Starting /dee2/code/volunteer_pipeline.sh SRR7172505 current disk space = 3059112255488 free memory = 1427027128 SRR7172505 SRAfilesize 591fcf2bd2590b5c4a2a10b380b8a0b9 SRR7172505.sra SRR7172505.sra file validated SRR7172505 is paired end SRR7172505 is conventional basespace SRR7172505 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4035 34.0 33.0 34.0 32.0 34.0 2 33.32325 34.0 33.0 34.0 32.0 34.0 3 33.4225 34.0 34.0 34.0 33.0 34.0 4 33.4585 34.0 34.0 34.0 33.0 34.0 5 33.42925 34.0 34.0 34.0 33.0 34.0 6 37.24925 38.0 38.0 38.0 36.0 38.0 7 37.44875 38.0 38.0 38.0 37.0 38.0 8 37.53475 38.0 38.0 38.0 38.0 38.0 9 37.523 38.0 38.0 38.0 38.0 38.0 10-14 37.53605 38.0 38.0 38.0 38.0 38.0 15-19 37.50789999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.506150000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.4672 38.0 38.0 38.0 37.8 38.0 30-34 37.4698 38.0 38.0 38.0 38.0 38.0 35-39 37.38345 38.0 38.0 38.0 37.0 38.0 40-44 37.1445 38.0 38.0 38.0 36.4 38.0 45-49 37.120850000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.008500000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.89175 38.0 38.0 38.0 35.8 38.0 60-64 36.9338 38.0 38.0 38.0 36.0 38.0 65-69 36.85475 38.0 38.0 38.0 35.6 38.0 70-74 36.65135 38.0 38.0 38.0 34.8 38.0 75-79 36.52915 38.0 38.0 38.0 34.2 38.0 80-84 36.39390000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.302350000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.2315 38.0 38.0 38.0 33.6 38.0 95-99 36.064949999999996 38.0 37.2 38.0 33.4 38.0 100-104 35.85979999999999 38.0 37.0 38.0 32.2 38.0 105-109 35.67505 38.0 37.0 38.0 31.2 38.0 110-114 35.293600000000005 38.0 36.0 38.0 29.0 38.0 115-119 35.24785 38.0 36.0 38.0 28.8 38.0 120-124 35.132549999999995 38.0 36.0 38.0 28.4 38.0 125-129 34.68455 38.0 35.0 38.0 27.2 38.0 130-134 34.0712 38.0 34.4 38.0 23.2 38.0 135-139 33.510000000000005 38.0 33.8 38.0 20.2 38.0 140-144 32.862899999999996 38.0 33.2 38.0 16.2 38.0 145-149 31.552750000000003 38.0 31.2 38.0 10.6 38.0 150-151 26.404125 33.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 4.0 11 3.0 12 2.0 13 3.0 14 5.0 15 2.0 16 5.0 17 2.0 18 6.0 19 3.0 20 6.0 21 2.0 22 10.0 23 6.0 24 13.0 25 11.0 26 25.0 27 29.0 28 31.0 29 41.0 30 45.0 31 86.0 32 81.0 33 137.0 34 209.0 35 358.0 36 840.0 37 2034.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.74657357124386 14.765968450995604 7.990690457719161 37.496767520041374 2 21.224999999999998 19.650000000000002 37.4 21.725 3 18.85 25.45 26.724999999999998 28.975 4 23.025000000000002 32.975 22.400000000000002 21.6 5 20.7 36.325 24.375 18.6 6 17.1 35.675000000000004 26.625 20.599999999999998 7 13.8 22.75 45.275 18.175 8 17.825 22.25 31.275 28.65 9 16.875 23.775 32.7 26.650000000000002 10-14 20.28 28.754999999999995 27.13 23.835 15-19 20.11 28.095 27.744999999999997 24.05 20-24 20.19 28.115000000000002 27.88 23.815 25-29 19.8 28.360000000000003 27.525 24.315 30-34 20.330000000000002 28.655 27.175 23.84 35-39 19.81297194579187 28.774316147422113 27.614142121318196 23.798569785467823 40-44 20.182109265559337 28.847308385031017 27.77166299779868 23.198919351610968 45-49 19.941979692892513 28.845095783524233 27.619666883409195 23.593257640174063 50-54 19.96097853819601 29.361148631747465 27.204962729501226 23.472910100555307 55-59 20.48253078386225 28.61647812593853 27.700470517569325 23.200520572629895 60-64 20.547739448255147 28.178040354478544 27.637310368998147 23.636909828268163 65-69 20.46648981430502 28.274688422843987 27.754141848941387 23.504679913909605 70-74 20.63611319809667 27.9839719509141 27.893814174805907 23.486100676183323 75-79 20.211433438549026 28.473370409339143 27.426223758705348 23.888972393406483 80-84 20.182246032143393 28.198067390977823 27.70239823762079 23.917288339257997 85-89 20.4625087596356 28.636500150165183 27.460206226849532 23.440784863349684 90-94 20.486632622409132 27.485731450886153 27.8862521277661 24.14138379893862 95-99 20.823741367230507 27.850065058552698 28.175357822039835 23.15083575217696 100-104 20.337540064102562 28.41045673076923 27.954727564102566 23.297275641025642 105-109 20.419005613472333 28.222734562951086 27.821772253408177 23.536487570168404 110-114 20.96192384769539 28.45190380761523 27.47995991983968 23.106212424849698 115-119 20.485971943887776 28.401803607214426 27.53507014028056 23.577154308617235 120-124 20.665 27.655 28.044999999999998 23.635 125-129 20.919873880186177 27.70632100495471 27.581202142034932 23.792602972824184 130-134 21.438638880499344 28.148595590456054 27.202255109231853 23.210510419812746 135-139 20.870969369733057 28.359489327345212 27.26951607205934 23.50002523086239 140-144 21.08485122183752 28.355662602237945 26.890461137036482 23.66902503888805 145-149 21.561078053902698 27.931396569828493 27.1963598179909 23.311165558277914 150-151 21.725 27.737499999999997 26.974999999999998 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 5.0 23 5.5 24 3.5 25 4.5 26 5.0 27 6.0 28 11.0 29 17.5 30 22.0 31 27.0 32 34.0 33 39.0 34 59.5 35 84.5 36 96.0 37 109.5 38 127.5 39 163.0 40 194.0 41 201.0 42 215.0 43 244.5 44 269.5 45 272.0 46 264.5 47 238.0 48 217.5 49 204.5 50 169.5 51 130.5 52 99.5 53 103.0 54 91.5 55 65.5 56 57.5 57 44.5 58 30.0 59 21.0 60 16.5 61 11.0 62 5.0 63 3.0 64 2.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.06 45-49 0.034999999999999996 50-54 0.055 55-59 0.11 60-64 0.135 65-69 0.105 70-74 0.17500000000000002 75-79 0.20500000000000002 80-84 0.135 85-89 0.11 90-94 0.13 95-99 0.09 100-104 0.16 105-109 0.24 110-114 0.2 115-119 0.2 120-124 0.0 125-129 0.095 130-134 0.67 135-139 0.915 140-144 0.35500000000000004 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.9875000000000003 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.887499999999999 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGA 10 0.0068661636 144.75 145 >>END_MODULE SRR7172505 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172505_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8535 33.0 33.0 34.0 32.0 34.0 2 32.874 34.0 33.0 34.0 32.0 34.0 3 32.93625 34.0 33.0 34.0 32.0 34.0 4 32.89125 34.0 33.0 34.0 32.0 34.0 5 32.96925 34.0 33.0 34.0 32.0 34.0 6 37.1805 38.0 38.0 38.0 37.0 38.0 7 37.1605 38.0 38.0 38.0 37.0 38.0 8 37.1175 38.0 38.0 38.0 37.0 38.0 9 37.071 38.0 38.0 38.0 37.0 38.0 10-14 37.126999999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.09635000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.0202 38.0 38.0 38.0 37.0 38.0 25-29 37.085899999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.9694 38.0 38.0 38.0 37.0 38.0 35-39 36.93025 38.0 38.0 38.0 36.8 38.0 40-44 36.873749999999994 38.0 38.0 38.0 36.4 38.0 45-49 36.9248 38.0 38.0 38.0 36.4 38.0 50-54 36.8724 38.0 38.0 38.0 36.4 38.0 55-59 36.8768 38.0 38.0 38.0 36.2 38.0 60-64 36.76845 38.0 38.0 38.0 36.2 38.0 65-69 36.68375 38.0 38.0 38.0 36.0 38.0 70-74 36.6197 38.0 38.0 38.0 35.2 38.0 75-79 36.55655 38.0 38.0 38.0 35.0 38.0 80-84 36.41755 38.0 38.0 38.0 34.8 38.0 85-89 36.2933 38.0 38.0 38.0 34.2 38.0 90-94 36.14675 38.0 38.0 38.0 33.8 38.0 95-99 36.01865 38.0 38.0 38.0 33.6 38.0 100-104 35.93415 38.0 38.0 38.0 33.2 38.0 105-109 35.87044999999999 38.0 38.0 38.0 33.0 38.0 110-114 35.61395 38.0 37.4 38.0 31.6 38.0 115-119 35.37215 38.0 37.0 38.0 30.2 38.0 120-124 35.1354 38.0 36.4 38.0 28.4 38.0 125-129 34.903949999999995 38.0 36.0 38.0 28.0 38.0 130-134 34.56685 38.0 35.8 38.0 25.8 38.0 135-139 34.04565 38.0 34.6 38.0 23.2 38.0 140-144 33.29135 38.0 33.2 38.0 16.2 38.0 145-149 32.2642 38.0 33.0 38.0 10.8 38.0 150-151 28.196125000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 7.0 4 2.0 5 1.0 6 5.0 7 1.0 8 1.0 9 4.0 10 6.0 11 3.0 12 0.0 13 3.0 14 2.0 15 2.0 16 11.0 17 2.0 18 3.0 19 4.0 20 9.0 21 12.0 22 14.0 23 17.0 24 22.0 25 12.0 26 23.0 27 23.0 28 38.0 29 40.0 30 42.0 31 56.0 32 89.0 33 94.0 34 124.0 35 248.0 36 559.0 37 2516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 20.200000000000003 12.45 27.224999999999998 2 25.987993996998497 24.96248124062031 33.64182091045523 15.407703851925964 3 19.339504628471353 27.545659244433324 31.873905429071804 21.240930698023515 4 22.191643732799598 37.65323992994746 21.26594946209657 18.88916687515637 5 23.567675756817614 38.37878408806605 22.041531148361273 16.012009006755065 6 19.15 38.125 23.45 19.275000000000002 7 19.075 19.425 41.625 19.875 8 20.775 24.125 28.050000000000004 27.05 9 20.674999999999997 25.0 29.225 25.1 10-14 23.34 28.4 26.56 21.7 15-19 22.509999999999998 28.299999999999997 28.005000000000003 21.185000000000002 20-24 22.93 27.845 28.115000000000002 21.11 25-29 22.650000000000002 28.54 28.310000000000002 20.5 30-34 21.995 28.03 28.73 21.245 35-39 22.915 27.950000000000003 27.845 21.29 40-44 22.54 28.294999999999998 28.07 21.095 45-49 22.655 27.939999999999998 28.389999999999997 21.015 50-54 23.16 27.73 27.985 21.125 55-59 22.835 27.694999999999997 28.365000000000002 21.105 60-64 22.759999999999998 27.67 28.12 21.45 65-69 22.85 27.089999999999996 28.595 21.465 70-74 22.79 28.249999999999996 27.6 21.36 75-79 22.675 27.665 28.21 21.45 80-84 22.625 28.01 28.01 21.355 85-89 23.244999999999997 27.884999999999998 27.650000000000002 21.22 90-94 23.075000000000003 27.615000000000002 28.389999999999997 20.919999999999998 95-99 23.45 27.55 27.96 21.04 100-104 23.505000000000003 27.98 27.529999999999998 20.985 105-109 23.330000000000002 27.62 27.99 21.060000000000002 110-114 23.794999999999998 28.43 27.165 20.61 115-119 23.505000000000003 27.889999999999997 27.93 20.674999999999997 120-124 24.154999999999998 27.939999999999998 27.595 20.31 125-129 24.355 28.189999999999998 27.529999999999998 19.925 130-134 24.52697967764541 27.29001902092302 27.885674241665832 20.297327059765742 135-139 23.79329356924465 28.189063204851887 27.86326499924816 20.154378226655307 140-144 24.5 27.944999999999997 26.950000000000003 20.605 145-149 24.445 28.470000000000002 26.815 20.27 150-151 25.5125 27.650000000000002 28.025 18.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 2.5 16 2.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 3.0 23 2.5 24 1.5 25 2.5 26 6.0 27 8.0 28 12.0 29 16.0 30 18.0 31 23.5 32 28.0 33 47.5 34 55.0 35 61.0 36 90.0 37 111.5 38 129.0 39 165.5 40 199.0 41 218.5 42 240.0 43 251.0 44 272.0 45 269.0 46 254.5 47 239.5 48 213.5 49 204.0 50 179.0 51 140.0 52 109.5 53 94.5 54 73.5 55 61.5 56 52.5 57 40.5 58 30.5 59 17.0 60 15.0 61 9.5 62 7.5 63 5.5 64 3.0 65 3.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.11 135-139 0.245 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42050894431847 98.65 2 0.47871000251952633 0.95 3 0.02519526329050139 0.075 4 0.05039052658100278 0.2 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.0625 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAAC 10 0.006830828 145.0 2 >>END_MODULE Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757244 spots for SRR7172505.sra Written 757244 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra Read 757241 spots for SRR7172505.sra Written 757241 spots for SRR7172505.sra SRR ids: ['SRR7172505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_437ekwem SRR7172505.sra spots: 15144823 blocks: [[1, 757241], [757242, 1514482], [1514483, 2271723], [2271724, 3028964], [3028965, 3786205], [3786206, 4543446], [4543447, 5300687], [5300688, 6057928], [6057929, 6815169], [6815170, 7572410], [7572411, 8329651], [8329652, 9086892], [9086893, 9844133], [9844134, 10601374], [10601375, 11358615], [11358616, 12115856], [12115857, 12873097], [12873098, 13630338], [13630339, 14387579], [14387580, 15144823]] SRR7172505 file size 5110383 SRR7172505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172505 SRR7172505_1.fastq SRR7172505_2.fastq Input file: SRR7172505_1.fastq Paired file: SRR7172505_2.fastq trimmed: SRR7172505-trimmed-pair1.fastq, SRR7172505-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:43:03 2025 >> started Mon Feb 10 13:43:18 2025 >> done (15.047s) 15144823 read pairs processed; of these: 14735 ( 0.10%) short read pairs filtered out after trimming by size control 56367 ( 0.37%) empty read pairs filtered out after trimming by size control 15073721 (99.53%) read pairs available; of these: 8093383 (53.69%) trimmed read pairs available after processing 6980338 (46.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 3 0.00% 21 8 0.00% 22 5 0.00% 23 12 0.00% 24 7 0.00% 25 9 0.00% 26 9 0.00% 27 5 0.00% 28 11 0.00% 29 12 0.00% 30 13 0.00% 31 9 0.00% 32 18 0.00% 33 14 0.00% 34 13 0.00% 35 23 0.00% 36 14 0.00% 37 18 0.00% 38 24 0.00% 39 23 0.00% 40 16 0.00% 41 31 0.00% 42 32 0.00% 43 34 0.00% 44 36 0.00% 45 32 0.00% 46 48 0.00% 47 60 0.00% 48 65 0.00% 49 66 0.00% 50 80 0.00% 51 84 0.00% 52 93 0.00% 53 87 0.00% 54 127 0.00% 55 110 0.00% 56 151 0.00% 57 158 0.00% 58 176 0.00% 59 224 0.00% 60 247 0.00% 61 257 0.00% 62 312 0.00% 63 352 0.00% 64 397 0.00% 65 423 0.00% 66 475 0.00% 67 574 0.00% 68 570 0.00% 69 732 0.00% 70 845 0.01% 71 942 0.01% 72 1003 0.01% 73 1209 0.01% 74 1322 0.01% 75 1407 0.01% 76 1566 0.01% 77 1801 0.01% 78 2021 0.01% 79 2286 0.02% 80 2567 0.02% 81 2799 0.02% 82 3206 0.02% 83 3684 0.02% 84 4564 0.03% 85 5152 0.03% 86 5543 0.04% 87 5814 0.04% 88 6183 0.04% 89 6689 0.04% 90 7186 0.05% 91 7731 0.05% 92 8971 0.06% 93 9539 0.06% 94 9203 0.06% 95 9909 0.07% 96 10199 0.07% 97 10781 0.07% 98 11022 0.07% 99 11637 0.08% 100 12396 0.08% 101 13349 0.09% 102 14581 0.10% 103 15213 0.10% 104 15568 0.10% 105 16271 0.11% 106 16687 0.11% 107 17350 0.12% 108 18065 0.12% 109 18833 0.12% 110 19598 0.13% 111 20612 0.14% 112 21952 0.15% 113 23027 0.15% 114 23884 0.16% 115 25135 0.17% 116 26255 0.17% 117 27389 0.18% 118 28470 0.19% 119 28986 0.19% 120 30532 0.20% 121 31458 0.21% 122 33317 0.22% 123 35112 0.23% 124 36481 0.24% 125 38352 0.25% 126 39777 0.26% 127 41386 0.27% 128 42970 0.29% 129 45762 0.30% 130 47247 0.31% 131 49091 0.33% 132 52169 0.35% 133 55330 0.37% 134 58719 0.39% 135 62426 0.41% 136 66537 0.44% 137 71432 0.47% 138 76446 0.51% 139 82910 0.55% 140 89227 0.59% 141 99131 0.66% 142 110293 0.73% 143 125160 0.83% 144 149481 0.99% 145 182712 1.21% 146 232657 1.54% 147 313552 2.08% 148 470147 3.12% 149 912360 6.05% 150 3844497 25.50% 151 6980338 46.31% 15073721 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=518.31 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=16 fanout-score=11.12 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=6.0 sequence=AAGAAAGCTTACCCTAAC SRR7172505 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:44:07 Started mapping on | Feb 10 13:44:07 Finished on | Feb 10 13:46:03 Mapping speed, Million of reads per hour | 467.81 Number of input reads | 15073721 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14041300 Uniquely mapped reads % | 93.15% Average mapped length | 293.17 Number of splices: Total | 13457917 Number of splices: Annotated (sjdb) | 13145433 Number of splices: GT/AG | 13189323 Number of splices: GC/AG | 216124 Number of splices: AT/AC | 7404 Number of splices: Non-canonical | 45066 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391380 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 94395 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 655169 655169 655169 N_multimapping 391380 391380 391380 N_noFeature 636766 13808261 744737 N_ambiguous 224784 1079 98972 UnstrandedReadsAssigned:13179750 PositiveStrandReadsAssigned:231960 NegativeStrandReadsAssigned:13197591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172505 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172505-trimmed-pair1.fastq SRR7172505-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,073,721 reads, 13,165,951 reads pseudoaligned [quant] estimated average fragment length: 255.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7172505.ke.tsv 34699 SRR7172505.se.tsv 87100 total ==> SRR7172505.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.37 621 25.6324 Potri.005G024800.1.v4.1 1035 780.368 188 17.5347 Potri.004G059700.1.v4.1 961 706.562 31 3.19339 Potri.007G009000.2.v4.1 1416 1161.37 0 0 Potri.003G141000.2.v4.1 2943 2688.37 882.436 23.891 Potri.016G087400.1.v4.1 270 80.6224 679 612.991 Potri.015G069301.1.v4.1 564 319.588 0 0 Potri.010G195200.1.v4.1 1773 1518.37 233.934 11.2139 Potri.012G127500.1.v4.1 977 722.466 273 27.5033 ==> SRR7172505.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 999 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 68 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 21 SRR7172505 completed mapping pipeline successfully