Starting /dee2/code/volunteer_pipeline.sh SRR7172499 current disk space = 3058796343296 free memory = 1574528524 SRR7172499 SRAfilesize 684d8d32fca026ca27b3345fbcab2ef1 SRR7172499.sra SRR7172499.sra file validated SRR7172499 is paired end SRR7172499 is conventional basespace SRR7172499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44775 34.0 33.0 34.0 32.0 34.0 2 33.249 34.0 33.0 34.0 32.0 34.0 3 33.30125 34.0 33.0 34.0 32.0 34.0 4 33.42675 34.0 33.0 34.0 33.0 34.0 5 33.174 34.0 33.0 34.0 33.0 34.0 6 37.09075 38.0 37.0 38.0 36.0 38.0 7 37.47025 38.0 38.0 38.0 37.0 38.0 8 37.5215 38.0 38.0 38.0 37.0 38.0 9 37.42525 38.0 38.0 38.0 37.0 38.0 10-14 37.406 38.0 38.0 38.0 37.0 38.0 15-19 37.220150000000004 38.0 38.0 38.0 36.8 38.0 20-24 37.12405 38.0 38.0 38.0 36.4 38.0 25-29 37.3313 38.0 38.0 38.0 37.0 38.0 30-34 37.2292 38.0 38.0 38.0 36.8 38.0 35-39 37.07315 38.0 38.0 38.0 36.2 38.0 40-44 37.16395 38.0 38.0 38.0 36.0 38.0 45-49 36.7879 38.0 38.0 38.0 35.2 38.0 50-54 37.093849999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.06425 38.0 38.0 38.0 36.0 38.0 60-64 37.031549999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.89345000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.5516 38.0 38.0 38.0 34.2 38.0 75-79 36.6243 38.0 37.8 38.0 34.6 38.0 80-84 36.394450000000006 38.0 37.4 38.0 33.8 38.0 85-89 36.2724 38.0 37.4 38.0 32.4 38.0 90-94 35.89245 38.0 36.8 38.0 31.2 38.0 95-99 36.355549999999994 38.0 37.2 38.0 34.0 38.0 100-104 36.253600000000006 38.0 37.0 38.0 33.6 38.0 105-109 35.8742 38.0 36.8 38.0 32.2 38.0 110-114 35.73665 38.0 36.8 38.0 31.4 38.0 115-119 35.392100000000006 38.0 36.0 38.0 30.0 38.0 120-124 35.26975 38.0 35.8 38.0 29.0 38.0 125-129 35.0461 38.0 35.4 38.0 28.4 38.0 130-134 34.63935 38.0 35.0 38.0 27.4 38.0 135-139 33.968849999999996 38.0 34.4 38.0 23.8 38.0 140-144 32.91305 38.0 33.6 38.0 17.0 38.0 145-149 31.453049999999998 36.0 31.2 38.0 11.4 38.0 150-151 28.134 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 2.0 17 0.0 18 3.0 19 4.0 20 3.0 21 6.0 22 9.0 23 14.0 24 9.0 25 10.0 26 26.0 27 24.0 28 28.0 29 52.0 30 56.0 31 60.0 32 104.0 33 130.0 34 218.0 35 411.0 36 907.0 37 1918.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.276004119464474 15.80844490216272 8.54788877445932 33.36766220391349 2 21.975 18.425 34.925 24.675 3 18.875 24.349999999999998 27.625 29.15 4 21.875 32.675 23.275000000000002 22.175 5 22.325 35.9 22.8 18.975 6 18.075 34.775 26.125 21.025 7 13.925 23.150000000000002 45.050000000000004 17.875 8 17.45 23.875 30.925000000000004 27.750000000000004 9 17.0 24.224999999999998 32.75 26.025 10-14 20.145 29.4 26.634999999999998 23.82 15-19 20.369999999999997 28.134999999999998 27.82 23.674999999999997 20-24 20.035 28.765 27.755000000000003 23.445 25-29 20.119999999999997 28.735 27.76 23.385 30-34 20.43 28.67 27.43 23.47 35-39 19.97 28.925 27.665 23.44 40-44 20.29 28.560000000000002 27.48 23.669999999999998 45-49 20.145 28.83 27.365000000000002 23.66 50-54 20.335 28.49 27.425 23.75 55-59 20.27 28.76 27.284999999999997 23.685000000000002 60-64 20.32 28.88 27.095000000000002 23.705000000000002 65-69 20.79 28.310000000000002 27.284999999999997 23.615 70-74 20.36 28.705000000000002 27.48 23.455000000000002 75-79 20.044999999999998 28.185 28.115000000000002 23.655 80-84 20.755000000000003 28.285 27.725 23.235 85-89 20.635 28.505000000000003 27.310000000000002 23.549999999999997 90-94 20.325 28.065 27.46 24.15 95-99 20.48 28.365000000000002 27.505000000000003 23.65 100-104 20.75 28.355000000000004 27.339999999999996 23.555 105-109 20.195 28.01 27.639999999999997 24.154999999999998 110-114 20.955 28.139999999999997 27.529999999999998 23.375 115-119 20.724999999999998 27.805000000000003 28.000000000000004 23.47 120-124 20.775 28.060000000000002 27.43 23.735 125-129 20.765 28.23 27.065 23.94 130-134 20.3 28.17 27.455000000000002 24.075 135-139 21.185000000000002 27.97 27.615000000000002 23.23 140-144 21.0 27.98 27.325 23.695 145-149 21.255 28.255000000000003 27.084999999999997 23.405 150-151 20.5875 29.1125 26.237500000000004 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 4.0 24 5.5 25 4.5 26 5.0 27 8.5 28 12.0 29 14.5 30 18.5 31 23.0 32 33.0 33 41.0 34 57.5 35 79.5 36 91.5 37 106.0 38 131.0 39 154.0 40 176.0 41 204.5 42 246.5 43 268.5 44 266.0 45 258.5 46 244.0 47 242.0 48 229.5 49 199.5 50 173.5 51 151.5 52 131.5 53 107.0 54 77.5 55 54.5 56 43.0 57 35.0 58 26.5 59 20.0 60 12.5 61 9.0 62 9.5 63 6.5 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 4.949999999999999 0.0 0.0 0.0 0.0 134-135 5.35 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGAG 10 0.006832588 144.9875 3 CAGATTT 10 0.006832588 144.9875 3 >>END_MODULE SRR7172499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95475 33.0 33.0 34.0 32.0 34.0 2 33.08625 34.0 33.0 34.0 32.0 34.0 3 33.12825 34.0 33.0 34.0 33.0 34.0 4 33.1295 34.0 33.0 34.0 33.0 34.0 5 33.1385 34.0 33.0 34.0 33.0 34.0 6 37.241 38.0 38.0 38.0 37.0 38.0 7 37.3405 38.0 38.0 38.0 37.0 38.0 8 37.28175 38.0 38.0 38.0 37.0 38.0 9 37.04625 38.0 38.0 38.0 37.0 38.0 10-14 37.05985 38.0 38.0 38.0 36.8 38.0 15-19 37.191100000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.94865 38.0 38.0 38.0 36.2 38.0 25-29 36.814350000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.987350000000006 38.0 38.0 38.0 36.8 38.0 35-39 37.01625 38.0 38.0 38.0 36.6 38.0 40-44 36.79875 38.0 38.0 38.0 35.6 38.0 45-49 36.876850000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.63 38.0 37.8 38.0 35.0 38.0 55-59 36.857 38.0 38.0 38.0 36.0 38.0 60-64 36.86415 38.0 38.0 38.0 36.0 38.0 65-69 36.59824999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.6704 38.0 38.0 38.0 35.6 38.0 75-79 36.839650000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.6515 38.0 38.0 38.0 35.6 38.0 85-89 36.07365 38.0 37.8 38.0 33.0 38.0 90-94 36.47785 38.0 38.0 38.0 34.6 38.0 95-99 36.496249999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.094049999999996 38.0 37.4 38.0 33.2 38.0 105-109 36.09285 38.0 38.0 38.0 33.8 38.0 110-114 35.91445 38.0 37.4 38.0 32.8 38.0 115-119 35.88905 38.0 37.6 38.0 33.0 38.0 120-124 35.709950000000006 38.0 37.0 38.0 32.4 38.0 125-129 35.50045 38.0 36.8 38.0 31.8 38.0 130-134 34.62665 38.0 35.6 38.0 25.8 38.0 135-139 34.4669 38.0 35.0 38.0 25.4 38.0 140-144 34.15325 38.0 35.0 38.0 23.6 38.0 145-149 33.5152 38.0 34.2 38.0 20.2 38.0 150-151 29.683875 36.0 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 1.0 6 1.0 7 0.0 8 3.0 9 0.0 10 1.0 11 3.0 12 0.0 13 1.0 14 3.0 15 2.0 16 8.0 17 5.0 18 4.0 19 8.0 20 11.0 21 3.0 22 7.0 23 13.0 24 7.0 25 14.0 26 20.0 27 22.0 28 24.0 29 33.0 30 41.0 31 77.0 32 76.0 33 94.0 34 138.0 35 259.0 36 582.0 37 2525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.449999999999996 23.0 11.4 24.15 2 28.000000000000004 24.775 31.1 16.125 3 19.45 28.125 31.2 21.224999999999998 4 23.400000000000002 36.075 22.425 18.099999999999998 5 24.6 37.65 21.75 16.0 6 20.575 37.8 22.825 18.8 7 19.35 18.375 42.449999999999996 19.825 8 20.525 24.474999999999998 28.249999999999996 26.75 9 22.225 23.75 29.5 24.525 10-14 22.82 28.515 26.86 21.805 15-19 22.915 28.625 27.58 20.880000000000003 20-24 22.564999999999998 28.110000000000003 28.38 20.945 25-29 22.53 28.405 28.765 20.3 30-34 22.689999999999998 28.315 27.944999999999997 21.05 35-39 23.235 27.310000000000002 28.37 21.085 40-44 23.1 27.994999999999997 28.084999999999997 20.82 45-49 22.384999999999998 28.055000000000003 28.38 21.18 50-54 23.13 27.834999999999997 28.205000000000002 20.830000000000002 55-59 22.555 27.985 28.285 21.175 60-64 22.615 28.22 27.71 21.455 65-69 23.355 28.299999999999997 27.500000000000004 20.845 70-74 23.32 28.155 27.41 21.115000000000002 75-79 23.015 28.08 27.92 20.985 80-84 23.09 28.105000000000004 27.62 21.185000000000002 85-89 23.32 27.855 27.894999999999996 20.93 90-94 23.23 27.705000000000002 27.950000000000003 21.115000000000002 95-99 23.69 27.334999999999997 27.500000000000004 21.475 100-104 23.04 27.555000000000003 28.439999999999998 20.965 105-109 23.535 28.060000000000002 27.74 20.665 110-114 22.99 28.660000000000004 27.72 20.630000000000003 115-119 24.245 27.689999999999998 27.55 20.515 120-124 24.22 27.575 27.800000000000004 20.405 125-129 24.404999999999998 27.99 27.005000000000003 20.599999999999998 130-134 24.695 27.42 27.935 19.950000000000003 135-139 24.52 27.76 27.54 20.18 140-144 24.88 28.095 27.11 19.915 145-149 24.865000000000002 28.389999999999997 26.605 20.14 150-151 25.224999999999998 28.175 26.9125 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 5.0 26 10.0 27 10.5 28 12.0 29 14.0 30 15.0 31 22.5 32 30.0 33 45.0 34 65.0 35 81.5 36 89.0 37 103.0 38 121.5 39 145.0 40 189.0 41 228.5 42 245.5 43 243.5 44 256.5 45 273.0 46 262.0 47 246.0 48 224.0 49 205.0 50 167.5 51 133.5 52 126.0 53 101.5 54 88.0 55 74.5 56 48.5 57 28.0 58 20.5 59 16.0 60 11.5 61 12.5 62 11.0 63 7.0 64 3.0 65 1.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7063572149344097 1.4000000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.325 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.800000000000001 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAGC 10 0.006830828 145.0 2 GAAACCC 10 0.006830828 145.0 2 AGAAGCT 10 0.006830828 145.0 3 >>END_MODULE Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021642 spots for SRR7172499.sra Written 1021642 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra Read 1021626 spots for SRR7172499.sra Written 1021626 spots for SRR7172499.sra SRR ids: ['SRR7172499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s5g6i617 SRR7172499.sra spots: 20432536 blocks: [[1, 1021626], [1021627, 2043252], [2043253, 3064878], [3064879, 4086504], [4086505, 5108130], [5108131, 6129756], [6129757, 7151382], [7151383, 8173008], [8173009, 9194634], [9194635, 10216260], [10216261, 11237886], [11237887, 12259512], [12259513, 13281138], [13281139, 14302764], [14302765, 15324390], [15324391, 16346016], [16346017, 17367642], [17367643, 18389268], [18389269, 19410894], [19410895, 20432536]] SRR7172499 file size 6902215 SRR7172499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172499 SRR7172499_1.fastq SRR7172499_2.fastq Input file: SRR7172499_1.fastq Paired file: SRR7172499_2.fastq trimmed: SRR7172499-trimmed-pair1.fastq, SRR7172499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:01:43 2025 >> started Mon Feb 10 13:02:08 2025 >> done (24.923s) 20432536 read pairs processed; of these: 20428 ( 0.10%) short read pairs filtered out after trimming by size control 15151 ( 0.07%) empty read pairs filtered out after trimming by size control 20396957 (99.83%) read pairs available; of these: 9487997 (46.52%) trimmed read pairs available after processing 10908960 (53.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 12 0.00% 20 8 0.00% 21 15 0.00% 22 12 0.00% 23 13 0.00% 24 11 0.00% 25 10 0.00% 26 5 0.00% 27 7 0.00% 28 18 0.00% 29 21 0.00% 30 13 0.00% 31 17 0.00% 32 17 0.00% 33 15 0.00% 34 9 0.00% 35 23 0.00% 36 15 0.00% 37 21 0.00% 38 23 0.00% 39 21 0.00% 40 32 0.00% 41 29 0.00% 42 35 0.00% 43 50 0.00% 44 43 0.00% 45 53 0.00% 46 43 0.00% 47 52 0.00% 48 61 0.00% 49 97 0.00% 50 94 0.00% 51 85 0.00% 52 107 0.00% 53 118 0.00% 54 140 0.00% 55 154 0.00% 56 178 0.00% 57 195 0.00% 58 221 0.00% 59 267 0.00% 60 329 0.00% 61 378 0.00% 62 376 0.00% 63 418 0.00% 64 528 0.00% 65 550 0.00% 66 593 0.00% 67 670 0.00% 68 858 0.00% 69 1508 0.01% 70 1520 0.01% 71 1245 0.01% 72 1420 0.01% 73 1577 0.01% 74 1725 0.01% 75 1847 0.01% 76 2092 0.01% 77 2277 0.01% 78 2516 0.01% 79 2776 0.01% 80 3169 0.02% 81 3675 0.02% 82 4049 0.02% 83 4717 0.02% 84 6039 0.03% 85 7043 0.03% 86 7217 0.04% 87 7726 0.04% 88 8286 0.04% 89 8751 0.04% 90 9336 0.05% 91 10195 0.05% 92 10996 0.05% 93 11770 0.06% 94 12806 0.06% 95 13710 0.07% 96 13922 0.07% 97 14596 0.07% 98 15339 0.08% 99 16369 0.08% 100 17327 0.08% 101 17853 0.09% 102 19672 0.10% 103 20564 0.10% 104 21986 0.11% 105 22847 0.11% 106 23875 0.12% 107 24683 0.12% 108 25700 0.13% 109 26981 0.13% 110 27745 0.14% 111 29065 0.14% 112 30827 0.15% 113 32771 0.16% 114 33827 0.17% 115 36332 0.18% 116 37207 0.18% 117 38720 0.19% 118 39577 0.19% 119 40907 0.20% 120 42451 0.21% 121 43978 0.22% 122 45283 0.22% 123 48119 0.24% 124 50958 0.25% 125 52297 0.26% 126 55018 0.27% 127 56851 0.28% 128 58807 0.29% 129 61282 0.30% 130 63348 0.31% 131 65355 0.32% 132 69001 0.34% 133 72358 0.35% 134 76681 0.38% 135 80866 0.40% 136 85161 0.42% 137 90909 0.45% 138 97232 0.48% 139 103818 0.51% 140 110384 0.54% 141 119742 0.59% 142 131247 0.64% 143 147068 0.72% 144 167615 0.82% 145 198032 0.97% 146 243683 1.19% 147 325148 1.59% 148 485338 2.38% 149 933503 4.58% 150 4520716 22.16% 151 10908960 53.48% 20396957 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=18 fanout-score=21.04 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=8.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=68.63 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172499 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:02:54 Started mapping on | Feb 10 13:02:55 Finished on | Feb 10 13:05:13 Mapping speed, Million of reads per hour | 532.09 Number of input reads | 20396957 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19083113 Uniquely mapped reads % | 93.56% Average mapped length | 293.47 Number of splices: Total | 17604065 Number of splices: Annotated (sjdb) | 17217610 Number of splices: GT/AG | 17223819 Number of splices: GC/AG | 316845 Number of splices: AT/AC | 10982 Number of splices: Non-canonical | 52419 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 571011 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 71508 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764815 764815 764815 N_multimapping 571011 571011 571011 N_noFeature 748197 18735788 931186 N_ambiguous 297075 1439 131752 UnstrandedReadsAssigned:18037841 PositiveStrandReadsAssigned:345886 NegativeStrandReadsAssigned:18020175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172499-trimmed-pair1.fastq SRR7172499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,396,957 reads, 18,039,672 reads pseudoaligned [quant] estimated average fragment length: 252.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7172499.ke.tsv 34699 SRR7172499.se.tsv 87100 total ==> SRR7172499.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.7 530 16.0232 Potri.005G024800.1.v4.1 1035 783.704 90 6.13378 Potri.004G059700.1.v4.1 961 709.776 30 2.25755 Potri.007G009000.2.v4.1 1416 1164.7 0 0 Potri.003G141000.2.v4.1 2943 2691.7 782 15.5173 Potri.016G087400.1.v4.1 270 81.8794 703 458.584 Potri.015G069301.1.v4.1 564 321.28 0 0 Potri.010G195200.1.v4.1 1773 1521.7 16.5456 0.580752 Potri.012G127500.1.v4.1 977 725.746 236 17.3686 ==> SRR7172499.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 533 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 691 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR7172499 completed mapping pipeline successfully