Starting /dee2/code/volunteer_pipeline.sh SRR7172506 current disk space = 3059103895552 free memory = 1392573136 SRR7172506 SRAfilesize 1bf8463d8a4c39f8a11b3becbbc6c276 SRR7172506.sra SRR7172506.sra file validated SRR7172506 is paired end SRR7172506 is conventional basespace SRR7172506 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172506_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2965 34.0 33.0 34.0 32.0 34.0 2 33.24025 34.0 33.0 34.0 32.0 34.0 3 33.33 34.0 34.0 34.0 32.0 34.0 4 33.43725 34.0 34.0 34.0 33.0 34.0 5 33.41575 34.0 34.0 34.0 33.0 34.0 6 37.18075 38.0 38.0 38.0 36.0 38.0 7 37.41875 38.0 38.0 38.0 37.0 38.0 8 37.45425 38.0 38.0 38.0 37.0 38.0 9 37.48275 38.0 38.0 38.0 38.0 38.0 10-14 37.4941 38.0 38.0 38.0 37.6 38.0 15-19 37.41465000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.446000000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.40194999999999 38.0 38.0 38.0 37.4 38.0 30-34 37.3688 38.0 38.0 38.0 37.0 38.0 35-39 37.1924 38.0 38.0 38.0 36.6 38.0 40-44 36.970800000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.924249999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.8913 38.0 38.0 38.0 36.0 38.0 55-59 36.70135 38.0 38.0 38.0 35.0 38.0 60-64 36.71725 38.0 38.0 38.0 35.0 38.0 65-69 36.63165 38.0 38.0 38.0 35.0 38.0 70-74 36.4422 38.0 38.0 38.0 34.0 38.0 75-79 36.34345 38.0 38.0 38.0 33.8 38.0 80-84 36.164249999999996 38.0 37.4 38.0 33.2 38.0 85-89 36.0341 38.0 37.2 38.0 33.2 38.0 90-94 35.9932 38.0 37.0 38.0 32.4 38.0 95-99 35.783249999999995 38.0 37.0 38.0 31.4 38.0 100-104 35.5674 38.0 36.8 38.0 30.6 38.0 105-109 35.205299999999994 38.0 36.0 38.0 28.8 38.0 110-114 34.90065 38.0 35.8 38.0 27.4 38.0 115-119 34.74025 38.0 35.6 38.0 26.8 38.0 120-124 34.68745 38.0 35.2 38.0 26.6 38.0 125-129 34.199 38.0 35.0 38.0 23.8 38.0 130-134 33.619299999999996 38.0 34.0 38.0 20.6 38.0 135-139 32.91080000000001 38.0 33.6 38.0 15.0 38.0 140-144 32.27765 38.0 31.6 38.0 13.4 38.0 145-149 30.887199999999996 36.4 30.4 38.0 8.2 38.0 150-151 25.799 32.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 3.0 9 2.0 10 5.0 11 0.0 12 1.0 13 2.0 14 2.0 15 5.0 16 5.0 17 2.0 18 9.0 19 5.0 20 9.0 21 9.0 22 11.0 23 15.0 24 13.0 25 24.0 26 24.0 27 30.0 28 36.0 29 51.0 30 65.0 31 84.0 32 95.0 33 145.0 34 199.0 35 391.0 36 910.0 37 1846.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.80165932071558 14.415348716619134 8.400311122634172 32.382680840031114 2 22.775000000000002 17.0 33.550000000000004 26.674999999999997 3 19.05 23.5 28.075 29.375 4 22.35 31.075000000000003 23.150000000000002 23.425 5 21.575 35.975 22.975 19.475 6 16.625 36.875 26.075 20.424999999999997 7 13.450000000000001 24.75 44.2 17.599999999999998 8 17.25 24.375 30.95 27.425 9 17.474999999999998 24.725 33.324999999999996 24.474999999999998 10-14 20.105 29.054999999999996 27.689999999999998 23.150000000000002 15-19 20.315 28.01 28.165000000000003 23.51 20-24 19.935 28.994999999999997 27.639999999999997 23.43 25-29 19.975 28.165000000000003 28.285 23.575 30-34 19.925 28.895 27.555000000000003 23.625 35-39 20.185185185185187 28.97897897897898 27.197197197197198 23.63863863863864 40-44 20.17130835503907 28.70667200961731 27.57463434181527 23.54738529352835 45-49 20.176229097827175 28.236707720036048 27.74106338239712 23.845999799739662 50-54 20.047075320512818 28.580729166666668 27.859575320512818 23.512620192307693 55-59 20.10221465076661 27.818418679226376 28.03387112937168 24.045495540635333 60-64 19.68634131676521 28.865617797374487 27.367471690550154 24.08056919531015 65-69 19.696362360958013 27.783345024551558 28.02886060727528 24.491432007215153 70-74 19.93785084202085 28.423215717722535 27.506014434643145 24.132919005613473 75-79 19.909774436090224 28.8922305764411 27.729323308270676 23.468671679197996 80-84 20.104229304469833 28.813389456804973 27.455401884145118 23.626979354580076 85-89 20.40785649864716 28.55997594949394 27.567892574406255 23.46427497745265 90-94 19.842661722703813 28.190609811093854 27.594327804780278 24.37240066142206 95-99 20.211433438549026 28.22285685655594 27.68675785359988 23.878951851295156 100-104 20.32565130260521 28.44188376753507 27.4749498997996 23.75751503006012 105-109 20.22657777332197 27.931224622788108 27.76580279713269 24.076394806757232 110-114 20.605331729805574 27.756063339346564 27.645820805772697 23.992784125075165 115-119 20.51513329324514 28.111846061334937 27.0344758468631 24.338544798556825 120-124 20.78 28.605000000000004 26.77 23.845 125-129 20.73866479831849 27.464718246421782 27.795015513962568 24.00160144129717 130-134 20.81696383600282 28.09005741915987 27.616601188677343 23.47637755615997 135-139 20.362036709308793 27.49153056580877 27.683672953430754 24.462759771451687 140-144 20.372415177675165 28.08171049989962 27.665127484440877 23.88074683798434 145-149 21.371068553427673 27.551377568878443 27.141357067853395 23.936196809840492 150-151 21.1375 27.025 27.1375 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 2.0 15 2.0 16 0.5 17 0.5 18 2.0 19 2.5 20 3.5 21 3.5 22 2.5 23 4.5 24 5.5 25 3.5 26 6.0 27 10.5 28 13.0 29 19.5 30 22.5 31 29.5 32 33.5 33 43.0 34 70.0 35 83.5 36 87.5 37 109.5 38 141.0 39 169.0 40 194.5 41 211.0 42 229.0 43 231.0 44 233.0 45 246.0 46 239.0 47 232.0 48 229.5 49 197.0 50 167.0 51 142.0 52 113.5 53 104.5 54 92.0 55 66.5 56 46.5 57 46.0 58 34.0 59 26.5 60 22.5 61 9.5 62 6.0 63 4.0 64 3.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.1 40-44 0.18 45-49 0.13 50-54 0.16 55-59 0.21 60-64 0.21 65-69 0.21 70-74 0.24 75-79 0.25 80-84 0.22 85-89 0.21 90-94 0.215 95-99 0.20500000000000002 100-104 0.2 105-109 0.255 110-114 0.22 115-119 0.22 120-124 0.0 125-129 0.09 130-134 0.73 135-139 1.115 140-144 0.38 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.5806614491290077 1.15 3 0.12623074981065388 0.375 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172506 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172506_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77075 33.0 33.0 34.0 32.0 34.0 2 32.7895 34.0 33.0 34.0 32.0 34.0 3 32.8065 34.0 33.0 34.0 32.0 34.0 4 32.80975 34.0 33.0 34.0 32.0 34.0 5 32.845 34.0 33.0 34.0 32.0 34.0 6 36.94925 38.0 38.0 38.0 36.0 38.0 7 36.9375 38.0 38.0 38.0 36.0 38.0 8 36.9475 38.0 38.0 38.0 36.0 38.0 9 36.90675 38.0 38.0 38.0 36.0 38.0 10-14 36.951550000000005 38.0 38.0 38.0 36.8 38.0 15-19 36.911950000000004 38.0 38.0 38.0 36.6 38.0 20-24 36.89835 38.0 38.0 38.0 36.6 38.0 25-29 36.9346 38.0 38.0 38.0 37.0 38.0 30-34 36.847300000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.85575 38.0 38.0 38.0 36.2 38.0 40-44 36.757 38.0 38.0 38.0 36.0 38.0 45-49 36.84015 38.0 38.0 38.0 36.4 38.0 50-54 36.7296 38.0 38.0 38.0 36.0 38.0 55-59 36.677200000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.64175 38.0 38.0 38.0 35.8 38.0 65-69 36.51425 38.0 38.0 38.0 35.2 38.0 70-74 36.5082 38.0 38.0 38.0 35.2 38.0 75-79 36.3668 38.0 38.0 38.0 34.2 38.0 80-84 36.2915 38.0 38.0 38.0 34.0 38.0 85-89 36.113 38.0 38.0 38.0 33.8 38.0 90-94 35.8501 38.0 38.0 38.0 33.2 38.0 95-99 35.77460000000001 38.0 38.0 38.0 32.6 38.0 100-104 35.7643 38.0 37.8 38.0 32.8 38.0 105-109 35.68445 38.0 37.8 38.0 32.4 38.0 110-114 35.40695 38.0 37.0 38.0 31.0 38.0 115-119 35.14025 38.0 37.0 38.0 28.6 38.0 120-124 34.906349999999996 38.0 36.4 38.0 27.6 38.0 125-129 34.55505 38.0 35.4 38.0 26.2 38.0 130-134 34.22395 38.0 35.0 38.0 24.0 38.0 135-139 33.72234999999999 38.0 34.2 38.0 21.4 38.0 140-144 32.81660000000001 38.0 33.2 38.0 14.0 38.0 145-149 31.882150000000003 38.0 32.4 38.0 8.6 38.0 150-151 27.462625000000003 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 7.0 4 2.0 5 3.0 6 2.0 7 3.0 8 3.0 9 3.0 10 1.0 11 3.0 12 4.0 13 7.0 14 3.0 15 5.0 16 3.0 17 8.0 18 8.0 19 4.0 20 7.0 21 12.0 22 13.0 23 15.0 24 13.0 25 24.0 26 27.0 27 30.0 28 31.0 29 34.0 30 57.0 31 53.0 32 91.0 33 102.0 34 127.0 35 245.0 36 607.0 37 2427.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.050000000000004 21.4 13.875000000000002 24.675 2 26.152304609218437 26.828657314629258 30.61122244488978 16.407815631262526 3 20.791583166332668 26.603206412825653 33.74248496993988 18.862725450901806 4 23.74749498997996 33.967935871743485 23.49699398797595 18.7875751503006 5 23.34669338677355 38.201402805611224 21.618236472945892 16.83366733466934 6 19.8 37.6 24.625 17.974999999999998 7 19.85 19.8 39.15 21.2 8 19.775000000000002 26.724999999999998 27.525 25.974999999999998 9 21.675 25.55 28.849999999999998 23.925 10-14 23.845 29.01 25.759999999999998 21.385 15-19 23.330000000000002 28.025 27.47 21.175 20-24 23.06 28.18 27.865000000000002 20.895 25-29 23.09 28.375 27.884999999999998 20.65 30-34 22.735 27.575 28.475 21.215 35-39 23.25 27.994999999999997 28.265 20.49 40-44 23.29 27.72 27.725 21.265 45-49 22.97 27.894999999999996 28.444999999999997 20.69 50-54 22.900000000000002 27.49 28.65 20.96 55-59 23.044999999999998 27.939999999999998 28.09 20.925 60-64 23.525 27.51 27.689999999999998 21.275 65-69 23.055 28.044999999999998 27.46 21.44 70-74 23.185 27.265 28.305000000000003 21.245 75-79 23.115 27.495000000000005 28.084999999999997 21.305 80-84 23.549999999999997 27.76 27.735 20.955 85-89 23.93 27.935 27.389999999999997 20.745 90-94 23.402020606181857 27.998399519855955 27.86335900770231 20.736220866259877 95-99 23.291164558227912 27.396369818490925 28.38641932096605 20.926046302315115 100-104 24.025 27.575 27.405 20.995 105-109 23.93 27.46 28.110000000000003 20.5 110-114 23.355 28.475 27.77 20.4 115-119 24.04 28.13 27.51 20.32 120-124 24.060000000000002 27.85 27.310000000000002 20.78 125-129 23.985 27.794999999999998 27.215 21.005 130-134 24.466913604965463 28.48633496846531 26.97967764540995 20.067073781159277 135-139 24.774549098196395 27.76553106212425 27.580160320641284 19.879759519038075 140-144 24.925 28.449999999999996 26.895000000000003 19.73 145-149 24.834999999999997 27.88 27.284999999999997 20.0 150-151 25.0625 28.4375 26.887499999999996 19.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.0 22 2.5 23 2.5 24 0.5 25 1.5 26 6.5 27 9.5 28 11.5 29 14.0 30 16.5 31 20.0 32 28.5 33 35.0 34 41.0 35 63.0 36 95.5 37 121.5 38 125.0 39 156.5 40 191.5 41 216.5 42 261.0 43 267.0 44 237.5 45 243.5 46 276.5 47 256.5 48 224.5 49 210.0 50 170.0 51 133.5 52 109.5 53 83.5 54 77.0 55 65.0 56 52.0 57 46.0 58 34.5 59 26.5 60 18.0 61 14.0 62 10.5 63 5.0 64 2.5 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.2 4 0.2 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.11 135-139 0.2 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.5806614491290077 1.15 3 0.12623074981065388 0.375 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772474 spots for SRR7172506.sra Written 772474 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra Read 772471 spots for SRR7172506.sra Written 772471 spots for SRR7172506.sra SRR ids: ['SRR7172506.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_omkvuaza SRR7172506.sra spots: 15449423 blocks: [[1, 772471], [772472, 1544942], [1544943, 2317413], [2317414, 3089884], [3089885, 3862355], [3862356, 4634826], [4634827, 5407297], [5407298, 6179768], [6179769, 6952239], [6952240, 7724710], [7724711, 8497181], [8497182, 9269652], [9269653, 10042123], [10042124, 10814594], [10814595, 11587065], [11587066, 12359536], [12359537, 13132007], [13132008, 13904478], [13904479, 14676949], [14676950, 15449423]] SRR7172506 file size 5213602 SRR7172506 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172506 SRR7172506_1.fastq SRR7172506_2.fastq Input file: SRR7172506_1.fastq Paired file: SRR7172506_2.fastq trimmed: SRR7172506-trimmed-pair1.fastq, SRR7172506-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:51:41 2025 >> started Mon Feb 10 13:51:58 2025 >> done (16.451s) 15449423 read pairs processed; of these: 28548 ( 0.18%) short read pairs filtered out after trimming by size control 69049 ( 0.45%) empty read pairs filtered out after trimming by size control 15351826 (99.37%) read pairs available; of these: 8045909 (52.41%) trimmed read pairs available after processing 7305917 (47.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 9 0.00% 21 10 0.00% 22 9 0.00% 23 12 0.00% 24 9 0.00% 25 8 0.00% 26 7 0.00% 27 18 0.00% 28 19 0.00% 29 17 0.00% 30 21 0.00% 31 16 0.00% 32 14 0.00% 33 15 0.00% 34 21 0.00% 35 15 0.00% 36 19 0.00% 37 27 0.00% 38 24 0.00% 39 29 0.00% 40 24 0.00% 41 38 0.00% 42 38 0.00% 43 48 0.00% 44 44 0.00% 45 54 0.00% 46 50 0.00% 47 57 0.00% 48 79 0.00% 49 111 0.00% 50 103 0.00% 51 131 0.00% 52 152 0.00% 53 136 0.00% 54 164 0.00% 55 178 0.00% 56 171 0.00% 57 200 0.00% 58 248 0.00% 59 283 0.00% 60 364 0.00% 61 331 0.00% 62 404 0.00% 63 453 0.00% 64 532 0.00% 65 533 0.00% 66 658 0.00% 67 755 0.00% 68 931 0.01% 69 1302 0.01% 70 1304 0.01% 71 1205 0.01% 72 1372 0.01% 73 1581 0.01% 74 1687 0.01% 75 1933 0.01% 76 1978 0.01% 77 2201 0.01% 78 2505 0.02% 79 2870 0.02% 80 3214 0.02% 81 3584 0.02% 82 3976 0.03% 83 4460 0.03% 84 6185 0.04% 85 7062 0.05% 86 7570 0.05% 87 7599 0.05% 88 8072 0.05% 89 8585 0.06% 90 9099 0.06% 91 9729 0.06% 92 10848 0.07% 93 11289 0.07% 94 11631 0.08% 95 12180 0.08% 96 12040 0.08% 97 12628 0.08% 98 13323 0.09% 99 14121 0.09% 100 14886 0.10% 101 15772 0.10% 102 17020 0.11% 103 17779 0.12% 104 18270 0.12% 105 19053 0.12% 106 19726 0.13% 107 20159 0.13% 108 21255 0.14% 109 22336 0.15% 110 23288 0.15% 111 23941 0.16% 112 25057 0.16% 113 26589 0.17% 114 27546 0.18% 115 28945 0.19% 116 30171 0.20% 117 31212 0.20% 118 31914 0.21% 119 32712 0.21% 120 34385 0.22% 121 35586 0.23% 122 36972 0.24% 123 39149 0.26% 124 40666 0.26% 125 42456 0.28% 126 44770 0.29% 127 46406 0.30% 128 47854 0.31% 129 50166 0.33% 130 51972 0.34% 131 54065 0.35% 132 57178 0.37% 133 60487 0.39% 134 63908 0.42% 135 67559 0.44% 136 72195 0.47% 137 76174 0.50% 138 81906 0.53% 139 88011 0.57% 140 94918 0.62% 141 103729 0.68% 142 113730 0.74% 143 127875 0.83% 144 149374 0.97% 145 180291 1.17% 146 226480 1.48% 147 300017 1.95% 148 442199 2.88% 149 844690 5.50% 150 3698379 24.09% 151 7305917 47.59% 15351826 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.17 sequence-density-rank=22 fanout-score=13.13 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=2.3 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTTATTTA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=22 prefix-density=0.59 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=11.17 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR7172506 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:52:46 Started mapping on | Feb 10 13:52:46 Finished on | Feb 10 13:54:45 Mapping speed, Million of reads per hour | 464.42 Number of input reads | 15351826 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14253547 Uniquely mapped reads % | 92.85% Average mapped length | 292.47 Number of splices: Total | 13237412 Number of splices: Annotated (sjdb) | 12915437 Number of splices: GT/AG | 12974068 Number of splices: GC/AG | 209829 Number of splices: AT/AC | 8361 Number of splices: Non-canonical | 45154 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415625 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 74405 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 709365 709365 709365 N_multimapping 415625 415625 415625 N_noFeature 565645 13984006 662333 N_ambiguous 289296 1222 115818 UnstrandedReadsAssigned:13398606 PositiveStrandReadsAssigned:268319 NegativeStrandReadsAssigned:13475396 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172506 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172506-trimmed-pair1.fastq SRR7172506-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,351,826 reads, 13,429,261 reads pseudoaligned [quant] estimated average fragment length: 252.106 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7172506.ke.tsv 34699 SRR7172506.se.tsv 87100 total ==> SRR7172506.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.89 613 21.4184 Potri.005G024800.1.v4.1 1035 783.894 359 28.2732 Potri.004G059700.1.v4.1 961 710.055 11 0.956398 Potri.007G009000.2.v4.1 1416 1164.89 0 0 Potri.003G141000.2.v4.1 2943 2691.89 959.503 22.0052 Potri.016G087400.1.v4.1 270 82.3528 870 652.197 Potri.015G069301.1.v4.1 564 322.223 0 0 Potri.010G195200.1.v4.1 1773 1521.89 55 2.23109 Potri.012G127500.1.v4.1 977 725.955 91 7.73873 ==> SRR7172506.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 571 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7172506 completed mapping pipeline successfully