Starting /dee2/code/volunteer_pipeline.sh SRR7172498 current disk space = 3058646552576 free memory = 1574616712 SRR7172498 SRAfilesize fecccb94a7cf701bc04646fd9c846fdd SRR7172498.sra SRR7172498.sra file validated SRR7172498 is paired end SRR7172498 is conventional basespace SRR7172498 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.679 34.0 33.0 34.0 33.0 34.0 2 33.356 34.0 34.0 34.0 33.0 34.0 3 33.42175 34.0 34.0 34.0 33.0 34.0 4 33.52575 34.0 34.0 34.0 33.0 34.0 5 33.5255 34.0 34.0 34.0 33.0 34.0 6 37.20175 38.0 38.0 38.0 36.0 38.0 7 37.4375 38.0 38.0 38.0 37.0 38.0 8 37.5785 38.0 38.0 38.0 38.0 38.0 9 37.63325 38.0 38.0 38.0 38.0 38.0 10-14 37.5681 38.0 38.0 38.0 38.0 38.0 15-19 37.57445 38.0 38.0 38.0 38.0 38.0 20-24 37.575900000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.52975 38.0 38.0 38.0 38.0 38.0 30-34 37.531349999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.473299999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.229949999999995 38.0 38.0 38.0 36.6 38.0 45-49 37.177800000000005 38.0 38.0 38.0 36.4 38.0 50-54 37.071000000000005 38.0 38.0 38.0 36.0 38.0 55-59 37.05105 38.0 38.0 38.0 36.0 38.0 60-64 36.952549999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.9132 38.0 38.0 38.0 35.6 38.0 70-74 36.771100000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.6791 38.0 38.0 38.0 34.4 38.0 80-84 36.515100000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.375350000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.35305 38.0 38.0 38.0 34.0 38.0 95-99 36.182399999999994 38.0 37.4 38.0 33.4 38.0 100-104 35.9426 38.0 37.0 38.0 32.8 38.0 105-109 35.7933 38.0 37.0 38.0 32.0 38.0 110-114 35.34295 38.0 36.2 38.0 29.4 38.0 115-119 35.425200000000004 38.0 36.2 38.0 30.2 38.0 120-124 34.98075 38.0 35.6 38.0 28.2 38.0 125-129 34.7216 38.0 35.0 38.0 27.0 38.0 130-134 34.484750000000005 38.0 35.0 38.0 25.6 38.0 135-139 33.8976 38.0 34.2 38.0 22.6 38.0 140-144 33.0597 38.0 33.2 38.0 17.0 38.0 145-149 32.13895 38.0 32.2 38.0 13.0 38.0 150-151 27.603125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 3.0 15 6.0 16 1.0 17 3.0 18 2.0 19 6.0 20 3.0 21 4.0 22 8.0 23 11.0 24 11.0 25 16.0 26 23.0 27 19.0 28 31.0 29 42.0 30 49.0 31 65.0 32 100.0 33 110.0 34 182.0 35 299.0 36 868.0 37 2131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.056381342901076 13.634033828805741 7.560225525371604 38.749359302921576 2 20.200000000000003 20.625 36.1 23.075000000000003 3 20.1 24.65 26.775 28.475 4 23.35 33.825 21.575 21.25 5 22.55 36.7 22.825 17.925 6 17.724999999999998 35.8 26.674999999999997 19.8 7 14.625 22.45 44.35 18.575 8 18.099999999999998 21.85 32.25 27.800000000000004 9 17.474999999999998 21.675 33.975 26.875 10-14 20.3 29.01 26.615 24.075 15-19 20.355 28.1 27.675 23.87 20-24 20.14 28.095 28.49 23.275000000000002 25-29 20.235 28.425 27.810000000000002 23.53 30-34 19.919999999999998 28.449999999999996 27.860000000000003 23.77 35-39 19.869999999999997 28.865000000000002 27.310000000000002 23.955000000000002 40-44 20.68 28.439999999999998 27.334999999999997 23.544999999999998 45-49 20.424999999999997 28.605000000000004 27.27 23.7 50-54 20.025000000000002 28.88 27.565 23.53 55-59 20.935000000000002 28.749999999999996 26.58 23.735 60-64 20.21 28.384999999999998 27.87 23.535 65-69 20.95 27.900000000000002 27.27 23.880000000000003 70-74 20.435 28.83 27.375 23.36 75-79 20.385 28.355000000000004 27.939999999999998 23.32 80-84 20.375 28.720000000000002 27.425 23.48 85-89 20.64 28.205000000000002 27.860000000000003 23.294999999999998 90-94 20.365 28.515 27.265 23.855 95-99 21.085 28.155 27.785 22.975 100-104 20.760570427820866 27.935951963972975 28.10607955966975 23.197398048536403 105-109 20.807080708070806 27.92279227922792 27.522752275227525 23.74737473747375 110-114 20.88759767581647 28.471248246844322 27.384291725105193 23.25686235223402 115-119 21.317131713171317 28.79287928792879 26.667666766676668 23.22232223222322 120-124 20.880000000000003 27.794999999999998 27.889999999999997 23.435 125-129 20.74 28.025 27.534999999999997 23.7 130-134 21.285 28.444999999999997 27.115000000000002 23.155 135-139 21.38 27.889999999999997 27.229999999999997 23.5 140-144 21.36 28.884999999999998 26.525 23.23 145-149 21.375 28.449999999999996 26.58 23.595 150-151 21.2875 28.15 26.625 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 4.0 26 4.5 27 10.0 28 14.5 29 12.0 30 17.5 31 23.0 32 29.5 33 43.0 34 63.5 35 75.5 36 86.0 37 98.5 38 118.5 39 158.0 40 192.0 41 218.0 42 232.0 43 241.5 44 260.5 45 260.5 46 249.0 47 264.0 48 251.5 49 208.5 50 181.0 51 145.0 52 114.5 53 101.0 54 82.0 55 64.5 56 48.5 57 34.5 58 24.5 59 18.5 60 13.0 61 9.0 62 7.0 63 4.0 64 3.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.01 110-114 0.18 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.9749999999999996 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172498 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172498_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60625 33.0 33.0 34.0 32.0 34.0 2 32.77075 34.0 33.0 34.0 32.0 34.0 3 32.77375 34.0 33.0 34.0 32.0 34.0 4 32.65275 34.0 33.0 34.0 32.0 34.0 5 32.674 34.0 33.0 34.0 32.0 34.0 6 36.8115 38.0 38.0 38.0 36.0 38.0 7 36.82975 38.0 38.0 38.0 36.0 38.0 8 36.915 38.0 38.0 38.0 37.0 38.0 9 36.82 38.0 38.0 38.0 36.0 38.0 10-14 36.873 38.0 38.0 38.0 36.6 38.0 15-19 36.9317 38.0 38.0 38.0 37.0 38.0 20-24 36.8948 38.0 38.0 38.0 37.0 38.0 25-29 36.939750000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.855199999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.765049999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.827 38.0 38.0 38.0 36.8 38.0 45-49 36.733349999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.73455 38.0 38.0 38.0 36.2 38.0 55-59 36.7092 38.0 38.0 38.0 36.2 38.0 60-64 36.5919 38.0 38.0 38.0 35.8 38.0 65-69 36.48915 38.0 38.0 38.0 35.4 38.0 70-74 36.51565000000001 38.0 38.0 38.0 35.2 38.0 75-79 36.39855000000001 38.0 38.0 38.0 35.0 38.0 80-84 36.3012 38.0 38.0 38.0 34.4 38.0 85-89 36.2367 38.0 38.0 38.0 34.0 38.0 90-94 36.0681 38.0 38.0 38.0 33.8 38.0 95-99 35.90345 38.0 38.0 38.0 33.4 38.0 100-104 35.72965 38.0 38.0 38.0 33.0 38.0 105-109 35.68915 38.0 38.0 38.0 33.0 38.0 110-114 35.3836 38.0 37.2 38.0 31.0 38.0 115-119 35.126250000000006 38.0 37.0 38.0 29.0 38.0 120-124 34.88115 38.0 36.2 38.0 28.0 38.0 125-129 34.5993 38.0 36.0 38.0 26.2 38.0 130-134 34.16845 38.0 35.2 38.0 23.0 38.0 135-139 33.668150000000004 38.0 34.0 38.0 21.4 38.0 140-144 32.95405000000001 38.0 33.0 38.0 13.8 38.0 145-149 32.02975 38.0 33.0 38.0 10.8 38.0 150-151 27.76475 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 3.0 4 0.0 5 3.0 6 2.0 7 2.0 8 2.0 9 1.0 10 3.0 11 1.0 12 2.0 13 6.0 14 4.0 15 7.0 16 8.0 17 9.0 18 4.0 19 11.0 20 11.0 21 6.0 22 11.0 23 19.0 24 23.0 25 24.0 26 24.0 27 14.0 28 35.0 29 30.0 30 47.0 31 54.0 32 61.0 33 116.0 34 120.0 35 259.0 36 543.0 37 2507.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.11401963251951 18.827082808960483 13.239365718600554 28.819531839919456 2 24.968537628995723 25.874653913918955 33.09841429650138 16.05839416058394 3 21.052631578947366 27.19717955175019 30.219088390833544 21.5311004784689 4 23.570888944850164 37.093930999748174 21.480735331150843 17.85444472425082 5 22.437673130193904 37.093930999748174 22.76504658776127 17.703349282296653 6 19.557566616390147 36.85268979386627 25.13826043237808 18.451483157365512 7 18.259557344064387 18.033199195171026 42.95774647887324 20.74949698189135 8 18.712273641851105 24.673038229376257 29.47686116700201 27.13782696177062 9 22.1579476861167 24.245472837022135 29.82897384305835 23.767605633802816 10-14 22.76659959758551 28.2645875251509 26.820925553319917 22.147887323943664 15-19 22.48038624019312 27.534701267350638 28.646147656407162 21.338764836049084 20-24 22.333417148604475 27.774704551169222 28.166960020115667 21.724918280110636 25-29 22.659627953745602 27.933634992458522 28.185017596782302 21.221719457013574 30-34 22.78347406513872 27.94028950542823 28.116204262163247 21.1600321672698 35-39 22.804283344226032 27.90709366044945 27.716052486048966 21.57257050927555 40-44 22.73413137511317 27.98008248667136 28.16618046474198 21.119605673473494 45-49 22.806841046277665 28.324949698189133 27.585513078470825 21.282696177062373 50-54 22.922535211267604 27.70120724346076 27.842052313883297 21.534205231388327 55-59 22.07642031171443 28.275515334338863 28.01407742584213 21.633986928104576 60-64 23.01543411593183 27.147956362173847 28.54054597556684 21.296063546327485 65-69 23.040941555175536 27.552560104617243 27.87445930992858 21.532039030278643 70-74 22.71515517328102 27.453347417131933 27.89598108747045 21.935516322116595 75-79 23.417307789007893 27.213757731181175 28.12892844571831 21.240006034092623 80-84 22.58389092921467 27.98712079287619 28.33425567238517 21.094732605523973 85-89 23.090076950158426 27.219232510184582 28.62244128149676 21.068249258160236 90-94 22.919392170675255 27.664284995471473 28.273120660159 21.143202173694274 95-99 23.703144654088053 27.753459119496853 27.838993710691824 20.70440251572327 100-104 22.676056338028168 27.565392354124747 28.3953722334004 21.36317907444668 105-109 22.881142799657965 27.423167848699766 28.544841808762133 21.150847542880136 110-114 23.100915585068922 27.703994365630347 28.3579837005735 20.837106348727236 115-119 23.768801247547664 27.491322501131847 27.92897027013431 20.810905981186174 120-124 24.059545363106015 27.79118889559445 27.63528465097566 20.51398109032388 125-129 23.64569186660631 27.85071173482219 27.89598108747045 20.607615311101053 130-134 24.265888978278358 27.509050683829443 27.56436041834272 20.660699919549476 135-139 24.200522928399035 27.493966210780368 27.212389380530972 21.09312148028962 140-144 24.221696927023086 28.23014635618367 27.09349695719962 20.45465975959362 145-149 24.58373157603501 28.180491976457567 27.19955732179687 20.03621912571055 150-151 24.77364185110664 28.143863179074447 26.886317907444667 20.196177062374247 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 20.0 1 10.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 1.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 2.0 25 3.0 26 3.5 27 5.0 28 9.5 29 12.5 30 18.0 31 23.5 32 27.5 33 40.5 34 50.0 35 63.5 36 89.5 37 117.0 38 147.0 39 175.0 40 196.0 41 195.0 42 223.0 43 253.5 44 254.0 45 264.0 46 258.5 47 233.0 48 219.0 49 218.5 50 181.0 51 137.5 52 118.5 53 102.0 54 88.5 55 67.0 56 41.5 57 35.5 58 31.5 59 21.0 60 16.5 61 10.5 62 6.5 63 3.5 64 1.5 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.675 3 0.7250000000000001 4 0.7250000000000001 5 0.7250000000000001 6 0.5499999999999999 7 0.6 8 0.6 9 0.6 10-14 0.6 15-19 0.58 20-24 0.575 25-29 0.5499999999999999 30-34 0.52 35-39 0.545 40-44 0.59 45-49 0.6 50-54 0.6 55-59 0.5499999999999999 60-64 0.545 65-69 0.59 70-74 0.5950000000000001 75-79 0.565 80-84 0.615 85-89 0.585 90-94 0.63 95-99 0.625 100-104 0.6 105-109 0.5950000000000001 110-114 0.61 115-119 0.605 120-124 0.58 125-129 0.5950000000000001 130-134 0.5599999999999999 135-139 0.5599999999999999 140-144 0.585 145-149 0.605 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00964956830879 97.475 2 0.8633824276282377 1.7000000000000002 3 0.050787201625190445 0.15 4 0.050787201625190445 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025393600812595223 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 19 0.475 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.75 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTAC 10 0.006795571 145.22784 6 TCAGGTC 10 0.006795571 145.22784 7 >>END_MODULE Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 986003 spots for SRR7172498.sra Written 986003 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra Read 985994 spots for SRR7172498.sra Written 985994 spots for SRR7172498.sra SRR ids: ['SRR7172498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kmqi04p8 SRR7172498.sra spots: 19719889 blocks: [[1, 985994], [985995, 1971988], [1971989, 2957982], [2957983, 3943976], [3943977, 4929970], [4929971, 5915964], [5915965, 6901958], [6901959, 7887952], [7887953, 8873946], [8873947, 9859940], [9859941, 10845934], [10845935, 11831928], [11831929, 12817922], [12817923, 13803916], [13803917, 14789910], [14789911, 15775904], [15775905, 16761898], [16761899, 17747892], [17747893, 18733886], [18733887, 19719889]] SRR7172498 file size 6660722 SRR7172498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172498 SRR7172498_1.fastq SRR7172498_2.fastq Input file: SRR7172498_1.fastq Paired file: SRR7172498_2.fastq trimmed: SRR7172498-trimmed-pair1.fastq, SRR7172498-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:46:30 2025 >> started Mon Feb 10 12:46:52 2025 >> done (22.499s) 19719889 read pairs processed; of these: 23943 ( 0.12%) short read pairs filtered out after trimming by size control 130424 ( 0.66%) empty read pairs filtered out after trimming by size control 19565522 (99.22%) read pairs available; of these: 10250063 (52.39%) trimmed read pairs available after processing 9315459 (47.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 13 0.00% 25 5 0.00% 26 10 0.00% 27 15 0.00% 28 10 0.00% 29 11 0.00% 30 14 0.00% 31 13 0.00% 32 13 0.00% 33 12 0.00% 34 16 0.00% 35 19 0.00% 36 25 0.00% 37 29 0.00% 38 28 0.00% 39 22 0.00% 40 21 0.00% 41 26 0.00% 42 35 0.00% 43 30 0.00% 44 46 0.00% 45 40 0.00% 46 42 0.00% 47 48 0.00% 48 66 0.00% 49 71 0.00% 50 88 0.00% 51 120 0.00% 52 124 0.00% 53 131 0.00% 54 139 0.00% 55 146 0.00% 56 152 0.00% 57 196 0.00% 58 238 0.00% 59 233 0.00% 60 299 0.00% 61 324 0.00% 62 382 0.00% 63 457 0.00% 64 522 0.00% 65 483 0.00% 66 622 0.00% 67 667 0.00% 68 787 0.00% 69 960 0.00% 70 1175 0.01% 71 1198 0.01% 72 1303 0.01% 73 1468 0.01% 74 1628 0.01% 75 1849 0.01% 76 1990 0.01% 77 2188 0.01% 78 2403 0.01% 79 2771 0.01% 80 3082 0.02% 81 3578 0.02% 82 3920 0.02% 83 4398 0.02% 84 5555 0.03% 85 6582 0.03% 86 6854 0.04% 87 7323 0.04% 88 7828 0.04% 89 8392 0.04% 90 9111 0.05% 91 9817 0.05% 92 10328 0.05% 93 11568 0.06% 94 12628 0.06% 95 12534 0.06% 96 13121 0.07% 97 13826 0.07% 98 14384 0.07% 99 15340 0.08% 100 16238 0.08% 101 17131 0.09% 102 18261 0.09% 103 19081 0.10% 104 20121 0.10% 105 21216 0.11% 106 22525 0.12% 107 23349 0.12% 108 24290 0.12% 109 25232 0.13% 110 26382 0.13% 111 27633 0.14% 112 29035 0.15% 113 30539 0.16% 114 32231 0.16% 115 33368 0.17% 116 34947 0.18% 117 36351 0.19% 118 37676 0.19% 119 39013 0.20% 120 40748 0.21% 121 42414 0.22% 122 44123 0.23% 123 46437 0.24% 124 49339 0.25% 125 51175 0.26% 126 53804 0.27% 127 55601 0.28% 128 57339 0.29% 129 60812 0.31% 130 63948 0.33% 131 66209 0.34% 132 70118 0.36% 133 73548 0.38% 134 78194 0.40% 135 82948 0.42% 136 89049 0.46% 137 95092 0.49% 138 100827 0.52% 139 109274 0.56% 140 118260 0.60% 141 129362 0.66% 142 143417 0.73% 143 163465 0.84% 144 192793 0.99% 145 228112 1.17% 146 286381 1.46% 147 386207 1.97% 148 582090 2.98% 149 1131134 5.78% 150 4817293 24.62% 151 9315459 47.61% 19565522 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=10 prefix-density=0.58 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=16.99 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=7.7 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=24 prefix-density=0.68 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=37.72 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.8 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7172498 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:47:43 Started mapping on | Feb 10 12:47:43 Finished on | Feb 10 12:49:58 Mapping speed, Million of reads per hour | 521.75 Number of input reads | 19565522 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18404301 Uniquely mapped reads % | 94.06% Average mapped length | 293.23 Number of splices: Total | 17832942 Number of splices: Annotated (sjdb) | 17471698 Number of splices: GT/AG | 17463150 Number of splices: GC/AG | 309021 Number of splices: AT/AC | 8946 Number of splices: Non-canonical | 51825 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 520206 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 62563 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660424 660424 660424 N_multimapping 520206 520206 520206 N_noFeature 719145 18118752 855742 N_ambiguous 262268 1132 112591 UnstrandedReadsAssigned:17422888 PositiveStrandReadsAssigned:284417 NegativeStrandReadsAssigned:17435968 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172498 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172498-trimmed-pair1.fastq SRR7172498-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,565,522 reads, 17,419,446 reads pseudoaligned [quant] estimated average fragment length: 245.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,322 rounds 52401 SRR7172498.ke.tsv 34699 SRR7172498.se.tsv 87100 total ==> SRR7172498.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.32 616 19.8792 Potri.005G024800.1.v4.1 1035 790.324 219 15.8579 Potri.004G059700.1.v4.1 961 716.415 1 0.0798806 Potri.007G009000.2.v4.1 1416 1171.32 0 0 Potri.003G141000.2.v4.1 2943 2698.32 1132 24.0081 Potri.016G087400.1.v4.1 270 81.0134 626.441 442.516 Potri.015G069301.1.v4.1 564 326.529 0 0 Potri.010G195200.1.v4.1 1773 1528.32 30 1.12334 Potri.012G127500.1.v4.1 977 732.357 130 10.1584 ==> SRR7172498.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1039 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7172498 completed mapping pipeline successfully