Starting /dee2/code/volunteer_pipeline.sh SRR7172500 current disk space = 3058878787584 free memory = 1387929492 SRR7172500 SRAfilesize 079483e17f9a850384ce63d64435722d SRR7172500.sra SRR7172500.sra file validated SRR7172500 is paired end SRR7172500 is conventional basespace SRR7172500 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48475 34.0 33.0 34.0 32.0 34.0 2 33.215 34.0 33.0 34.0 32.0 34.0 3 33.308 34.0 33.0 34.0 32.0 34.0 4 33.387 34.0 33.0 34.0 33.0 34.0 5 33.17275 34.0 33.0 34.0 33.0 34.0 6 37.018 38.0 37.0 38.0 36.0 38.0 7 37.43375 38.0 38.0 38.0 37.0 38.0 8 37.57325 38.0 38.0 38.0 37.0 38.0 9 37.46775 38.0 38.0 38.0 38.0 38.0 10-14 37.36145 38.0 38.0 38.0 36.8 38.0 15-19 37.20555 38.0 38.0 38.0 36.8 38.0 20-24 37.1206 38.0 38.0 38.0 36.4 38.0 25-29 37.32925 38.0 38.0 38.0 37.0 38.0 30-34 37.183749999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.04205 38.0 38.0 38.0 36.0 38.0 40-44 37.1769 38.0 38.0 38.0 36.6 38.0 45-49 36.773 38.0 38.0 38.0 35.2 38.0 50-54 37.117149999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.12795 38.0 38.0 38.0 36.0 38.0 60-64 37.034000000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.950300000000006 38.0 38.0 38.0 35.8 38.0 70-74 36.6875 38.0 38.0 38.0 34.6 38.0 75-79 36.6558 38.0 38.0 38.0 34.6 38.0 80-84 36.383449999999996 38.0 37.8 38.0 34.0 38.0 85-89 36.3241 38.0 37.6 38.0 33.2 38.0 90-94 35.88975000000001 38.0 36.8 38.0 31.6 38.0 95-99 36.44685 38.0 38.0 38.0 34.0 38.0 100-104 36.364250000000006 38.0 37.8 38.0 33.8 38.0 105-109 36.029799999999994 38.0 37.0 38.0 32.4 38.0 110-114 35.91325 38.0 37.0 38.0 32.6 38.0 115-119 35.604600000000005 38.0 36.6 38.0 30.2 38.0 120-124 35.560950000000005 38.0 36.2 38.0 30.4 38.0 125-129 35.152750000000005 38.0 35.8 38.0 28.6 38.0 130-134 34.88105 38.0 35.0 38.0 28.0 38.0 135-139 34.2686 38.0 35.0 38.0 24.2 38.0 140-144 33.44605 38.0 34.2 38.0 20.2 38.0 145-149 31.814300000000003 37.2 32.6 38.0 11.4 38.0 150-151 28.607 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 1.0 20 3.0 21 7.0 22 5.0 23 10.0 24 4.0 25 15.0 26 16.0 27 25.0 28 42.0 29 43.0 30 64.0 31 84.0 32 98.0 33 139.0 34 171.0 35 328.0 36 777.0 37 2153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.08990495761624 14.92422296429489 7.474955047521192 27.510917030567683 2 22.475 17.474999999999998 34.825 25.224999999999998 3 18.175 26.150000000000002 27.825 27.85 4 22.125 32.85 24.375 20.65 5 22.525000000000002 35.699999999999996 23.474999999999998 18.3 6 18.025 34.325 25.6 22.05 7 14.524999999999999 23.1 44.95 17.424999999999997 8 16.3 23.674999999999997 33.6 26.424999999999997 9 17.625 23.325000000000003 32.800000000000004 26.25 10-14 20.395 29.86 26.284999999999997 23.46 15-19 19.705000000000002 28.470000000000002 27.584999999999997 24.240000000000002 20-24 19.689999999999998 29.03 27.6 23.68 25-29 19.735 28.315 28.24 23.71 30-34 19.335 29.28 28.144999999999996 23.24 35-39 19.82 29.099999999999998 27.46 23.62 40-44 19.78 29.049999999999997 27.215 23.955000000000002 45-49 20.044999999999998 28.96 27.27 23.724999999999998 50-54 20.13 28.799999999999997 27.67 23.400000000000002 55-59 19.919999999999998 28.689999999999998 28.065 23.325000000000003 60-64 19.814999999999998 28.994999999999997 27.189999999999998 24.0 65-69 19.825 28.015 28.055000000000003 24.104999999999997 70-74 20.23 28.144999999999996 27.805000000000003 23.82 75-79 20.44 28.12 27.74 23.7 80-84 20.225 28.255000000000003 27.505000000000003 24.015 85-89 20.73 28.99 27.095000000000002 23.185 90-94 20.605 28.285 27.500000000000004 23.61 95-99 20.68 28.575 27.395000000000003 23.35 100-104 20.255000000000003 29.325000000000003 27.195000000000004 23.225 105-109 21.044999999999998 28.299999999999997 27.395000000000003 23.26 110-114 20.075000000000003 28.605000000000004 27.435 23.885 115-119 20.955 28.435 27.205000000000002 23.405 120-124 20.865000000000002 28.610000000000003 27.139999999999997 23.385 125-129 21.135 28.1 27.250000000000004 23.515 130-134 20.724999999999998 28.560000000000002 27.215 23.5 135-139 21.18 28.525 26.56 23.735 140-144 20.905 28.42 27.1 23.575 145-149 20.94 28.689999999999998 26.365 24.005000000000003 150-151 21.4875 29.1625 25.6 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 1.5 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 3.0 21 3.0 22 1.5 23 2.5 24 4.0 25 6.5 26 6.5 27 6.5 28 9.0 29 13.5 30 18.0 31 27.0 32 39.0 33 48.5 34 67.5 35 80.5 36 83.5 37 106.0 38 138.5 39 163.5 40 180.5 41 202.0 42 242.5 43 255.5 44 249.5 45 247.0 46 256.5 47 261.5 48 241.0 49 199.0 50 160.5 51 136.5 52 106.0 53 89.5 54 76.5 55 72.5 56 64.5 57 39.5 58 20.0 59 17.0 60 16.0 61 9.5 62 5.0 63 2.5 64 2.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 6.887499999999999 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 7.6375 0.0 0.0 0.0 0.0 138-139 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCACC 10 0.006836113 144.9625 9 >>END_MODULE SRR7172500 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172500_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89275 33.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 33.06525 34.0 33.0 34.0 32.0 34.0 4 33.055 34.0 33.0 34.0 33.0 34.0 5 33.04475 34.0 33.0 34.0 32.0 34.0 6 37.201 38.0 38.0 38.0 37.0 38.0 7 37.10675 38.0 38.0 38.0 37.0 38.0 8 37.12325 38.0 38.0 38.0 37.0 38.0 9 36.9035 38.0 38.0 38.0 36.0 38.0 10-14 36.9202 38.0 38.0 38.0 36.6 38.0 15-19 37.079449999999994 38.0 38.0 38.0 37.0 38.0 20-24 36.76625 38.0 38.0 38.0 35.6 38.0 25-29 36.6828 38.0 38.0 38.0 35.6 38.0 30-34 36.874900000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.8891 38.0 38.0 38.0 36.2 38.0 40-44 36.637800000000006 38.0 38.0 38.0 35.6 38.0 45-49 36.721199999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.486900000000006 38.0 38.0 38.0 34.0 38.0 55-59 36.7302 38.0 38.0 38.0 35.8 38.0 60-64 36.708800000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.437200000000004 38.0 38.0 38.0 34.2 38.0 70-74 36.500099999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.641999999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.4971 38.0 38.0 38.0 35.0 38.0 85-89 35.85145 38.0 37.4 38.0 31.4 38.0 90-94 36.2365 38.0 38.0 38.0 33.8 38.0 95-99 36.2907 38.0 38.0 38.0 34.0 38.0 100-104 35.8603 38.0 37.4 38.0 31.8 38.0 105-109 35.898300000000006 38.0 37.8 38.0 33.0 38.0 110-114 35.67385 38.0 37.4 38.0 31.4 38.0 115-119 35.6954 38.0 37.0 38.0 31.8 38.0 120-124 35.4364 38.0 37.0 38.0 30.6 38.0 125-129 35.209199999999996 38.0 36.2 38.0 29.4 38.0 130-134 34.4141 38.0 35.4 38.0 25.2 38.0 135-139 34.19885000000001 38.0 35.0 38.0 23.4 38.0 140-144 33.98035 38.0 35.0 38.0 23.0 38.0 145-149 33.15840000000001 38.0 34.0 38.0 16.4 38.0 150-151 29.457875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 2.0 5 0.0 6 4.0 7 0.0 8 4.0 9 2.0 10 3.0 11 2.0 12 6.0 13 2.0 14 2.0 15 5.0 16 1.0 17 3.0 18 7.0 19 4.0 20 14.0 21 8.0 22 7.0 23 9.0 24 22.0 25 21.0 26 21.0 27 24.0 28 30.0 29 39.0 30 53.0 31 58.0 32 79.0 33 100.0 34 164.0 35 267.0 36 557.0 37 2469.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.575 24.2 9.1 20.125 2 26.700000000000003 25.224999999999998 30.55 17.525 3 20.9 27.35 31.900000000000002 19.85 4 23.35 35.925000000000004 24.05 16.675 5 23.575 38.525 21.2 16.7 6 19.650000000000002 39.175 23.0 18.175 7 20.025000000000002 20.275000000000002 39.800000000000004 19.900000000000002 8 20.375 24.175 29.049999999999997 26.400000000000002 9 21.5 24.85 29.025000000000002 24.625 10-14 23.580000000000002 28.465 26.450000000000003 21.505 15-19 22.830000000000002 28.694999999999997 27.465 21.01 20-24 22.91 28.22 27.83 21.04 25-29 22.535 28.555000000000003 27.805000000000003 21.105 30-34 22.945 27.845 27.905 21.305 35-39 23.11 27.400000000000002 28.78 20.71 40-44 23.22 27.650000000000002 28.410000000000004 20.72 45-49 22.755 27.310000000000002 28.375 21.560000000000002 50-54 22.6 27.77 28.449999999999996 21.18 55-59 23.75 27.735 27.994999999999997 20.52 60-64 23.235 27.405 28.875 20.485 65-69 23.035 27.474999999999998 28.63 20.86 70-74 22.82 27.985 27.975 21.22 75-79 23.3 27.87 27.985 20.845 80-84 23.87 27.689999999999998 27.474999999999998 20.965 85-89 23.335 28.439999999999998 27.425 20.8 90-94 23.965 27.41 27.565 21.060000000000002 95-99 23.75 27.644999999999996 28.485 20.119999999999997 100-104 23.945 27.605 27.485 20.965 105-109 23.665 27.605 27.900000000000002 20.830000000000002 110-114 23.9 28.155 27.43 20.515 115-119 24.355 28.075 27.27 20.3 120-124 24.795 27.060000000000002 27.775 20.369999999999997 125-129 24.044999999999998 27.250000000000004 27.73 20.974999999999998 130-134 24.87 27.79 27.655 19.685 135-139 24.755 28.060000000000002 27.134999999999998 20.05 140-144 24.825 27.77 27.275 20.13 145-149 25.445 28.000000000000004 27.02 19.535 150-151 25.7 27.8375 26.424999999999997 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 1.0 23 0.5 24 2.0 25 4.5 26 5.5 27 4.5 28 8.0 29 12.0 30 12.5 31 21.5 32 28.0 33 31.5 34 48.0 35 68.5 36 81.5 37 114.0 38 141.0 39 156.0 40 183.5 41 227.0 42 271.0 43 270.0 44 266.5 45 265.5 46 257.0 47 248.0 48 212.5 49 192.5 50 181.5 51 155.0 52 123.5 53 94.5 54 78.0 55 59.5 56 44.0 57 34.5 58 25.0 59 19.5 60 16.0 61 10.0 62 6.5 63 4.0 64 2.5 65 1.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83307965499746 97.39999999999999 2 0.989345509893455 1.95 3 0.12683916793505834 0.375 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025367833587011668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.525 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.862500000000001 0.0 0.0 0.0 0.0 134-135 7.262499999999999 0.0 0.0 0.0 0.0 136-137 7.6875 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 929012 spots for SRR7172500.sra Written 929012 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra Read 928999 spots for SRR7172500.sra Written 928999 spots for SRR7172500.sra SRR ids: ['SRR7172500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ntg6zvhf SRR7172500.sra spots: 18579993 blocks: [[1, 928999], [929000, 1857998], [1857999, 2786997], [2786998, 3715996], [3715997, 4644995], [4644996, 5573994], [5573995, 6502993], [6502994, 7431992], [7431993, 8360991], [8360992, 9289990], [9289991, 10218989], [10218990, 11147988], [11147989, 12076987], [12076988, 13005986], [13005987, 13934985], [13934986, 14863984], [14863985, 15792983], [15792984, 16721982], [16721983, 17650981], [17650982, 18579993]] SRR7172500 file size 6274449 SRR7172500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172500 SRR7172500_1.fastq SRR7172500_2.fastq Input file: SRR7172500_1.fastq Paired file: SRR7172500_2.fastq trimmed: SRR7172500-trimmed-pair1.fastq, SRR7172500-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:13:29 2025 >> started Mon Feb 10 13:13:50 2025 >> done (20.404s) 18579993 read pairs processed; of these: 29235 ( 0.16%) short read pairs filtered out after trimming by size control 24142 ( 0.13%) empty read pairs filtered out after trimming by size control 18526616 (99.71%) read pairs available; of these: 8715668 (47.04%) trimmed read pairs available after processing 9810948 (52.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 7 0.00% 20 6 0.00% 21 14 0.00% 22 9 0.00% 23 14 0.00% 24 14 0.00% 25 11 0.00% 26 13 0.00% 27 21 0.00% 28 15 0.00% 29 15 0.00% 30 17 0.00% 31 20 0.00% 32 9 0.00% 33 12 0.00% 34 15 0.00% 35 27 0.00% 36 23 0.00% 37 16 0.00% 38 38 0.00% 39 29 0.00% 40 34 0.00% 41 48 0.00% 42 35 0.00% 43 47 0.00% 44 49 0.00% 45 46 0.00% 46 52 0.00% 47 64 0.00% 48 71 0.00% 49 100 0.00% 50 91 0.00% 51 124 0.00% 52 126 0.00% 53 143 0.00% 54 167 0.00% 55 171 0.00% 56 186 0.00% 57 218 0.00% 58 283 0.00% 59 282 0.00% 60 333 0.00% 61 377 0.00% 62 404 0.00% 63 479 0.00% 64 511 0.00% 65 638 0.00% 66 690 0.00% 67 792 0.00% 68 962 0.01% 69 1552 0.01% 70 1685 0.01% 71 1387 0.01% 72 1510 0.01% 73 1693 0.01% 74 1817 0.01% 75 2070 0.01% 76 2260 0.01% 77 2434 0.01% 78 2792 0.02% 79 3206 0.02% 80 3561 0.02% 81 4047 0.02% 82 4579 0.02% 83 5263 0.03% 84 6922 0.04% 85 8022 0.04% 86 8436 0.05% 87 9128 0.05% 88 9450 0.05% 89 10002 0.05% 90 10849 0.06% 91 11626 0.06% 92 12710 0.07% 93 13569 0.07% 94 14421 0.08% 95 15414 0.08% 96 16242 0.09% 97 16785 0.09% 98 17561 0.09% 99 18541 0.10% 100 19806 0.11% 101 20904 0.11% 102 22360 0.12% 103 23483 0.13% 104 24807 0.13% 105 26400 0.14% 106 27248 0.15% 107 28215 0.15% 108 29360 0.16% 109 30509 0.16% 110 31783 0.17% 111 33393 0.18% 112 34569 0.19% 113 36921 0.20% 114 38055 0.21% 115 39980 0.22% 116 41825 0.23% 117 42517 0.23% 118 43738 0.24% 119 45091 0.24% 120 46776 0.25% 121 48457 0.26% 122 50009 0.27% 123 52802 0.29% 124 55930 0.30% 125 57119 0.31% 126 60119 0.32% 127 61245 0.33% 128 63175 0.34% 129 65404 0.35% 130 66909 0.36% 131 68844 0.37% 132 72607 0.39% 133 75371 0.41% 134 79818 0.43% 135 84382 0.46% 136 88218 0.48% 137 93146 0.50% 138 98263 0.53% 139 103738 0.56% 140 108759 0.59% 141 116804 0.63% 142 126954 0.69% 143 140806 0.76% 144 159312 0.86% 145 183734 0.99% 146 221946 1.20% 147 288685 1.56% 148 417071 2.25% 149 785003 4.24% 150 3885881 20.97% 151 9810948 52.96% 18526616 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=298.46 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=13 prefix-density=0.47 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.12 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7172500 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:14:43 Started mapping on | Feb 10 13:14:44 Finished on | Feb 10 13:17:01 Mapping speed, Million of reads per hour | 486.83 Number of input reads | 18526616 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17020312 Uniquely mapped reads % | 91.87% Average mapped length | 292.07 Number of splices: Total | 16336736 Number of splices: Annotated (sjdb) | 15976462 Number of splices: GT/AG | 16016929 Number of splices: GC/AG | 253354 Number of splices: AT/AC | 9415 Number of splices: Non-canonical | 57038 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481550 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 109345 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.82% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1052794 1052794 1052794 N_multimapping 481550 481550 481550 N_noFeature 593808 16704010 729186 N_ambiguous 306402 1352 124646 UnstrandedReadsAssigned:16120102 PositiveStrandReadsAssigned:314950 NegativeStrandReadsAssigned:16166480 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172500 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172500-trimmed-pair1.fastq SRR7172500-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,526,616 reads, 16,156,964 reads pseudoaligned [quant] estimated average fragment length: 241.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7172500.ke.tsv 34699 SRR7172500.se.tsv 87100 total ==> SRR7172500.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.55 934 28.3556 Potri.005G024800.1.v4.1 1035 794.546 237 16.0969 Potri.004G059700.1.v4.1 961 720.658 10 0.748829 Potri.007G009000.2.v4.1 1416 1175.55 0 0 Potri.003G141000.2.v4.1 2943 2702.55 1102 22.005 Potri.016G087400.1.v4.1 270 86.4454 972 606.787 Potri.015G069301.1.v4.1 564 331.755 0 0 Potri.010G195200.1.v4.1 1773 1532.55 297 10.4582 Potri.012G127500.1.v4.1 977 736.613 110 8.05871 ==> SRR7172500.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 13 SRR7172500 completed mapping pipeline successfully