Starting /dee2/code/volunteer_pipeline.sh SRR7172504 current disk space = 3058928001024 free memory = 1349400664 SRR7172504 SRAfilesize 072928d659a761d49af1c47fd22f86d9 SRR7172504.sra SRR7172504.sra file validated SRR7172504 is paired end SRR7172504 is conventional basespace SRR7172504 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4485 34.0 33.0 34.0 32.0 34.0 2 33.29325 34.0 33.0 34.0 32.0 34.0 3 33.3515 34.0 33.0 34.0 33.0 34.0 4 33.473 34.0 34.0 34.0 33.0 34.0 5 33.4695 34.0 34.0 34.0 33.0 34.0 6 37.133 38.0 38.0 38.0 36.0 38.0 7 37.356 38.0 38.0 38.0 37.0 38.0 8 37.5415 38.0 38.0 38.0 37.0 38.0 9 37.46125 38.0 38.0 38.0 37.0 38.0 10-14 37.46925 38.0 38.0 38.0 37.2 38.0 15-19 37.4405 38.0 38.0 38.0 37.2 38.0 20-24 37.4287 38.0 38.0 38.0 37.2 38.0 25-29 37.4279 38.0 38.0 38.0 37.2 38.0 30-34 37.440250000000006 38.0 38.0 38.0 37.2 38.0 35-39 37.2748 38.0 38.0 38.0 36.8 38.0 40-44 37.04600000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.98905 38.0 38.0 38.0 36.0 38.0 50-54 36.783699999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.818949999999994 38.0 38.0 38.0 35.6 38.0 60-64 36.7571 38.0 38.0 38.0 35.0 38.0 65-69 36.661699999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.5434 38.0 38.0 38.0 34.2 38.0 75-79 36.43175 38.0 38.0 38.0 34.0 38.0 80-84 36.28585 38.0 37.6 38.0 33.8 38.0 85-89 36.200199999999995 38.0 37.6 38.0 33.4 38.0 90-94 36.0037 38.0 37.0 38.0 33.0 38.0 95-99 35.7462 38.0 36.8 38.0 31.4 38.0 100-104 35.407050000000005 38.0 36.0 38.0 29.4 38.0 105-109 35.485 38.0 36.0 38.0 30.2 38.0 110-114 35.185950000000005 38.0 36.0 38.0 28.8 38.0 115-119 34.9516 38.0 35.4 38.0 27.8 38.0 120-124 34.54995 38.0 35.0 38.0 26.0 38.0 125-129 34.1923 38.0 34.8 38.0 23.8 38.0 130-134 33.680949999999996 38.0 34.2 38.0 19.4 38.0 135-139 33.217299999999994 38.0 33.6 38.0 15.0 38.0 140-144 32.453500000000005 38.0 32.2 38.0 14.0 38.0 145-149 31.307 37.4 31.0 38.0 8.6 38.0 150-151 25.68 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 4.0 10 2.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 2.0 17 0.0 18 4.0 19 5.0 20 8.0 21 9.0 22 13.0 23 13.0 24 11.0 25 21.0 26 23.0 27 34.0 28 41.0 29 47.0 30 62.0 31 92.0 32 94.0 33 146.0 34 227.0 35 374.0 36 907.0 37 1851.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.942510956432066 14.23047177107502 8.533127094612013 40.2938901778809 2 20.3 19.375 38.45 21.875 3 19.0 23.724999999999998 28.050000000000004 29.225 4 22.525000000000002 31.5 22.875 23.1 5 21.15 36.449999999999996 23.775 18.625 6 17.1 36.475 25.4 21.025 7 13.750000000000002 22.575 43.824999999999996 19.85 8 16.150000000000002 23.9 32.175 27.775 9 17.45 23.674999999999997 33.525 25.35 10-14 20.13 28.99 27.439999999999998 23.44 15-19 20.06 28.21 27.85 23.880000000000003 20-24 19.994999999999997 28.225 28.21 23.57 25-29 19.54 28.810000000000002 28.275 23.375 30-34 19.64 28.29 27.61 24.46 35-39 20.419293505453815 28.840188131692184 27.509256479535676 23.23126188331832 40-44 19.524524524524526 28.85885885885886 28.06806806806807 23.54854854854855 45-49 20.305305305305303 28.293293293293292 27.61761761761762 23.783783783783786 50-54 20.284270056553726 28.642210099594617 27.426054752014412 23.647465091837244 55-59 20.113158421790505 28.53995593831364 28.149409172841978 23.197476467053875 60-64 19.826722756410255 27.974759615384613 27.914663461538463 24.283854166666664 65-69 20.268442930835878 28.261631692292283 27.695697901537535 23.7742274753343 70-74 20.224381448462385 28.09275768806972 27.667033957728137 24.015826905739758 75-79 19.7145003756574 28.174305033809166 28.67017280240421 23.441021788129227 80-84 20.57394701257074 28.051284619622376 28.02624330144739 23.348525066359493 85-89 20.260390585878817 28.382573860791187 27.99198798197296 23.365047571357035 90-94 20.278459458105875 28.877648119397005 27.705714428807532 23.138177993689588 95-99 20.600901352028043 28.657986980470707 27.1407110665999 23.600400600901352 100-104 20.336353170829373 28.815256018819763 27.488863306471796 23.359527503879075 105-109 20.515902829952417 28.259454044578014 27.24267468069121 23.981968444778364 110-114 20.191296509589865 28.21373128348941 27.89323451349592 23.70173769342481 115-119 21.20180270405608 28.477716574862296 27.000500751126687 23.319979969954932 120-124 20.68 28.884999999999998 26.83 23.605 125-129 21.02 28.720000000000002 26.685 23.575 130-134 20.27 29.049999999999997 27.125 23.555 135-139 20.995 28.384999999999998 26.755000000000003 23.865 140-144 20.715 28.1 27.33 23.855 145-149 20.535 28.735 26.305 24.425 150-151 20.599999999999998 28.000000000000004 26.937499999999996 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 2.0 21 3.5 22 3.5 23 3.0 24 5.5 25 7.5 26 8.5 27 14.0 28 17.5 29 18.5 30 25.0 31 34.5 32 43.0 33 53.5 34 56.0 35 73.0 36 95.0 37 114.0 38 138.5 39 146.5 40 175.0 41 217.5 42 252.5 43 254.5 44 242.5 45 246.5 46 237.5 47 222.5 48 208.5 49 204.0 50 174.0 51 146.5 52 118.5 53 93.0 54 82.0 55 62.5 56 52.5 57 35.5 58 25.0 59 26.0 60 20.5 61 13.0 62 10.0 63 5.0 64 2.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06999999999999999 40-44 0.1 45-49 0.1 50-54 0.095 55-59 0.13999999999999999 60-64 0.16 65-69 0.165 70-74 0.16999999999999998 75-79 0.17500000000000002 80-84 0.165 85-89 0.15 90-94 0.165 95-99 0.15 100-104 0.105 105-109 0.17500000000000002 110-114 0.155 115-119 0.15 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.5875 0.0 0.0 0.0 0.0 108-109 2.9125 0.0 0.0 0.0 0.0 110-111 3.1625 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.55 0.0 0.0 0.0 0.0 120-121 5.0125 0.0 0.0 0.0 0.0 122-123 5.55 0.0 0.0 0.0 0.0 124-125 5.949999999999999 0.0 0.0 0.0 0.0 126-127 6.387499999999999 0.0 0.0 0.0 0.0 128-129 6.800000000000001 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 8.024999999999999 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138-139 9.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007712375 18.101562 140-144 >>END_MODULE SRR7172504 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172504_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75 33.0 33.0 34.0 32.0 34.0 2 32.84575 34.0 33.0 34.0 32.0 34.0 3 32.8975 34.0 33.0 34.0 32.0 34.0 4 32.801 34.0 33.0 34.0 32.0 34.0 5 32.67875 34.0 33.0 34.0 32.0 34.0 6 36.94675 38.0 38.0 38.0 36.0 38.0 7 37.04875 38.0 38.0 38.0 37.0 38.0 8 37.00075 38.0 38.0 38.0 37.0 38.0 9 36.983 38.0 38.0 38.0 37.0 38.0 10-14 36.9269 38.0 38.0 38.0 36.6 38.0 15-19 36.920449999999995 38.0 38.0 38.0 36.8 38.0 20-24 36.946799999999996 38.0 38.0 38.0 37.0 38.0 25-29 36.93345000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.906699999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.80605 38.0 38.0 38.0 36.2 38.0 40-44 36.8097 38.0 38.0 38.0 36.0 38.0 45-49 36.841750000000005 38.0 38.0 38.0 36.4 38.0 50-54 36.70985 38.0 38.0 38.0 36.0 38.0 55-59 36.60685 38.0 38.0 38.0 35.6 38.0 60-64 36.60025 38.0 38.0 38.0 35.6 38.0 65-69 36.492650000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.3537 38.0 38.0 38.0 34.4 38.0 75-79 36.3474 38.0 38.0 38.0 34.4 38.0 80-84 36.275099999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.19855 38.0 38.0 38.0 34.0 38.0 90-94 36.031699999999994 38.0 38.0 38.0 33.4 38.0 95-99 35.9173 38.0 38.0 38.0 33.0 38.0 100-104 35.707049999999995 38.0 38.0 38.0 32.2 38.0 105-109 35.47239999999999 38.0 37.0 38.0 31.0 38.0 110-114 35.265049999999995 38.0 37.0 38.0 29.4 38.0 115-119 34.9232 38.0 36.2 38.0 27.8 38.0 120-124 34.72365 38.0 36.2 38.0 27.0 38.0 125-129 34.216699999999996 38.0 35.6 38.0 23.0 38.0 130-134 33.5409 38.0 35.0 38.0 17.4 38.0 135-139 33.0158 38.0 33.0 38.0 14.2 38.0 140-144 32.17525 38.0 32.8 38.0 13.0 38.0 145-149 31.147250000000003 38.0 32.2 38.0 3.8 38.0 150-151 26.17625 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 6.0 4 2.0 5 0.0 6 3.0 7 2.0 8 1.0 9 1.0 10 1.0 11 4.0 12 2.0 13 5.0 14 5.0 15 10.0 16 1.0 17 10.0 18 7.0 19 8.0 20 12.0 21 18.0 22 8.0 23 14.0 24 24.0 25 26.0 26 31.0 27 38.0 28 34.0 29 42.0 30 53.0 31 61.0 32 85.0 33 131.0 34 155.0 35 252.0 36 589.0 37 2343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5 20.825 11.425 29.25 2 23.95 26.375 34.9 14.774999999999999 3 20.525 27.775 31.25 20.45 4 23.767825869402053 36.0270202651989 22.641981486114584 17.563172379284463 5 23.849999999999998 37.4 22.375 16.375 6 19.05 38.625 23.674999999999997 18.65 7 17.875 20.349999999999998 40.8 20.974999999999998 8 20.974999999999998 23.799999999999997 29.599999999999998 25.624999999999996 9 21.85 24.375 30.0 23.775 10-14 23.77 28.1 26.51 21.62 15-19 22.705000000000002 28.175 28.17 20.95 20-24 23.625 28.139999999999997 27.605 20.630000000000003 25-29 22.89 28.544999999999998 28.49 20.075000000000003 30-34 22.705000000000002 28.76 28.325 20.21 35-39 23.29 28.275 27.765 20.669999999999998 40-44 22.805 28.335 27.58 21.279999999999998 45-49 22.84 28.299999999999997 28.04 20.82 50-54 22.720000000000002 27.884999999999998 28.310000000000002 21.085 55-59 23.66 28.255000000000003 27.165 20.919999999999998 60-64 23.369999999999997 28.125 28.01 20.495 65-69 23.435 27.855 27.83 20.880000000000003 70-74 23.990000000000002 28.105000000000004 27.16 20.745 75-79 23.724999999999998 28.244999999999997 27.35 20.68 80-84 23.755000000000003 27.955000000000002 27.584999999999997 20.705000000000002 85-89 23.57 27.66 27.93 20.84 90-94 23.215 28.535 27.815 20.435 95-99 23.47 27.88 28.144999999999996 20.505000000000003 100-104 23.915 27.925 27.13 21.029999999999998 105-109 23.62 28.165000000000003 27.98 20.235 110-114 24.19 27.455000000000002 28.044999999999998 20.31 115-119 24.315 28.12 26.76 20.805 120-124 24.36 28.485 27.095000000000002 20.06 125-129 24.88 27.685 27.389999999999997 20.044999999999998 130-134 24.77 27.884999999999998 27.61 19.735 135-139 25.264999999999997 27.05 27.439999999999998 20.244999999999997 140-144 25.424999999999997 28.23 26.875 19.470000000000002 145-149 25.755 27.96 26.584999999999997 19.7 150-151 25.837500000000002 27.987499999999997 26.3 19.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 2.0 21 2.0 22 1.0 23 2.5 24 5.0 25 6.5 26 6.5 27 8.5 28 15.0 29 14.0 30 16.5 31 29.0 32 42.0 33 48.0 34 52.5 35 66.0 36 85.5 37 102.5 38 112.0 39 161.5 40 206.5 41 215.5 42 233.5 43 247.5 44 249.5 45 259.0 46 279.0 47 262.5 48 217.5 49 200.5 50 171.5 51 120.5 52 115.0 53 110.0 54 91.0 55 68.0 56 40.0 57 35.5 58 27.0 59 21.0 60 17.0 61 8.0 62 8.5 63 6.0 64 1.5 65 1.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.137499999999999 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.05 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.949999999999999 0.0 0.0 0.0 0.0 126-127 6.387499999999999 0.0 0.0 0.0 0.0 128-129 6.8125 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 8.024999999999999 0.0 0.0 0.0 0.0 134-135 8.8 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 9.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAATT 10 0.006830828 145.0 1 GGAATTG 10 0.006830828 145.0 2 >>END_MODULE Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830258 spots for SRR7172504.sra Written 830258 spots for SRR7172504.sra Read 830265 spots for SRR7172504.sra Written 830265 spots for SRR7172504.sra SRR ids: ['SRR7172504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cty1jy6w SRR7172504.sra spots: 16605167 blocks: [[1, 830258], [830259, 1660516], [1660517, 2490774], [2490775, 3321032], [3321033, 4151290], [4151291, 4981548], [4981549, 5811806], [5811807, 6642064], [6642065, 7472322], [7472323, 8302580], [8302581, 9132838], [9132839, 9963096], [9963097, 10793354], [10793355, 11623612], [11623613, 12453870], [12453871, 13284128], [13284129, 14114386], [14114387, 14944644], [14944645, 15774902], [15774903, 16605167]] SRR7172504 file size 5605245 SRR7172504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172504 SRR7172504_1.fastq SRR7172504_2.fastq Input file: SRR7172504_1.fastq Paired file: SRR7172504_2.fastq trimmed: SRR7172504-trimmed-pair1.fastq, SRR7172504-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:25:43 2025 >> started Mon Feb 10 13:26:03 2025 >> done (20.330s) 16605167 read pairs processed; of these: 26348 ( 0.16%) short read pairs filtered out after trimming by size control 84411 ( 0.51%) empty read pairs filtered out after trimming by size control 16494408 (99.33%) read pairs available; of these: 8958403 (54.31%) trimmed read pairs available after processing 7536005 (45.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 9 0.00% 21 8 0.00% 22 15 0.00% 23 9 0.00% 24 5 0.00% 25 7 0.00% 26 13 0.00% 27 9 0.00% 28 12 0.00% 29 17 0.00% 30 19 0.00% 31 16 0.00% 32 10 0.00% 33 13 0.00% 34 24 0.00% 35 10 0.00% 36 26 0.00% 37 34 0.00% 38 18 0.00% 39 34 0.00% 40 48 0.00% 41 49 0.00% 42 48 0.00% 43 56 0.00% 44 70 0.00% 45 61 0.00% 46 96 0.00% 47 107 0.00% 48 103 0.00% 49 133 0.00% 50 125 0.00% 51 167 0.00% 52 172 0.00% 53 173 0.00% 54 218 0.00% 55 219 0.00% 56 249 0.00% 57 301 0.00% 58 351 0.00% 59 404 0.00% 60 482 0.00% 61 519 0.00% 62 585 0.00% 63 691 0.00% 64 788 0.00% 65 874 0.01% 66 953 0.01% 67 1056 0.01% 68 1330 0.01% 69 1414 0.01% 70 1753 0.01% 71 1853 0.01% 72 2015 0.01% 73 2396 0.01% 74 2679 0.02% 75 2850 0.02% 76 3243 0.02% 77 3550 0.02% 78 4064 0.02% 79 4555 0.03% 80 5049 0.03% 81 5562 0.03% 82 6393 0.04% 83 7026 0.04% 84 8807 0.05% 85 9953 0.06% 86 10590 0.06% 87 11189 0.07% 88 11922 0.07% 89 12460 0.08% 90 13541 0.08% 91 14717 0.09% 92 15699 0.10% 93 17163 0.10% 94 18019 0.11% 95 19032 0.12% 96 19944 0.12% 97 21016 0.13% 98 21761 0.13% 99 22622 0.14% 100 24341 0.15% 101 25310 0.15% 102 26835 0.16% 103 27728 0.17% 104 28939 0.18% 105 30114 0.18% 106 31195 0.19% 107 32247 0.20% 108 33365 0.20% 109 34554 0.21% 110 35667 0.22% 111 37338 0.23% 112 38480 0.23% 113 40576 0.25% 114 41880 0.25% 115 44274 0.27% 116 45131 0.27% 117 45825 0.28% 118 47221 0.29% 119 48669 0.30% 120 49579 0.30% 121 51136 0.31% 122 52995 0.32% 123 55150 0.33% 124 57265 0.35% 125 58507 0.35% 126 60724 0.37% 127 63202 0.38% 128 64212 0.39% 129 65729 0.40% 130 68888 0.42% 131 70032 0.42% 132 72612 0.44% 133 76688 0.46% 134 79193 0.48% 135 82948 0.50% 136 86749 0.53% 137 91774 0.56% 138 97452 0.59% 139 102440 0.62% 140 108789 0.66% 141 117108 0.71% 142 127963 0.78% 143 141906 0.86% 144 163068 0.99% 145 194230 1.18% 146 234521 1.42% 147 314223 1.91% 148 458016 2.78% 149 873179 5.29% 150 3784848 22.95% 151 7536005 45.69% 16494408 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.35 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=13.27 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=2.2 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.68 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=73.70 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.8 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172504 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:26:53 Started mapping on | Feb 10 13:26:53 Finished on | Feb 10 13:29:02 Mapping speed, Million of reads per hour | 460.31 Number of input reads | 16494408 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15239718 Uniquely mapped reads % | 92.39% Average mapped length | 290.14 Number of splices: Total | 13961681 Number of splices: Annotated (sjdb) | 13619452 Number of splices: GT/AG | 13698553 Number of splices: GC/AG | 206146 Number of splices: AT/AC | 8928 Number of splices: Non-canonical | 48054 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398864 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 79296 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874125 874125 874125 N_multimapping 398864 398864 398864 N_noFeature 755932 14953316 905531 N_ambiguous 245147 1259 107473 UnstrandedReadsAssigned:14238639 PositiveStrandReadsAssigned:285143 NegativeStrandReadsAssigned:14226714 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7172504 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172504-trimmed-pair1.fastq SRR7172504-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,494,408 reads, 14,218,638 reads pseudoaligned [quant] estimated average fragment length: 231.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR7172504.ke.tsv 34699 SRR7172504.se.tsv 87100 total ==> SRR7172504.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.21 1301.71 49.9656 Potri.005G024800.1.v4.1 1035 804.21 443 37.789 Potri.004G059700.1.v4.1 961 730.304 14 1.31509 Potri.007G009000.2.v4.1 1416 1185.21 0 0 Potri.003G141000.2.v4.1 2943 2712.21 484 12.242 Potri.016G087400.1.v4.1 270 89.7705 619.047 473.065 Potri.015G069301.1.v4.1 564 339.897 0 0 Potri.010G195200.1.v4.1 1773 1542.21 144.901 6.44554 Potri.012G127500.1.v4.1 977 746.258 185 17.0065 ==> SRR7172504.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 569 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7172504 completed mapping pipeline successfully