Starting /dee2/code/volunteer_pipeline.sh SRR7172502 current disk space = 3058952441856 free memory = 1354049604 SRR7172502 SRAfilesize c0f607e92cbbc7e1ab0a5a156b53c26c SRR7172502.sra SRR7172502.sra file validated SRR7172502 is paired end SRR7172502 is conventional basespace SRR7172502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01775 34.0 34.0 34.0 33.0 34.0 2 33.4555 34.0 34.0 34.0 33.0 34.0 3 33.46575 34.0 34.0 34.0 33.0 34.0 4 33.5375 34.0 34.0 34.0 33.0 34.0 5 33.56875 34.0 34.0 34.0 33.0 34.0 6 37.264 38.0 38.0 38.0 36.0 38.0 7 37.501 38.0 38.0 38.0 37.0 38.0 8 37.5455 38.0 38.0 38.0 38.0 38.0 9 37.5335 38.0 38.0 38.0 38.0 38.0 10-14 37.5509 38.0 38.0 38.0 38.0 38.0 15-19 37.554 38.0 38.0 38.0 38.0 38.0 20-24 37.569849999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.51415 38.0 38.0 38.0 38.0 38.0 30-34 37.4905 38.0 38.0 38.0 38.0 38.0 35-39 37.42615000000001 38.0 38.0 38.0 37.6 38.0 40-44 37.310950000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.26825 38.0 38.0 38.0 37.0 38.0 50-54 37.108799999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.146550000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.1091 38.0 38.0 38.0 36.0 38.0 65-69 36.98095000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.8745 38.0 38.0 38.0 35.6 38.0 75-79 36.7783 38.0 38.0 38.0 35.0 38.0 80-84 36.6735 38.0 38.0 38.0 34.8 38.0 85-89 36.652750000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.45205 38.0 38.0 38.0 34.0 38.0 95-99 36.3211 38.0 37.8 38.0 33.8 38.0 100-104 36.13135 38.0 37.4 38.0 33.4 38.0 105-109 35.94035 38.0 37.0 38.0 32.4 38.0 110-114 35.51055 38.0 36.8 38.0 30.2 38.0 115-119 35.6245 38.0 37.0 38.0 31.0 38.0 120-124 35.4079 38.0 36.4 38.0 29.6 38.0 125-129 35.03395 38.0 36.0 38.0 28.0 38.0 130-134 34.796800000000005 38.0 35.4 38.0 27.6 38.0 135-139 34.536649999999995 38.0 35.2 38.0 26.2 38.0 140-144 33.78065 38.0 34.0 38.0 22.6 38.0 145-149 32.79065 38.0 33.2 38.0 15.6 38.0 150-151 28.296125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 1.0 17 7.0 18 3.0 19 5.0 20 5.0 21 10.0 22 8.0 23 10.0 24 11.0 25 20.0 26 22.0 27 19.0 28 38.0 29 30.0 30 36.0 31 45.0 32 82.0 33 112.0 34 171.0 35 255.0 36 726.0 37 2379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.736040609137056 14.441624365482234 10.736040609137056 39.08629441624365 2 21.475 20.150000000000002 35.775 22.6 3 18.775 26.1 26.75 28.375 4 21.725 33.300000000000004 24.375 20.599999999999998 5 20.7 36.5 25.05 17.75 6 17.675 35.175 27.400000000000002 19.75 7 13.350000000000001 22.425 45.45 18.775 8 18.35 23.3 29.95 28.4 9 17.349999999999998 23.724999999999998 33.550000000000004 25.374999999999996 10-14 19.41 29.175 27.215 24.2 15-19 19.54 28.645 28.115000000000002 23.7 20-24 19.67 29.595 27.689999999999998 23.044999999999998 25-29 19.24 29.134999999999998 27.735 23.89 30-34 19.485 28.84 28.505000000000003 23.169999999999998 35-39 19.68 28.87 27.889999999999997 23.56 40-44 19.975 28.63 28.244999999999997 23.150000000000002 45-49 19.86 28.535 27.639999999999997 23.965 50-54 19.53 28.83 28.28 23.36 55-59 19.74 29.294999999999998 27.665 23.3 60-64 19.830000000000002 28.87 27.825 23.474999999999998 65-69 19.8 28.749999999999996 28.29 23.16 70-74 20.349999999999998 28.34 27.525 23.785 75-79 19.77 28.999999999999996 27.525 23.705000000000002 80-84 20.135 28.89 27.77 23.205000000000002 85-89 20.405 29.189999999999998 27.644999999999996 22.759999999999998 90-94 20.43 28.720000000000002 27.46 23.39 95-99 20.580000000000002 28.375 27.6 23.445 100-104 20.16306522609044 29.041616646658664 27.3359343737495 23.4593837535014 105-109 20.53 28.835 27.33 23.305 110-114 20.551717232402122 28.97767097226394 27.46570541704215 23.00490637829178 115-119 20.805 28.645 27.169999999999998 23.380000000000003 120-124 20.54 28.199999999999996 27.16 24.099999999999998 125-129 20.5 28.645 27.355 23.5 130-134 20.955 28.615000000000002 27.205000000000002 23.225 135-139 20.599999999999998 29.04 26.695 23.665 140-144 20.26 28.544999999999998 27.955000000000002 23.24 145-149 20.59 29.095 26.295 24.02 150-151 20.075000000000003 29.4125 27.3875 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 3.0 23 3.0 24 3.5 25 3.0 26 6.5 27 14.0 28 13.0 29 15.0 30 25.5 31 32.0 32 41.0 33 52.5 34 64.5 35 80.5 36 104.0 37 117.5 38 143.5 39 186.0 40 205.0 41 233.5 42 257.0 43 265.0 44 259.5 45 253.5 46 247.0 47 220.0 48 205.5 49 201.5 50 163.5 51 125.5 52 98.5 53 71.0 54 71.0 55 58.0 56 38.0 57 32.5 58 27.5 59 20.0 60 12.5 61 5.5 62 4.0 63 5.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.13 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.112500000000001 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.175 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATA 10 0.006830828 145.0 4 AGGAACT 10 0.006830828 145.0 2 TCCATAC 15 1.1411342E-4 145.0 5 CCATACT 15 1.1411342E-4 145.0 6 ATACTTT 15 1.1411342E-4 145.0 8 TCTCCAT 10 0.006830828 145.0 3 CATACTT 15 1.1411342E-4 145.0 7 TACTTTT 20 3.5877043E-4 108.75 9 >>END_MODULE SRR7172502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71575 33.0 33.0 34.0 32.0 34.0 2 32.809 34.0 33.0 34.0 32.0 34.0 3 32.9115 34.0 33.0 34.0 32.0 34.0 4 32.7745 34.0 33.0 34.0 32.0 34.0 5 32.8325 34.0 33.0 34.0 32.0 34.0 6 37.04075 38.0 38.0 38.0 37.0 38.0 7 37.02975 38.0 38.0 38.0 37.0 38.0 8 37.127 38.0 38.0 38.0 37.0 38.0 9 37.09325 38.0 38.0 38.0 37.0 38.0 10-14 37.0793 38.0 38.0 38.0 37.0 38.0 15-19 37.06335 38.0 38.0 38.0 37.0 38.0 20-24 37.0172 38.0 38.0 38.0 37.0 38.0 25-29 37.0018 38.0 38.0 38.0 37.0 38.0 30-34 36.943949999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.89575 38.0 38.0 38.0 36.8 38.0 40-44 36.91265 38.0 38.0 38.0 37.0 38.0 45-49 36.89475 38.0 38.0 38.0 36.8 38.0 50-54 36.853449999999995 38.0 38.0 38.0 36.4 38.0 55-59 36.735 38.0 38.0 38.0 36.4 38.0 60-64 36.72665 38.0 38.0 38.0 36.0 38.0 65-69 36.708000000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.69665 38.0 38.0 38.0 36.0 38.0 75-79 36.4066 38.0 38.0 38.0 34.8 38.0 80-84 36.44115000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.45125 38.0 38.0 38.0 35.0 38.0 90-94 36.257200000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.0665 38.0 38.0 38.0 34.0 38.0 100-104 36.04715 38.0 38.0 38.0 34.0 38.0 105-109 35.81165 38.0 38.0 38.0 32.8 38.0 110-114 35.77945 38.0 38.0 38.0 32.4 38.0 115-119 35.5436 38.0 37.8 38.0 31.8 38.0 120-124 35.2245 38.0 36.8 38.0 30.2 38.0 125-129 35.01895 38.0 36.8 38.0 28.4 38.0 130-134 34.59225 38.0 36.0 38.0 26.6 38.0 135-139 34.1322 38.0 35.6 38.0 23.2 38.0 140-144 33.43535 38.0 34.0 38.0 17.2 38.0 145-149 32.79225 38.0 33.0 38.0 10.8 38.0 150-151 28.70625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 3.0 5 4.0 6 4.0 7 2.0 8 1.0 9 1.0 10 1.0 11 3.0 12 3.0 13 2.0 14 1.0 15 3.0 16 4.0 17 4.0 18 8.0 19 10.0 20 10.0 21 13.0 22 14.0 23 14.0 24 21.0 25 18.0 26 20.0 27 24.0 28 30.0 29 25.0 30 44.0 31 70.0 32 51.0 33 101.0 34 105.0 35 196.0 36 479.0 37 2690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.704094448631 17.935192162773173 14.669680984677216 29.691032403918616 2 26.350163275558902 26.02361215774931 32.002009545340364 15.62421502135142 3 20.92964824120603 28.165829145728644 30.778894472361806 20.125628140703515 4 22.22222222222222 37.20462543991956 22.67471091000503 17.898441427853193 5 23.133014835302994 36.76137792305758 22.856424440533065 17.24918280110636 6 18.498995983935743 37.851405622489956 24.673694779116463 18.97590361445783 7 18.57896058247552 17.42405222194326 43.15842329902084 20.83856389656038 8 20.793571069814163 23.731793068809644 29.357106981416376 26.117528879959817 9 21.014310820989206 24.328395681647 29.7765503389405 24.8807431584233 10-14 22.452669110631245 28.011851554261035 27.78084668307136 21.754632652036356 15-19 22.614503816793892 28.224186420249097 28.254319003615908 20.906990759341102 20-24 22.111183648872597 28.68477878772661 28.323205945864512 20.880831617536284 25-29 22.742105527385913 28.766504342587478 27.95321050253527 20.538179627491342 30-34 21.841273028462428 28.48752572662015 28.989508558807287 20.681692686110136 35-39 22.601536221697877 27.702193885235204 28.369898087253375 21.326371805813547 40-44 22.590527848927728 28.808196474310684 27.92928531967254 20.671990357089047 45-49 22.25012556504269 28.10145655449523 28.54846810647916 21.099949773982924 50-54 22.969919148295084 28.15748506001105 28.011851554261035 20.860744237432833 55-59 22.888420206889627 27.844732349101136 28.306718891232297 20.96012855277694 60-64 23.007783078081847 27.98393170976651 28.039166457444136 20.96911875470751 65-69 23.34923424554356 27.90861159929701 27.692693949284457 21.04946020587497 70-74 22.845520289272798 27.601446364001607 28.610887906789877 20.942145439935718 75-79 23.13912606730286 27.76996484178805 28.05625313912607 21.034655951783023 80-84 23.56102461074837 27.935710698141637 27.44349573078855 21.059768960321446 85-89 23.566047212456052 27.875439477649422 28.292315419387243 20.266197890507282 90-94 23.942742340532398 27.292817679558013 28.653942742340533 20.11049723756906 95-99 23.460572576594675 27.97086891009543 28.23204419889503 20.336514314414867 100-104 23.640198885038423 27.88910652403194 28.2607603837075 20.209934207222137 105-109 22.88297338021095 28.176795580110497 28.066298342541433 20.873932697137118 110-114 23.88247112004018 28.513309894525364 27.418382722250122 20.185836263184328 115-119 23.867403314917127 28.111501757910595 27.955801104972377 20.0652938221999 120-124 24.407392527119327 27.968059461631178 27.666733627963037 19.95781438328646 125-129 24.001808045803827 27.85897242730149 27.853950077846417 20.285269449048265 130-134 24.140181754280263 27.82547572425566 28.001205000753128 20.03313752071095 135-139 24.474014561888026 27.511925684157667 28.1646999748933 19.84935977906101 140-144 24.55047714716223 27.865394274234053 27.790055248618785 19.794073329984933 145-149 24.706177800100452 28.51833249623305 27.232546459065798 19.542943244600703 150-151 26.14264188849824 28.176795580110497 27.209944751381215 18.470617780010045 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 16.0 1 8.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 2.0 20 3.0 21 1.5 22 0.5 23 2.0 24 5.0 25 5.0 26 5.0 27 7.5 28 7.0 29 9.5 30 17.5 31 24.5 32 38.5 33 46.0 34 47.5 35 67.5 36 95.5 37 122.5 38 143.0 39 170.5 40 204.5 41 239.0 42 257.0 43 253.5 44 267.0 45 271.5 46 254.0 47 237.5 48 221.0 49 187.0 50 150.0 51 132.5 52 115.5 53 88.0 54 68.5 55 55.0 56 41.0 57 35.0 58 23.0 59 13.5 60 13.0 61 8.5 62 6.5 63 7.0 64 4.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.475 3 0.5 4 0.5499999999999999 5 0.575 6 0.4 7 0.42500000000000004 8 0.44999999999999996 9 0.42500000000000004 10-14 0.43499999999999994 15-19 0.44 20-24 0.43499999999999994 25-29 0.40499999999999997 30-34 0.395 35-39 0.40499999999999997 40-44 0.445 45-49 0.44999999999999996 50-54 0.43499999999999994 55-59 0.43 60-64 0.42500000000000004 65-69 0.42500000000000004 70-74 0.44 75-79 0.44999999999999996 80-84 0.44999999999999996 85-89 0.44999999999999996 90-94 0.44999999999999996 95-99 0.44999999999999996 100-104 0.445 105-109 0.44999999999999996 110-114 0.44999999999999996 115-119 0.44999999999999996 120-124 0.44 125-129 0.445 130-134 0.415 135-139 0.42500000000000004 140-144 0.44999999999999996 145-149 0.44999999999999996 150-151 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52044422009087 98.575 2 0.3281171125694094 0.65 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.1624999999999996 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 3.9625000000000004 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 5.0875 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 6.75 0.0 0.0 0.0 0.0 136-137 7.1625 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra Read 840717 spots for SRR7172502.sra Written 840717 spots for SRR7172502.sra SRR ids: ['SRR7172502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zqhsf604 SRR7172502.sra spots: 16814340 blocks: [[1, 840717], [840718, 1681434], [1681435, 2522151], [2522152, 3362868], [3362869, 4203585], [4203586, 5044302], [5044303, 5885019], [5885020, 6725736], [6725737, 7566453], [7566454, 8407170], [8407171, 9247887], [9247888, 10088604], [10088605, 10929321], [10929322, 11770038], [11770039, 12610755], [12610756, 13451472], [13451473, 14292189], [14292190, 15132906], [15132907, 15973623], [15973624, 16814340]] SRR7172502 file size 5676127 SRR7172502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172502 SRR7172502_1.fastq SRR7172502_2.fastq Input file: SRR7172502_1.fastq Paired file: SRR7172502_2.fastq trimmed: SRR7172502-trimmed-pair1.fastq, SRR7172502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:26:21 2025 >> started Mon Feb 10 13:26:39 2025 >> done (18.630s) 16814340 read pairs processed; of these: 18567 ( 0.11%) short read pairs filtered out after trimming by size control 110088 ( 0.65%) empty read pairs filtered out after trimming by size control 16685685 (99.23%) read pairs available; of these: 8896589 (53.32%) trimmed read pairs available after processing 7789096 (46.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 10 0.00% 25 12 0.00% 26 16 0.00% 27 12 0.00% 28 6 0.00% 29 7 0.00% 30 14 0.00% 31 12 0.00% 32 14 0.00% 33 17 0.00% 34 20 0.00% 35 20 0.00% 36 25 0.00% 37 14 0.00% 38 24 0.00% 39 31 0.00% 40 22 0.00% 41 34 0.00% 42 37 0.00% 43 42 0.00% 44 42 0.00% 45 54 0.00% 46 65 0.00% 47 73 0.00% 48 79 0.00% 49 88 0.00% 50 106 0.00% 51 112 0.00% 52 146 0.00% 53 129 0.00% 54 168 0.00% 55 167 0.00% 56 224 0.00% 57 256 0.00% 58 272 0.00% 59 327 0.00% 60 330 0.00% 61 412 0.00% 62 474 0.00% 63 550 0.00% 64 612 0.00% 65 629 0.00% 66 729 0.00% 67 789 0.00% 68 944 0.01% 69 1118 0.01% 70 1438 0.01% 71 1467 0.01% 72 1669 0.01% 73 1727 0.01% 74 1975 0.01% 75 2183 0.01% 76 2464 0.01% 77 2699 0.02% 78 2862 0.02% 79 3221 0.02% 80 3730 0.02% 81 4265 0.03% 82 4807 0.03% 83 5439 0.03% 84 6744 0.04% 85 7480 0.04% 86 7994 0.05% 87 8361 0.05% 88 8996 0.05% 89 9313 0.06% 90 10267 0.06% 91 11088 0.07% 92 12009 0.07% 93 13373 0.08% 94 13872 0.08% 95 14829 0.09% 96 15064 0.09% 97 15772 0.09% 98 16413 0.10% 99 16901 0.10% 100 17970 0.11% 101 18786 0.11% 102 20176 0.12% 103 21459 0.13% 104 22372 0.13% 105 23780 0.14% 106 24539 0.15% 107 25173 0.15% 108 25868 0.16% 109 27041 0.16% 110 27797 0.17% 111 29158 0.17% 112 30662 0.18% 113 31849 0.19% 114 33259 0.20% 115 34780 0.21% 116 36408 0.22% 117 36966 0.22% 118 38298 0.23% 119 38769 0.23% 120 40142 0.24% 121 41620 0.25% 122 43393 0.26% 123 45240 0.27% 124 47506 0.28% 125 49217 0.29% 126 51340 0.31% 127 53476 0.32% 128 53983 0.32% 129 56370 0.34% 130 58551 0.35% 131 60301 0.36% 132 64122 0.38% 133 67254 0.40% 134 70401 0.42% 135 74780 0.45% 136 79002 0.47% 137 84000 0.50% 138 89362 0.54% 139 95794 0.57% 140 103096 0.62% 141 112342 0.67% 142 123604 0.74% 143 139704 0.84% 144 161036 0.97% 145 190260 1.14% 146 235102 1.41% 147 316962 1.90% 148 486269 2.91% 149 927998 5.56% 150 4071510 24.40% 151 7789096 46.68% 16685685 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=11 prefix-density=0.44 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=428.71 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=91.28 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.6 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7172502 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:27:37 Started mapping on | Feb 10 13:27:38 Finished on | Feb 10 13:29:50 Mapping speed, Million of reads per hour | 455.06 Number of input reads | 16685685 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15449365 Uniquely mapped reads % | 92.59% Average mapped length | 291.99 Number of splices: Total | 14325589 Number of splices: Annotated (sjdb) | 13948915 Number of splices: GT/AG | 14045168 Number of splices: GC/AG | 219110 Number of splices: AT/AC | 8483 Number of splices: Non-canonical | 52828 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451377 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 112061 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 801139 801139 801139 N_multimapping 451377 451377 451377 N_noFeature 743706 15193412 860626 N_ambiguous 265516 1219 125671 UnstrandedReadsAssigned:14440143 PositiveStrandReadsAssigned:254734 NegativeStrandReadsAssigned:14463068 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172502-trimmed-pair1.fastq SRR7172502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,685,685 reads, 14,559,422 reads pseudoaligned [quant] estimated average fragment length: 246.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7172502.ke.tsv 34699 SRR7172502.se.tsv 87100 total ==> SRR7172502.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.6 1554 60.4846 Potri.005G024800.1.v4.1 1035 789.603 98 8.56293 Potri.004G059700.1.v4.1 961 715.742 3 0.289181 Potri.007G009000.2.v4.1 1416 1170.6 0 0 Potri.003G141000.2.v4.1 2943 2697.6 757.63 19.3769 Potri.016G087400.1.v4.1 270 84.9597 677.391 550.088 Potri.015G069301.1.v4.1 564 327.421 0 0 Potri.010G195200.1.v4.1 1773 1527.6 45 2.03239 Potri.012G127500.1.v4.1 977 731.668 125 11.7869 ==> SRR7172502.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 586 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7172502 completed mapping pipeline successfully