Starting /dee2/code/volunteer_pipeline.sh SRR7172507 current disk space = 3059066351616 free memory = 1579663320 SRR7172507 SRAfilesize c2b5c3a696ffca092979a5810e27b830 SRR7172507.sra SRR7172507.sra file validated SRR7172507 is paired end SRR7172507 is conventional basespace SRR7172507 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.861 34.0 33.0 34.0 33.0 34.0 2 33.368 34.0 34.0 34.0 33.0 34.0 3 33.431 34.0 34.0 34.0 33.0 34.0 4 33.432 34.0 34.0 34.0 33.0 34.0 5 33.44975 34.0 34.0 34.0 33.0 34.0 6 37.15075 38.0 38.0 38.0 36.0 38.0 7 37.41725 38.0 38.0 38.0 37.0 38.0 8 37.5275 38.0 38.0 38.0 38.0 38.0 9 37.55575 38.0 38.0 38.0 38.0 38.0 10-14 37.49925 38.0 38.0 38.0 37.8 38.0 15-19 37.52605 38.0 38.0 38.0 38.0 38.0 20-24 37.553549999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.49295 38.0 38.0 38.0 38.0 38.0 30-34 37.4875 38.0 38.0 38.0 38.0 38.0 35-39 37.384699999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.21815 38.0 38.0 38.0 36.8 38.0 45-49 37.163799999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.982299999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.944100000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.96645 38.0 38.0 38.0 36.0 38.0 65-69 36.7988 38.0 38.0 38.0 35.2 38.0 70-74 36.724849999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.619600000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.501599999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.3207 38.0 38.0 38.0 33.8 38.0 90-94 36.29715 38.0 37.8 38.0 33.6 38.0 95-99 36.16335 38.0 37.0 38.0 33.2 38.0 100-104 35.94075 38.0 37.0 38.0 32.6 38.0 105-109 35.77635 38.0 37.0 38.0 31.4 38.0 110-114 35.39450000000001 38.0 36.0 38.0 29.4 38.0 115-119 35.3169 38.0 36.0 38.0 29.4 38.0 120-124 34.98655 38.0 35.6 38.0 28.0 38.0 125-129 34.670449999999995 38.0 35.0 38.0 27.0 38.0 130-134 34.3022 38.0 34.8 38.0 25.2 38.0 135-139 33.62905000000001 38.0 33.8 38.0 21.4 38.0 140-144 33.029399999999995 38.0 33.2 38.0 15.0 38.0 145-149 32.00635 37.6 32.2 38.0 10.8 38.0 150-151 27.417875000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 2.0 18 5.0 19 8.0 20 5.0 21 7.0 22 20.0 23 10.0 24 10.0 25 23.0 26 17.0 27 36.0 28 27.0 29 43.0 30 59.0 31 63.0 32 78.0 33 121.0 34 195.0 35 322.0 36 815.0 37 2125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.17919959214887 13.051236298750958 9.049197043079277 38.7203670660209 2 20.8 19.275000000000002 35.525 24.4 3 19.125 24.325 27.800000000000004 28.749999999999996 4 23.025000000000002 31.874999999999996 22.825 22.275 5 21.875 34.725 24.0 19.400000000000002 6 15.6 35.775 27.825 20.8 7 13.825000000000001 23.325000000000003 45.375 17.474999999999998 8 18.625 21.95 32.550000000000004 26.875 9 17.974999999999998 21.65 33.95 26.424999999999997 10-14 19.67 29.635 26.6 24.095 15-19 19.825 28.68 27.675 23.82 20-24 19.985 29.035 27.705000000000002 23.275000000000002 25-29 20.169999999999998 28.18 28.025 23.625 30-34 19.975 28.88 28.075 23.07 35-39 19.950000000000003 28.79 27.800000000000004 23.46 40-44 20.05 28.110000000000003 28.27 23.57 45-49 20.365 28.875 27.334999999999997 23.425 50-54 20.685000000000002 28.57 27.735 23.01 55-59 19.655 28.705000000000002 28.255000000000003 23.385 60-64 20.175 28.53 28.025 23.27 65-69 20.06 28.42 28.035 23.485 70-74 20.09801470220533 28.449267390108517 27.909186377956697 23.54353152972946 75-79 20.195 28.82 27.595 23.39 80-84 21.02 28.465 27.26 23.255 85-89 20.515 28.525 26.96 24.0 90-94 20.386019300965046 28.0314015700785 27.841392069603483 23.741187059352967 95-99 19.425 28.37 28.58 23.625 100-104 20.42531898924193 28.56642481861396 27.46559919939955 23.54265699274456 105-109 20.344154869691362 28.792956830573758 27.487369316192282 23.375518983542594 110-114 20.923708861393578 27.95671993187397 28.0869608776236 23.032610329108852 115-119 20.70621186355907 28.283485045513657 27.46824047214164 23.542062618785636 120-124 20.805 27.91 27.765 23.52 125-129 20.525 28.095 27.61 23.77 130-134 20.69 28.605000000000004 27.35 23.355 135-139 20.794999999999998 28.275 27.49 23.44 140-144 21.42 28.265 26.875 23.44 145-149 21.27 28.33 27.055 23.345 150-151 20.7 28.3375 27.6 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 3.0 23 3.5 24 3.5 25 4.5 26 6.0 27 8.5 28 13.0 29 17.0 30 20.0 31 27.0 32 36.0 33 50.0 34 64.5 35 83.0 36 95.0 37 107.5 38 136.5 39 170.5 40 187.5 41 217.0 42 253.0 43 263.0 44 261.5 45 247.5 46 232.0 47 230.0 48 227.0 49 208.5 50 170.0 51 127.0 52 112.0 53 100.5 54 79.0 55 60.5 56 51.5 57 37.0 58 22.5 59 21.5 60 13.5 61 4.5 62 5.0 63 5.0 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.075 105-109 0.045 110-114 0.185 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.5794910556815319 1.15 3 0.10078105316200556 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGGG 10 0.006843168 144.91249 145 CCTGTCT 10 0.006843168 144.91249 9 ATCAAGC 10 0.006843168 144.91249 6 TTGGAGA 10 0.006843168 144.91249 9 TTCAGGA 10 0.006843168 144.91249 3 GGAATCC 10 0.006843168 144.91249 3 >>END_MODULE SRR7172507 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172507_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.615 33.0 33.0 34.0 32.0 34.0 2 32.7465 34.0 33.0 34.0 32.0 34.0 3 32.753 34.0 33.0 34.0 32.0 34.0 4 32.65625 34.0 33.0 34.0 32.0 34.0 5 32.7035 34.0 33.0 34.0 32.0 34.0 6 36.82175 38.0 38.0 38.0 36.0 38.0 7 36.8435 38.0 38.0 38.0 36.0 38.0 8 36.904 38.0 38.0 38.0 37.0 38.0 9 36.8185 38.0 38.0 38.0 36.0 38.0 10-14 36.89835000000001 38.0 38.0 38.0 36.6 38.0 15-19 36.91125 38.0 38.0 38.0 37.0 38.0 20-24 36.8489 38.0 38.0 38.0 36.6 38.0 25-29 36.8647 38.0 38.0 38.0 36.8 38.0 30-34 36.8278 38.0 38.0 38.0 36.6 38.0 35-39 36.78099999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.7599 38.0 38.0 38.0 36.0 38.0 45-49 36.689550000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.70605 38.0 38.0 38.0 36.0 38.0 55-59 36.645300000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.5567 38.0 38.0 38.0 35.4 38.0 65-69 36.47055 38.0 38.0 38.0 35.0 38.0 70-74 36.449799999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.305049999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.23245 38.0 38.0 38.0 34.0 38.0 85-89 36.1314 38.0 38.0 38.0 34.0 38.0 90-94 36.00905 38.0 38.0 38.0 33.8 38.0 95-99 35.77040000000001 38.0 38.0 38.0 32.8 38.0 100-104 35.69205 38.0 38.0 38.0 32.6 38.0 105-109 35.5677 38.0 37.6 38.0 31.0 38.0 110-114 35.3507 38.0 37.0 38.0 29.8 38.0 115-119 35.0672 38.0 37.0 38.0 28.4 38.0 120-124 34.8228 38.0 36.0 38.0 27.6 38.0 125-129 34.52575 38.0 36.0 38.0 25.4 38.0 130-134 34.10209999999999 38.0 35.2 38.0 23.6 38.0 135-139 33.55815 38.0 34.0 38.0 18.6 38.0 140-144 32.845749999999995 38.0 33.0 38.0 13.8 38.0 145-149 31.9092 38.0 32.8 38.0 10.8 38.0 150-151 27.768875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 6.0 4 5.0 5 3.0 6 3.0 7 1.0 8 0.0 9 2.0 10 2.0 11 2.0 12 2.0 13 4.0 14 7.0 15 5.0 16 4.0 17 4.0 18 10.0 19 13.0 20 5.0 21 13.0 22 12.0 23 15.0 24 19.0 25 25.0 26 26.0 27 39.0 28 30.0 29 34.0 30 52.0 31 53.0 32 66.0 33 95.0 34 159.0 35 242.0 36 560.0 37 2460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.90424729831616 20.683588841417443 12.239256094496104 28.172907765770294 2 25.30786629806484 26.41367177682835 33.40035184719779 14.878110077909025 3 21.040723981900452 27.702362996480645 31.62393162393162 19.63298139768728 4 24.3086978381096 36.1236802413273 22.146807440925087 17.420814479638008 5 22.77526395173454 37.757667169431876 22.448466566113627 17.01860231271996 6 18.8598694123556 38.82471120040181 24.334505273731793 17.9809141135108 7 19.748743718592966 18.165829145728644 42.1105527638191 19.974874371859297 8 21.075106757096208 23.43632253202713 29.264004019090677 26.224566691785984 9 20.57272042200452 24.918362220547603 29.33936196935443 25.169555388093446 10-14 23.139914594323034 28.80683245415725 26.842501883948756 21.210751067570964 15-19 22.515824374560435 27.70019089721692 28.202551994373554 21.58143273384909 20-24 22.691650758565256 27.896111725108007 28.29800060283332 21.11423691349342 25-29 22.163628145246346 28.60730249610768 28.150268695695846 21.07880066295013 30-34 22.569304941743674 27.797308155885897 28.12876657292085 21.50462032944958 35-39 21.953792064289303 28.41285786037167 28.397790055248617 21.235560020090407 40-44 22.81450964630225 28.69272508038585 27.75823954983923 20.734525723472668 45-49 22.926927329379836 28.098301336817773 28.007839983917982 20.966931349884412 50-54 22.77889447236181 28.100502512562812 28.427135678391956 20.693467336683415 55-59 22.567682957456427 27.8567482043297 28.40926214274951 21.166306695464364 60-64 23.712893666181124 27.32432568185243 28.097845195640165 20.864935456326283 65-69 23.535617401788407 27.90615894705114 27.33849090726414 21.219732743896312 70-74 23.532958199356912 27.165393890675244 27.984324758842444 21.317323151125404 75-79 22.899191320508315 27.35948565975187 28.178210859410317 21.5631121603295 80-84 23.016231971455852 27.7551635760591 28.05668626564149 21.17191818684356 85-89 23.494248254382878 27.22158034862109 28.442256492691016 20.841914904305018 90-94 23.90954773869347 27.472361809045225 28.25628140703518 20.36180904522613 95-99 22.71585083928033 28.01789124535129 28.515428686300133 20.75082922906825 100-104 23.14070351758794 27.522613065326635 28.42211055276382 20.914572864321606 105-109 23.325797538306958 27.837226827430296 28.008038181361467 20.82893745290128 110-114 23.33316585439381 27.478269607596843 28.61377681756519 20.574787720444153 115-119 23.87579761844948 28.47309450836557 27.25217303924031 20.398934833944633 120-124 24.313055709047067 27.658612548349826 27.683729341437687 20.344602401165417 125-129 23.470310459158043 27.830804782477646 27.680096453330655 21.01878830503366 130-134 24.588105284307815 27.717500502310628 28.134418324291744 19.559975889089813 135-139 24.093420391762933 28.24711200401808 27.252636865896534 20.40683073832245 140-144 23.780579695584468 28.43220977545587 27.60335560355654 20.183854925403125 145-149 24.677151901914478 27.96844379679413 27.40565800713532 19.948746294156074 150-151 25.361135535736718 27.220198467529205 28.0241175731692 19.394548423564878 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 17.0 1 8.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 5.0 25 6.5 26 8.0 27 9.5 28 8.0 29 13.5 30 24.5 31 23.5 32 31.5 33 47.5 34 52.5 35 66.0 36 95.5 37 121.0 38 137.5 39 166.0 40 187.0 41 216.0 42 242.0 43 244.5 44 261.0 45 267.0 46 259.5 47 243.5 48 215.5 49 189.5 50 153.5 51 128.5 52 112.0 53 95.0 54 83.5 55 64.0 56 50.5 57 37.5 58 24.5 59 24.5 60 20.5 61 11.0 62 8.0 63 7.0 64 4.5 65 1.5 66 1.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.525 3 0.5499999999999999 4 0.5499999999999999 5 0.5499999999999999 6 0.44999999999999996 7 0.5 8 0.475 9 0.475 10-14 0.475 15-19 0.47000000000000003 20-24 0.47000000000000003 25-29 0.445 30-34 0.44 35-39 0.44999999999999996 40-44 0.48 45-49 0.51 50-54 0.5 55-59 0.455 60-64 0.455 65-69 0.47000000000000003 70-74 0.48 75-79 0.455 80-84 0.505 85-89 0.46499999999999997 90-94 0.5 95-99 0.51 100-104 0.5 105-109 0.475 110-114 0.485 115-119 0.485 120-124 0.46499999999999997 125-129 0.47000000000000003 130-134 0.45999999999999996 135-139 0.44999999999999996 140-144 0.46499999999999997 145-149 0.49500000000000005 150-151 0.4875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21439432336543 97.875 2 0.6335529650278764 1.25 3 0.07602635580334516 0.22499999999999998 4 0.025342118601115054 0.1 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.949999999999999 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.8 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 30 0.0014431519 24.166666 130-134 >>END_MODULE Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744566 spots for SRR7172507.sra Written 744566 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra Read 744560 spots for SRR7172507.sra Written 744560 spots for SRR7172507.sra SRR ids: ['SRR7172507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ou2tzw4a SRR7172507.sra spots: 14891206 blocks: [[1, 744560], [744561, 1489120], [1489121, 2233680], [2233681, 2978240], [2978241, 3722800], [3722801, 4467360], [4467361, 5211920], [5211921, 5956480], [5956481, 6701040], [6701041, 7445600], [7445601, 8190160], [8190161, 8934720], [8934721, 9679280], [9679281, 10423840], [10423841, 11168400], [11168401, 11912960], [11912961, 12657520], [12657521, 13402080], [13402081, 14146640], [14146641, 14891206]] SRR7172507 file size 5024440 SRR7172507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172507 SRR7172507_1.fastq SRR7172507_2.fastq Input file: SRR7172507_1.fastq Paired file: SRR7172507_2.fastq trimmed: SRR7172507-trimmed-pair1.fastq, SRR7172507-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:52:22 2025 >> started Mon Feb 10 14:52:37 2025 >> done (15.820s) 14891206 read pairs processed; of these: 20379 ( 0.14%) short read pairs filtered out after trimming by size control 101929 ( 0.68%) empty read pairs filtered out after trimming by size control 14768898 (99.18%) read pairs available; of these: 7691756 (52.08%) trimmed read pairs available after processing 7077142 (47.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 2 0.00% 26 6 0.00% 27 11 0.00% 28 5 0.00% 29 11 0.00% 30 9 0.00% 31 8 0.00% 32 7 0.00% 33 12 0.00% 34 10 0.00% 35 50 0.00% 36 20 0.00% 37 22 0.00% 38 24 0.00% 39 21 0.00% 40 20 0.00% 41 23 0.00% 42 41 0.00% 43 24 0.00% 44 32 0.00% 45 38 0.00% 46 38 0.00% 47 44 0.00% 48 53 0.00% 49 59 0.00% 50 62 0.00% 51 93 0.00% 52 92 0.00% 53 83 0.00% 54 97 0.00% 55 115 0.00% 56 130 0.00% 57 146 0.00% 58 194 0.00% 59 177 0.00% 60 247 0.00% 61 237 0.00% 62 276 0.00% 63 304 0.00% 64 339 0.00% 65 414 0.00% 66 464 0.00% 67 511 0.00% 68 580 0.00% 69 718 0.00% 70 909 0.01% 71 947 0.01% 72 973 0.01% 73 1059 0.01% 74 1166 0.01% 75 1272 0.01% 76 1425 0.01% 77 1604 0.01% 78 1774 0.01% 79 2062 0.01% 80 2266 0.02% 81 2512 0.02% 82 2885 0.02% 83 3310 0.02% 84 4456 0.03% 85 4962 0.03% 86 5424 0.04% 87 5794 0.04% 88 6037 0.04% 89 6385 0.04% 90 6914 0.05% 91 7467 0.05% 92 7998 0.05% 93 8819 0.06% 94 9659 0.07% 95 9754 0.07% 96 10174 0.07% 97 10589 0.07% 98 11032 0.07% 99 11780 0.08% 100 12401 0.08% 101 13044 0.09% 102 14092 0.10% 103 14585 0.10% 104 15710 0.11% 105 16451 0.11% 106 17533 0.12% 107 18072 0.12% 108 18764 0.13% 109 19696 0.13% 110 20218 0.14% 111 21317 0.14% 112 22477 0.15% 113 23903 0.16% 114 25002 0.17% 115 26533 0.18% 116 27501 0.19% 117 28137 0.19% 118 29085 0.20% 119 30119 0.20% 120 31226 0.21% 121 32739 0.22% 122 33748 0.23% 123 36029 0.24% 124 37832 0.26% 125 39243 0.27% 126 41290 0.28% 127 42972 0.29% 128 44750 0.30% 129 46832 0.32% 130 48875 0.33% 131 50501 0.34% 132 53413 0.36% 133 56353 0.38% 134 59288 0.40% 135 63581 0.43% 136 67829 0.46% 137 71803 0.49% 138 76507 0.52% 139 82931 0.56% 140 89093 0.60% 141 97127 0.66% 142 108153 0.73% 143 122623 0.83% 144 143779 0.97% 145 170292 1.15% 146 212122 1.44% 147 284916 1.93% 148 430158 2.91% 149 830805 5.63% 150 3612992 24.46% 151 7077142 47.92% 14768898 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=11 prefix-density=0.50 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=103.10 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=1.8 sequence=AGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.27 sequence-density-rank=15 fanout-score=6.88 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=4.4 sequence=AAGAAAGCTTACCCTAAC SRR7172507 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:53:23 Started mapping on | Feb 10 14:53:23 Finished on | Feb 10 14:55:00 Mapping speed, Million of reads per hour | 548.12 Number of input reads | 14768898 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13878987 Uniquely mapped reads % | 93.97% Average mapped length | 293.14 Number of splices: Total | 13189885 Number of splices: Annotated (sjdb) | 12875402 Number of splices: GT/AG | 12924324 Number of splices: GC/AG | 214592 Number of splices: AT/AC | 7774 Number of splices: Non-canonical | 43195 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383935 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 66895 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 522973 522973 522973 N_multimapping 383935 383935 383935 N_noFeature 592145 13653811 699416 N_ambiguous 225575 1064 106927 UnstrandedReadsAssigned:13061267 PositiveStrandReadsAssigned:224112 NegativeStrandReadsAssigned:13072644 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172507 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172507-trimmed-pair1.fastq SRR7172507-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,768,898 reads, 13,100,998 reads pseudoaligned [quant] estimated average fragment length: 246.412 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7172507.ke.tsv 34699 SRR7172507.se.tsv 87100 total ==> SRR7172507.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.59 796 33.1674 Potri.005G024800.1.v4.1 1035 789.588 144 13.47 Potri.004G059700.1.v4.1 961 715.678 7 0.722414 Potri.007G009000.2.v4.1 1416 1170.59 0 0 Potri.003G141000.2.v4.1 2943 2697.59 580.364 15.8902 Potri.016G087400.1.v4.1 270 81.2536 746 678.113 Potri.015G069301.1.v4.1 564 325.932 0 0 Potri.010G195200.1.v4.1 1773 1527.59 65 3.14277 Potri.012G127500.1.v4.1 977 731.637 156 15.7483 ==> SRR7172507.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 633 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 91 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7172507 completed mapping pipeline successfully