Starting /dee2/code/volunteer_pipeline.sh SRR7172501 current disk space = 3058897600512 free memory = 1292971480 SRR7172501 SRAfilesize 5f2fd60d65f405c807022d6574fca053 SRR7172501.sra SRR7172501.sra file validated SRR7172501 is paired end SRR7172501 is conventional basespace SRR7172501 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9755 34.0 33.0 34.0 33.0 34.0 2 33.3985 34.0 34.0 34.0 33.0 34.0 3 33.43825 34.0 34.0 34.0 33.0 34.0 4 33.53475 34.0 34.0 34.0 33.0 34.0 5 33.52275 34.0 34.0 34.0 33.0 34.0 6 37.26425 38.0 38.0 38.0 36.0 38.0 7 37.45675 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 38.0 38.0 9 37.6075 38.0 38.0 38.0 38.0 38.0 10-14 37.54625 38.0 38.0 38.0 38.0 38.0 15-19 37.562349999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.56325 38.0 38.0 38.0 38.0 38.0 25-29 37.5029 38.0 38.0 38.0 38.0 38.0 30-34 37.44065 38.0 38.0 38.0 37.6 38.0 35-39 37.39475 38.0 38.0 38.0 37.2 38.0 40-44 37.2863 38.0 38.0 38.0 37.0 38.0 45-49 37.18825 38.0 38.0 38.0 36.6 38.0 50-54 37.0551 38.0 38.0 38.0 36.0 38.0 55-59 37.067150000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.015750000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.9697 38.0 38.0 38.0 36.0 38.0 70-74 36.8857 38.0 38.0 38.0 35.6 38.0 75-79 36.725049999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.64525000000001 38.0 38.0 38.0 34.4 38.0 85-89 36.6203 38.0 38.0 38.0 34.4 38.0 90-94 36.452 38.0 38.0 38.0 34.0 38.0 95-99 36.34045 38.0 37.8 38.0 33.8 38.0 100-104 36.11925 38.0 37.4 38.0 33.4 38.0 105-109 35.91439999999999 38.0 37.0 38.0 32.2 38.0 110-114 35.5047 38.0 36.6 38.0 30.2 38.0 115-119 35.66655 38.0 36.8 38.0 31.0 38.0 120-124 35.38165 38.0 36.2 38.0 30.0 38.0 125-129 34.88125000000001 38.0 36.0 38.0 27.8 38.0 130-134 34.7404 38.0 35.4 38.0 27.4 38.0 135-139 34.33835 38.0 35.0 38.0 25.2 38.0 140-144 33.6979 38.0 34.2 38.0 22.2 38.0 145-149 32.762649999999994 38.0 33.2 38.0 13.8 38.0 150-151 28.433875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 3.0 11 0.0 12 0.0 13 2.0 14 1.0 15 3.0 16 1.0 17 3.0 18 5.0 19 6.0 20 4.0 21 6.0 22 8.0 23 10.0 24 16.0 25 16.0 26 21.0 27 26.0 28 29.0 29 42.0 30 41.0 31 42.0 32 90.0 33 102.0 34 149.0 35 271.0 36 729.0 37 2372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5116988809766 14.01322482197355 10.757884028484233 40.71719226856562 2 22.425 20.175 34.1 23.3 3 18.925 25.4 25.95 29.725 4 23.175 32.675 20.775 23.375 5 22.075 36.35 23.575 18.0 6 17.474999999999998 37.125 25.15 20.25 7 14.000000000000002 23.3 43.325 19.375 8 18.475 23.150000000000002 30.049999999999997 28.325 9 17.05 23.724999999999998 33.475 25.75 10-14 20.07 28.945 27.189999999999998 23.794999999999998 15-19 20.855 28.084999999999997 27.634999999999998 23.425 20-24 19.919999999999998 29.080000000000002 27.665 23.335 25-29 20.015 28.215 27.815 23.955000000000002 30-34 19.825 28.67 28.02 23.485 35-39 20.549999999999997 27.815 28.345 23.29 40-44 20.39 28.34 27.644999999999996 23.625 45-49 20.064999999999998 28.384999999999998 27.605 23.945 50-54 20.13 28.199999999999996 27.74 23.93 55-59 20.22 28.055000000000003 27.639999999999997 24.085 60-64 20.82 28.275 27.224999999999998 23.68 65-69 20.225 28.23 27.965 23.580000000000002 70-74 20.72 27.685 27.91 23.685000000000002 75-79 20.080000000000002 27.935 28.275 23.71 80-84 20.625 28.225 27.72 23.43 85-89 20.28 28.060000000000002 27.589999999999996 24.07 90-94 20.745 28.095 27.584999999999997 23.575 95-99 21.12 27.91 27.655 23.315 100-104 20.63944761332933 28.655058540978683 27.16901831281897 23.53647553287301 105-109 20.25 28.28 28.199999999999996 23.27 110-114 20.430753819183572 28.539944903581265 27.10242925118958 23.92687202604558 115-119 20.665 28.29 27.48 23.565 120-124 20.985 27.425 27.485 24.104999999999997 125-129 21.279999999999998 27.605 27.665 23.45 130-134 21.535 27.744999999999997 27.060000000000002 23.66 135-139 21.455 27.88 27.060000000000002 23.605 140-144 21.555 28.26 26.745 23.44 145-149 21.305 27.99 27.345000000000002 23.36 150-151 20.7875 27.1 27.55 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 2.5 21 2.5 22 1.0 23 2.5 24 5.0 25 5.0 26 3.5 27 4.5 28 6.0 29 11.5 30 17.5 31 24.5 32 35.5 33 49.0 34 53.5 35 66.0 36 88.0 37 110.0 38 133.5 39 158.0 40 202.0 41 211.0 42 213.5 43 244.5 44 259.0 45 261.0 46 261.5 47 242.5 48 210.5 49 210.0 50 204.5 51 161.0 52 125.5 53 98.0 54 72.5 55 56.0 56 43.5 57 34.5 58 31.5 59 26.0 60 15.0 61 10.5 62 8.0 63 5.5 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.17500000000000002 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTTG 10 0.0068449317 144.90001 7 TCTTTGT 10 0.0068449317 144.90001 8 CTTCTTT 35 0.0033214893 62.100002 6 TTTTTTT 35 0.0035507833 20.7 35-39 AAAAAAA 35 0.0035507833 20.7 15-19 >>END_MODULE SRR7172501 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172501_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.678 33.0 33.0 34.0 32.0 34.0 2 32.75275 34.0 33.0 34.0 32.0 34.0 3 32.84475 34.0 33.0 34.0 32.0 34.0 4 32.7625 34.0 33.0 34.0 32.0 34.0 5 32.756 34.0 33.0 34.0 32.0 34.0 6 36.969 38.0 38.0 38.0 37.0 38.0 7 37.03825 38.0 38.0 38.0 37.0 38.0 8 36.99075 38.0 38.0 38.0 37.0 38.0 9 37.0835 38.0 38.0 38.0 37.0 38.0 10-14 37.035650000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.05200000000001 38.0 38.0 38.0 37.0 38.0 20-24 36.982949999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.06085 38.0 38.0 38.0 36.8 38.0 30-34 36.9636 38.0 38.0 38.0 37.0 38.0 35-39 36.9585 38.0 38.0 38.0 37.0 38.0 40-44 36.973850000000006 38.0 38.0 38.0 37.0 38.0 45-49 36.986599999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.899950000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.8231 38.0 38.0 38.0 36.4 38.0 60-64 36.79365 38.0 38.0 38.0 36.0 38.0 65-69 36.777750000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.817299999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.52885 38.0 38.0 38.0 35.4 38.0 80-84 36.536899999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.545899999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.28285 38.0 38.0 38.0 34.2 38.0 95-99 36.1437 38.0 38.0 38.0 34.0 38.0 100-104 36.084450000000004 38.0 38.0 38.0 34.0 38.0 105-109 35.798500000000004 38.0 38.0 38.0 33.2 38.0 110-114 35.805949999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.594550000000005 38.0 37.8 38.0 31.6 38.0 120-124 35.3859 38.0 37.0 38.0 31.0 38.0 125-129 35.152 38.0 36.6 38.0 30.0 38.0 130-134 34.76915 38.0 36.0 38.0 27.8 38.0 135-139 34.26895 38.0 35.4 38.0 24.6 38.0 140-144 33.644600000000004 38.0 34.0 38.0 21.4 38.0 145-149 33.0472 38.0 33.0 38.0 16.2 38.0 150-151 28.82175 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 1.0 4 2.0 5 0.0 6 3.0 7 0.0 8 2.0 9 2.0 10 3.0 11 4.0 12 3.0 13 4.0 14 4.0 15 2.0 16 1.0 17 8.0 18 2.0 19 4.0 20 9.0 21 9.0 22 11.0 23 15.0 24 18.0 25 19.0 26 26.0 27 29.0 28 24.0 29 40.0 30 33.0 31 37.0 32 66.0 33 78.0 34 117.0 35 201.0 36 534.0 37 2668.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.028169014084504 19.089537223340038 13.455734406438632 29.42655935613682 2 24.35832913940614 26.04428787116256 32.813286361348766 16.784096628082537 3 20.286936823559024 27.107978857286685 31.990938837150768 20.614145482003522 4 24.452279022916144 34.19793502895996 21.9843868043314 19.365399143792494 5 23.923444976076556 37.093930999748174 21.782926215059177 17.199697809116092 6 19.628047248052276 38.55240010052777 23.548630309122895 18.270922342297062 7 18.62276954008545 18.421713998492084 41.593365167127416 21.36215129429505 8 20.457401357124905 23.649158079919577 29.052525760241267 26.84091480271425 9 21.261623523498365 24.88062327217894 29.379241015330486 24.47851218899221 10-14 23.624026137220408 28.534807740638353 25.860769037446595 21.980397084694648 15-19 22.905252576024125 27.78084945966323 27.896456396079415 21.417441568233226 20-24 23.10630811761749 27.976878612716767 27.484292535813022 21.432520733852726 25-29 23.014676316847606 28.29211901889827 27.447728186570163 21.245476477683955 30-34 22.894049055086448 27.31704865299558 28.347406513872137 21.441495778045837 35-39 22.77342179332529 28.096099718536387 27.85987133092079 21.27060715721753 40-44 22.115529636519028 27.333970137248002 28.781861143230607 21.768639083002363 45-49 22.770684628531214 27.92801849803961 27.73197949130391 21.569317382125263 50-54 22.79079119332462 28.058711169196744 27.440434301799538 21.7100633356791 55-59 22.79969841668761 28.24327720532797 27.564714752450364 21.392309625534054 60-64 23.29731088213119 27.33852726815783 27.529530032671524 21.834631817039458 65-69 22.980648404121638 28.233224428248306 27.52450364413169 21.261623523498365 70-74 23.161598391555668 28.182960542849962 27.30334254837899 21.35209851721538 75-79 23.608946971600904 27.353606433777333 28.027142498115104 21.01030409650666 80-84 23.12487432133521 28.639654132314497 27.13653730142771 21.09893424492258 85-89 23.5560247323179 28.41703111647313 27.205549690846027 20.821394460362942 90-94 23.26025744167337 27.825824617860018 27.815768302493964 21.098149637972647 95-99 23.532666096665494 27.752351254840818 27.204144243826384 21.510838404667304 100-104 23.81718537885263 27.83448137161245 27.427221076977226 20.921112172557695 105-109 23.37740686742748 27.705997687396312 28.228847217334476 20.687748227841738 110-114 23.175145787251157 27.920772169716468 27.91574502312487 20.988337019907497 115-119 23.53946706887883 28.45148315736551 27.239819004524886 20.76923076923077 120-124 24.208304011259678 27.922991856841257 27.837538956469288 20.031165175429777 125-129 24.30122662376835 27.785039211743413 27.6141162276292 20.299617936859036 130-134 25.006282985674794 27.735611962804725 27.253078662980652 20.005026388539836 135-139 24.413169137974368 27.308368936918825 28.13269665745162 20.14576526765519 140-144 25.060325759099133 27.599034787854414 26.96561431731349 20.375025135732958 145-149 24.959782827267244 28.267645284536496 27.171727327568874 19.600844560627387 150-151 24.921452808847555 28.69171798416489 27.284152318713083 19.102676888274477 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 20.0 1 10.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 2.0 24 0.5 25 2.0 26 3.5 27 6.5 28 9.0 29 11.5 30 15.0 31 17.0 32 27.5 33 37.0 34 44.5 35 57.0 36 80.0 37 103.5 38 121.5 39 157.0 40 184.5 41 207.0 42 240.5 43 250.0 44 251.5 45 265.0 46 272.0 47 258.0 48 236.5 49 216.5 50 188.0 51 152.5 52 118.5 53 94.5 54 79.5 55 70.5 56 55.5 57 41.0 58 27.5 59 22.0 60 17.5 61 8.0 62 6.0 63 5.0 64 3.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.65 3 0.675 4 0.7250000000000001 5 0.7250000000000001 6 0.525 7 0.525 8 0.525 9 0.525 10-14 0.525 15-19 0.525 20-24 0.525 25-29 0.52 30-34 0.52 35-39 0.52 40-44 0.545 45-49 0.53 50-54 0.53 55-59 0.525 60-64 0.525 65-69 0.525 70-74 0.525 75-79 0.525 80-84 0.54 85-89 0.5349999999999999 90-94 0.5599999999999999 95-99 0.585 100-104 0.555 105-109 0.545 110-114 0.54 115-119 0.5499999999999999 120-124 0.53 125-129 0.54 130-134 0.525 135-139 0.525 140-144 0.54 145-149 0.54 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2656368700937 98.0 2 0.6330716637123323 1.25 3 0.05064573309698658 0.15 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02532286654849329 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.8499999999999996 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATA 10 0.00682755 145.0 8 GGGGGGG 20 0.0059333243 29.0 45-49 AAAAAAA 65 0.0076330877 13.384615 95-99 >>END_MODULE Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835789 spots for SRR7172501.sra Written 835789 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra Read 835783 spots for SRR7172501.sra Written 835783 spots for SRR7172501.sra SRR ids: ['SRR7172501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9sgo0arj SRR7172501.sra spots: 16715666 blocks: [[1, 835783], [835784, 1671566], [1671567, 2507349], [2507350, 3343132], [3343133, 4178915], [4178916, 5014698], [5014699, 5850481], [5850482, 6686264], [6686265, 7522047], [7522048, 8357830], [8357831, 9193613], [9193614, 10029396], [10029397, 10865179], [10865180, 11700962], [11700963, 12536745], [12536746, 13372528], [13372529, 14208311], [14208312, 15044094], [15044095, 15879877], [15879878, 16715666]] SRR7172501 file size 5642690 SRR7172501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172501 SRR7172501_1.fastq SRR7172501_2.fastq Input file: SRR7172501_1.fastq Paired file: SRR7172501_2.fastq trimmed: SRR7172501-trimmed-pair1.fastq, SRR7172501-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:17:43 2025 >> started Mon Feb 10 13:18:10 2025 >> done (27.043s) 16715666 read pairs processed; of these: 15752 ( 0.09%) short read pairs filtered out after trimming by size control 104026 ( 0.62%) empty read pairs filtered out after trimming by size control 16595888 (99.28%) read pairs available; of these: 8647144 (52.10%) trimmed read pairs available after processing 7948744 (47.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 9 0.00% 22 4 0.00% 23 5 0.00% 24 5 0.00% 25 3 0.00% 26 10 0.00% 27 12 0.00% 28 12 0.00% 29 7 0.00% 30 18 0.00% 31 7 0.00% 32 13 0.00% 33 9 0.00% 34 4 0.00% 35 15 0.00% 36 11 0.00% 37 31 0.00% 38 13 0.00% 39 28 0.00% 40 28 0.00% 41 25 0.00% 42 28 0.00% 43 43 0.00% 44 30 0.00% 45 56 0.00% 46 49 0.00% 47 54 0.00% 48 75 0.00% 49 67 0.00% 50 89 0.00% 51 96 0.00% 52 88 0.00% 53 118 0.00% 54 139 0.00% 55 119 0.00% 56 161 0.00% 57 165 0.00% 58 195 0.00% 59 215 0.00% 60 288 0.00% 61 332 0.00% 62 336 0.00% 63 384 0.00% 64 420 0.00% 65 455 0.00% 66 536 0.00% 67 619 0.00% 68 752 0.00% 69 865 0.01% 70 917 0.01% 71 993 0.01% 72 1094 0.01% 73 1302 0.01% 74 1395 0.01% 75 1537 0.01% 76 1711 0.01% 77 1934 0.01% 78 2133 0.01% 79 2395 0.01% 80 2667 0.02% 81 2932 0.02% 82 3349 0.02% 83 3824 0.02% 84 4752 0.03% 85 5306 0.03% 86 5942 0.04% 87 6123 0.04% 88 6682 0.04% 89 7168 0.04% 90 7662 0.05% 91 8360 0.05% 92 9159 0.06% 93 9888 0.06% 94 10893 0.07% 95 11526 0.07% 96 11531 0.07% 97 12115 0.07% 98 12894 0.08% 99 13495 0.08% 100 14335 0.09% 101 15087 0.09% 102 15835 0.10% 103 17032 0.10% 104 18099 0.11% 105 19146 0.12% 106 20113 0.12% 107 20753 0.13% 108 21820 0.13% 109 22771 0.14% 110 23423 0.14% 111 24823 0.15% 112 25606 0.15% 113 27474 0.17% 114 28193 0.17% 115 29847 0.18% 116 31155 0.19% 117 32168 0.19% 118 33188 0.20% 119 34159 0.21% 120 35635 0.21% 121 36945 0.22% 122 38352 0.23% 123 40606 0.24% 124 42380 0.26% 125 44037 0.27% 126 46007 0.28% 127 48216 0.29% 128 50082 0.30% 129 52364 0.32% 130 54535 0.33% 131 55984 0.34% 132 59495 0.36% 133 62841 0.38% 134 66250 0.40% 135 69852 0.42% 136 74324 0.45% 137 79122 0.48% 138 85189 0.51% 139 91887 0.55% 140 99015 0.60% 141 107773 0.65% 142 118771 0.72% 143 134220 0.81% 144 155815 0.94% 145 184204 1.11% 146 227822 1.37% 147 309056 1.86% 148 477869 2.88% 149 926342 5.58% 150 4118391 24.82% 151 7948744 47.90% 16595888 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=11 prefix-density=0.60 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=18.60 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=AGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.89 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=77.27 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.4 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7172501 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:19:11 Started mapping on | Feb 10 13:19:12 Finished on | Feb 10 13:21:12 Mapping speed, Million of reads per hour | 497.88 Number of input reads | 16595888 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15591537 Uniquely mapped reads % | 93.95% Average mapped length | 293.22 Number of splices: Total | 15122960 Number of splices: Annotated (sjdb) | 14813647 Number of splices: GT/AG | 14820380 Number of splices: GC/AG | 253697 Number of splices: AT/AC | 8528 Number of splices: Non-canonical | 40355 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401418 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 35001 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 617015 617015 617015 N_multimapping 401418 401418 401418 N_noFeature 545707 15347474 653324 N_ambiguous 232360 978 95301 UnstrandedReadsAssigned:14813470 PositiveStrandReadsAssigned:243085 NegativeStrandReadsAssigned:14842912 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172501 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172501-trimmed-pair1.fastq SRR7172501-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,595,888 reads, 14,844,570 reads pseudoaligned [quant] estimated average fragment length: 246.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR7172501.ke.tsv 34699 SRR7172501.se.tsv 87100 total ==> SRR7172501.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.73 434 15.9231 Potri.005G024800.1.v4.1 1035 789.726 90 7.41219 Potri.004G059700.1.v4.1 961 715.778 16 1.45386 Potri.007G009000.2.v4.1 1416 1170.73 0 0 Potri.003G141000.2.v4.1 2943 2697.73 1013.45 24.4335 Potri.016G087400.1.v4.1 270 81.8826 658 522.654 Potri.015G069301.1.v4.1 564 326.22 0 0 Potri.010G195200.1.v4.1 1773 1527.73 5 0.212865 Potri.012G127500.1.v4.1 977 731.746 107 9.51051 ==> SRR7172501.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1182 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7172501 completed mapping pipeline successfully