Starting /dee2/code/volunteer_pipeline.sh SRR7172503 current disk space = 3059087515648 free memory = 1400394280 SRR7172503 SRAfilesize 3d0ad94d410631d93401a359af4929ea SRR7172503.sra SRR7172503.sra file validated SRR7172503 is paired end SRR7172503 is conventional basespace SRR7172503 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50725 34.0 33.0 34.0 33.0 34.0 2 33.3325 34.0 33.0 34.0 33.0 34.0 3 33.38275 34.0 34.0 34.0 33.0 34.0 4 33.53825 34.0 34.0 34.0 33.0 34.0 5 33.52325 34.0 34.0 34.0 33.0 34.0 6 37.226 38.0 38.0 38.0 36.0 38.0 7 37.431 38.0 38.0 38.0 37.0 38.0 8 37.57325 38.0 38.0 38.0 38.0 38.0 9 37.51575 38.0 38.0 38.0 38.0 38.0 10-14 37.5202 38.0 38.0 38.0 37.8 38.0 15-19 37.50005 38.0 38.0 38.0 38.0 38.0 20-24 37.46659999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.443799999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.419200000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.303450000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.1221 38.0 38.0 38.0 36.2 38.0 45-49 36.9932 38.0 38.0 38.0 36.0 38.0 50-54 36.8745 38.0 38.0 38.0 35.6 38.0 55-59 36.8916 38.0 38.0 38.0 36.0 38.0 60-64 36.83495 38.0 38.0 38.0 35.8 38.0 65-69 36.7573 38.0 38.0 38.0 35.0 38.0 70-74 36.6747 38.0 38.0 38.0 34.6 38.0 75-79 36.468999999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.3967 38.0 38.0 38.0 34.0 38.0 85-89 36.322449999999996 38.0 37.8 38.0 34.0 38.0 90-94 36.20155 38.0 37.4 38.0 33.4 38.0 95-99 35.9017 38.0 37.0 38.0 32.6 38.0 100-104 35.532799999999995 38.0 36.8 38.0 30.2 38.0 105-109 35.592549999999996 38.0 36.8 38.0 30.8 38.0 110-114 35.287150000000004 38.0 36.0 38.0 29.4 38.0 115-119 35.087599999999995 38.0 35.8 38.0 28.8 38.0 120-124 34.6259 38.0 35.0 38.0 26.8 38.0 125-129 34.34955 38.0 35.0 38.0 24.6 38.0 130-134 33.8851 38.0 34.4 38.0 22.8 38.0 135-139 33.53065 38.0 34.0 38.0 20.2 38.0 140-144 32.697050000000004 38.0 33.0 38.0 14.4 38.0 145-149 31.781799999999997 38.0 31.4 38.0 10.8 38.0 150-151 26.311875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 4.0 10 1.0 11 2.0 12 3.0 13 1.0 14 1.0 15 1.0 16 4.0 17 6.0 18 5.0 19 6.0 20 6.0 21 8.0 22 5.0 23 11.0 24 14.0 25 12.0 26 20.0 27 31.0 28 34.0 29 46.0 30 64.0 31 74.0 32 110.0 33 123.0 34 194.0 35 370.0 36 878.0 37 1964.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.066993043030145 13.733573821180109 7.523834063385726 38.67559907240402 2 19.875 19.6 38.125 22.400000000000002 3 17.675 24.25 28.425 29.65 4 22.900000000000002 30.875000000000004 23.474999999999998 22.75 5 21.2 36.975 24.099999999999998 17.724999999999998 6 18.0 35.525 25.85 20.625 7 13.950000000000001 22.85 44.65 18.55 8 16.35 24.525 32.1 27.025 9 16.325 23.925 34.325 25.424999999999997 10-14 20.23 29.299999999999997 26.35 24.12 15-19 19.939999999999998 28.044999999999998 27.834999999999997 24.18 20-24 20.31 28.705000000000002 27.775 23.21 25-29 20.041002050102506 28.521426071303562 27.861393069653484 23.576178808940448 30-34 20.412041204120413 28.312831283128315 28.032803280328032 23.242324232423243 35-39 20.319463221671423 28.050673476540982 27.990586350207803 23.63927695157979 40-44 20.118224626790905 28.69952910530007 27.727682596934173 23.454563670974853 45-49 20.572029653376077 27.53957122821078 27.900220396714086 23.988178721699057 50-54 20.051091965537967 27.990382688839908 28.601482668803847 23.357042676818274 55-59 20.22353648757017 28.874298315958303 27.67141138732959 23.23075380914194 60-64 20.606516290726816 28.37593984962406 27.81453634085213 23.20300751879699 65-69 20.24561403508772 28.641604010025063 27.528822055137848 23.583959899749374 70-74 20.195488721804512 28.51127819548872 27.614035087719298 23.67919799498747 75-79 20.06516290726817 28.315789473684212 27.924812030075184 23.694235588972433 80-84 20.1203007518797 28.055137844611526 28.20551378446115 23.61904761904762 85-89 20.721804511278197 28.68671679197995 27.43859649122807 23.152882205513784 90-94 20.551378446115287 28.325814536340854 28.01002506265664 23.112781954887218 95-99 20.87719298245614 28.135338345864664 27.187969924812027 23.79949874686717 100-104 20.816224336504757 28.838257386079118 27.060590886329493 23.28492739108663 105-109 20.73390816121917 27.787246841788647 27.74714257068378 23.731702426308402 110-114 20.614320789697853 28.05531893571178 27.990178884601896 23.340181389988476 115-119 21.344824130674418 28.36456558773424 27.051808798476802 23.23880148311454 120-124 20.785 28.249999999999996 26.91 24.055 125-129 20.685000000000002 28.84 27.615000000000002 22.86 130-134 20.685000000000002 28.910000000000004 27.33 23.075000000000003 135-139 21.115000000000002 27.860000000000003 26.950000000000003 24.075 140-144 20.995 27.755000000000003 27.73 23.52 145-149 20.805 28.48 27.500000000000004 23.215 150-151 21.0 29.462500000000002 26.35 23.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.0 19 2.5 20 0.5 21 0.5 22 2.0 23 4.0 24 3.5 25 4.5 26 8.0 27 9.0 28 13.0 29 16.5 30 23.0 31 35.5 32 44.5 33 44.5 34 47.5 35 67.0 36 94.5 37 117.5 38 140.5 39 168.0 40 186.5 41 199.5 42 230.0 43 250.5 44 259.5 45 257.0 46 249.5 47 246.0 48 228.0 49 204.5 50 173.0 51 138.5 52 116.0 53 94.0 54 71.5 55 62.0 56 47.0 57 35.0 58 26.5 59 22.0 60 20.0 61 11.5 62 6.5 63 4.0 64 1.5 65 1.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9749999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.145 40-44 0.19 45-49 0.18 50-54 0.18 55-59 0.24 60-64 0.25 65-69 0.25 70-74 0.25 75-79 0.25 80-84 0.25 85-89 0.25 90-94 0.25 95-99 0.25 100-104 0.15 105-109 0.26 110-114 0.215 115-119 0.21 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96438494569337 97.95 2 1.035615054306643 2.0500000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.262499999999999 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.574999999999999 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.949999999999999 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172503 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172503_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80775 33.0 33.0 34.0 32.0 34.0 2 32.86675 34.0 33.0 34.0 32.0 34.0 3 32.91575 34.0 33.0 34.0 32.0 34.0 4 32.81525 34.0 33.0 34.0 32.0 34.0 5 32.73 34.0 33.0 34.0 32.0 34.0 6 36.96075 38.0 38.0 38.0 37.0 38.0 7 36.94175 38.0 38.0 38.0 37.0 38.0 8 36.976 38.0 38.0 38.0 37.0 38.0 9 37.07875 38.0 38.0 38.0 37.0 38.0 10-14 36.95595 38.0 38.0 38.0 36.6 38.0 15-19 36.97115 38.0 38.0 38.0 36.8 38.0 20-24 37.01225 38.0 38.0 38.0 37.0 38.0 25-29 36.94135 38.0 38.0 38.0 37.0 38.0 30-34 36.97175 38.0 38.0 38.0 37.0 38.0 35-39 36.8483 38.0 38.0 38.0 36.2 38.0 40-44 36.9091 38.0 38.0 38.0 37.0 38.0 45-49 36.93085 38.0 38.0 38.0 36.4 38.0 50-54 36.81825 38.0 38.0 38.0 36.2 38.0 55-59 36.687799999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.6672 38.0 38.0 38.0 36.0 38.0 65-69 36.4863 38.0 38.0 38.0 35.2 38.0 70-74 36.48365 38.0 38.0 38.0 35.0 38.0 75-79 36.40185 38.0 38.0 38.0 35.0 38.0 80-84 36.39785 38.0 38.0 38.0 34.6 38.0 85-89 36.2771 38.0 38.0 38.0 34.0 38.0 90-94 36.1655 38.0 38.0 38.0 34.0 38.0 95-99 35.9893 38.0 38.0 38.0 33.4 38.0 100-104 35.831599999999995 38.0 38.0 38.0 32.6 38.0 105-109 35.66695 38.0 37.0 38.0 31.2 38.0 110-114 35.47494999999999 38.0 37.0 38.0 30.4 38.0 115-119 35.16095 38.0 36.6 38.0 28.4 38.0 120-124 34.97709999999999 38.0 36.2 38.0 28.0 38.0 125-129 34.64195 38.0 35.8 38.0 26.8 38.0 130-134 33.8327 38.0 35.0 38.0 21.0 38.0 135-139 33.3591 38.0 33.0 38.0 18.6 38.0 140-144 32.704699999999995 38.0 33.0 38.0 13.8 38.0 145-149 31.63205 38.0 32.4 38.0 8.6 38.0 150-151 26.521375 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 6.0 4 4.0 5 3.0 6 1.0 7 1.0 8 7.0 9 1.0 10 3.0 11 2.0 12 3.0 13 4.0 14 4.0 15 2.0 16 5.0 17 3.0 18 8.0 19 10.0 20 8.0 21 10.0 22 14.0 23 11.0 24 15.0 25 18.0 26 18.0 27 48.0 28 36.0 29 47.0 30 65.0 31 65.0 32 83.0 33 81.0 34 149.0 35 262.0 36 597.0 37 2396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 18.25 12.1 29.875 2 24.956239059764943 25.70642660665166 33.4333583395849 15.9039759939985 3 19.979994998749685 27.956989247311824 30.182545636409102 21.880470117529384 4 23.479349186483102 36.520650813516895 21.426783479349186 18.573216520650814 5 22.836418209104554 37.143571785892945 23.936968484242122 16.08304152076038 6 20.025000000000002 37.1 24.65 18.224999999999998 7 18.375 19.825 40.050000000000004 21.75 8 21.025 24.125 29.775000000000002 25.074999999999996 9 21.6 24.15 29.675 24.575 10-14 22.97 28.37 26.740000000000002 21.92 15-19 22.785 28.095 28.055000000000003 21.065 20-24 21.995 28.175 28.025 21.805 25-29 22.869999999999997 27.85 28.38 20.9 30-34 22.425 27.595 28.720000000000002 21.26 35-39 22.6 28.1 27.93 21.37 40-44 22.915 27.455000000000002 28.325 21.305 45-49 23.26 28.050000000000004 27.63 21.060000000000002 50-54 22.425 27.544999999999998 28.73 21.3 55-59 22.785 27.46 28.26 21.495 60-64 23.07 26.705000000000002 28.915000000000003 21.310000000000002 65-69 23.125 27.175 28.78 20.919999999999998 70-74 23.225 27.865000000000002 27.82 21.09 75-79 23.395 27.689999999999998 28.044999999999998 20.87 80-84 22.925 28.389999999999997 27.735 20.95 85-89 23.064999999999998 27.275 28.365000000000002 21.295 90-94 22.785 27.485 28.285 21.445 95-99 22.939999999999998 28.044999999999998 27.915 21.099999999999998 100-104 23.715 27.884999999999998 27.51 20.89 105-109 23.57 27.589999999999996 28.115000000000002 20.724999999999998 110-114 22.994999999999997 28.23 27.79 20.985 115-119 24.099999999999998 27.794999999999998 27.235 20.87 120-124 23.46 28.544999999999998 26.905 21.09 125-129 23.674999999999997 27.76 27.85 20.715 130-134 24.5 28.125 26.745 20.630000000000003 135-139 24.675 27.725 27.455000000000002 20.145 140-144 24.7 28.26 26.85 20.19 145-149 24.75 28.525 26.365 20.36 150-151 24.325 27.625 28.512500000000003 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 2.5 22 0.5 23 1.0 24 2.5 25 2.5 26 6.0 27 9.0 28 9.0 29 14.5 30 20.5 31 24.0 32 28.0 33 39.0 34 54.0 35 66.5 36 74.5 37 97.0 38 138.0 39 169.5 40 197.0 41 225.5 42 246.0 43 259.5 44 273.5 45 263.5 46 239.0 47 226.0 48 233.0 49 224.0 50 176.5 51 137.0 52 107.5 53 95.0 54 87.5 55 68.5 56 54.5 57 37.0 58 27.5 59 23.0 60 12.5 61 8.0 62 7.0 63 4.5 64 0.5 65 1.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.125 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14076320444781 98.075 2 0.7581501137225171 1.5 3 0.050543340914834464 0.15 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.65 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.175 0.0 0.0 0.0 0.0 128-129 5.4875 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 7.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATGT 10 0.006830828 145.0 3 GGAAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807334 spots for SRR7172503.sra Written 807334 spots for SRR7172503.sra Read 807353 spots for SRR7172503.sra Written 807353 spots for SRR7172503.sra SRR ids: ['SRR7172503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_51h8f69u SRR7172503.sra spots: 16146699 blocks: [[1, 807334], [807335, 1614668], [1614669, 2422002], [2422003, 3229336], [3229337, 4036670], [4036671, 4844004], [4844005, 5651338], [5651339, 6458672], [6458673, 7266006], [7266007, 8073340], [8073341, 8880674], [8880675, 9688008], [9688009, 10495342], [10495343, 11302676], [11302677, 12110010], [12110011, 12917344], [12917345, 13724678], [13724679, 14532012], [14532013, 15339346], [15339347, 16146699]] SRR7172503 file size 5449886 SRR7172503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172503 SRR7172503_1.fastq SRR7172503_2.fastq Input file: SRR7172503_1.fastq Paired file: SRR7172503_2.fastq trimmed: SRR7172503-trimmed-pair1.fastq, SRR7172503-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:33:30 2025 >> started Mon Feb 10 13:33:47 2025 >> done (16.994s) 16146699 read pairs processed; of these: 19724 ( 0.12%) short read pairs filtered out after trimming by size control 64458 ( 0.40%) empty read pairs filtered out after trimming by size control 16062517 (99.48%) read pairs available; of these: 8354660 (52.01%) trimmed read pairs available after processing 7707857 (47.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 7 0.00% 21 2 0.00% 22 5 0.00% 23 14 0.00% 24 5 0.00% 25 4 0.00% 26 10 0.00% 27 9 0.00% 28 14 0.00% 29 13 0.00% 30 11 0.00% 31 17 0.00% 32 14 0.00% 33 12 0.00% 34 14 0.00% 35 12 0.00% 36 25 0.00% 37 26 0.00% 38 26 0.00% 39 31 0.00% 40 28 0.00% 41 26 0.00% 42 24 0.00% 43 32 0.00% 44 32 0.00% 45 72 0.00% 46 59 0.00% 47 48 0.00% 48 68 0.00% 49 69 0.00% 50 112 0.00% 51 95 0.00% 52 124 0.00% 53 133 0.00% 54 126 0.00% 55 181 0.00% 56 177 0.00% 57 213 0.00% 58 223 0.00% 59 271 0.00% 60 314 0.00% 61 375 0.00% 62 402 0.00% 63 467 0.00% 64 528 0.00% 65 580 0.00% 66 645 0.00% 67 714 0.00% 68 861 0.01% 69 909 0.01% 70 1168 0.01% 71 1319 0.01% 72 1393 0.01% 73 1549 0.01% 74 1749 0.01% 75 1988 0.01% 76 2239 0.01% 77 2429 0.02% 78 2718 0.02% 79 2968 0.02% 80 3425 0.02% 81 3819 0.02% 82 4346 0.03% 83 5012 0.03% 84 6043 0.04% 85 6744 0.04% 86 7302 0.05% 87 7778 0.05% 88 8363 0.05% 89 8813 0.05% 90 9542 0.06% 91 10518 0.07% 92 11135 0.07% 93 12162 0.08% 94 12653 0.08% 95 13533 0.08% 96 13894 0.09% 97 14454 0.09% 98 15019 0.09% 99 15598 0.10% 100 17077 0.11% 101 17883 0.11% 102 19291 0.12% 103 20225 0.13% 104 20519 0.13% 105 21396 0.13% 106 22229 0.14% 107 23176 0.14% 108 23821 0.15% 109 25029 0.16% 110 25756 0.16% 111 27226 0.17% 112 28413 0.18% 113 29729 0.19% 114 30931 0.19% 115 32741 0.20% 116 33633 0.21% 117 34448 0.21% 118 36119 0.22% 119 36710 0.23% 120 38359 0.24% 121 40070 0.25% 122 41425 0.26% 123 44097 0.27% 124 45292 0.28% 125 47196 0.29% 126 48591 0.30% 127 50402 0.31% 128 52408 0.33% 129 53809 0.33% 130 56283 0.35% 131 58303 0.36% 132 61409 0.38% 133 64696 0.40% 134 67585 0.42% 135 71470 0.44% 136 74902 0.47% 137 79986 0.50% 138 85275 0.53% 139 90539 0.56% 140 96867 0.60% 141 105677 0.66% 142 116689 0.73% 143 130881 0.81% 144 151610 0.94% 145 183053 1.14% 146 222222 1.38% 147 302385 1.88% 148 445894 2.78% 149 860191 5.36% 150 3822871 23.80% 151 7707857 47.99% 16062517 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=7 prefix-density=0.51 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=333.09 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.79 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=12.98 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.1 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGC SRR7172503 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:34:53 Started mapping on | Feb 10 13:34:53 Finished on | Feb 10 13:36:54 Mapping speed, Million of reads per hour | 477.89 Number of input reads | 16062517 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15025409 Uniquely mapped reads % | 93.54% Average mapped length | 292.26 Number of splices: Total | 14475058 Number of splices: Annotated (sjdb) | 14161254 Number of splices: GT/AG | 14194867 Number of splices: GC/AG | 228677 Number of splices: AT/AC | 7620 Number of splices: Non-canonical | 43894 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422809 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 54163 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631515 631515 631515 N_multimapping 422809 422809 422809 N_noFeature 613259 14783772 718273 N_ambiguous 239105 969 101842 UnstrandedReadsAssigned:14173045 PositiveStrandReadsAssigned:240668 NegativeStrandReadsAssigned:14205294 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172503 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172503-trimmed-pair1.fastq SRR7172503-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,062,517 reads, 14,193,305 reads pseudoaligned [quant] estimated average fragment length: 241.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7172503.ke.tsv 34699 SRR7172503.se.tsv 87100 total ==> SRR7172503.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.07 441 16.781 Potri.005G024800.1.v4.1 1035 794.074 120 10.2189 Potri.004G059700.1.v4.1 961 720.141 14 1.3146 Potri.007G009000.2.v4.1 1416 1175.07 0 0 Potri.003G141000.2.v4.1 2943 2702.07 827 20.6963 Potri.016G087400.1.v4.1 270 84.1218 534 429.257 Potri.015G069301.1.v4.1 564 330.558 0 0 Potri.010G195200.1.v4.1 1773 1532.07 15 0.662058 Potri.012G127500.1.v4.1 977 736.119 48 4.40938 ==> SRR7172503.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1086 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7172503 completed mapping pipeline successfully