Starting /dee2/code/volunteer_pipeline.sh SRR7172508 current disk space = 3059050496000 free memory = 1010985428 SRR7172508 SRAfilesize 5015d3b1168957e32c7eb436b635640b SRR7172508.sra SRR7172508.sra file validated SRR7172508 is paired end SRR7172508 is conventional basespace SRR7172508 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88675 34.0 33.0 34.0 33.0 34.0 2 33.361 34.0 33.0 34.0 33.0 34.0 3 33.41475 34.0 34.0 34.0 33.0 34.0 4 33.4415 34.0 34.0 34.0 33.0 34.0 5 33.34075 34.0 34.0 34.0 33.0 34.0 6 37.0385 38.0 37.0 38.0 36.0 38.0 7 37.3445 38.0 38.0 38.0 37.0 38.0 8 37.46375 38.0 38.0 38.0 37.0 38.0 9 37.50575 38.0 38.0 38.0 38.0 38.0 10-14 37.49845 38.0 38.0 38.0 37.8 38.0 15-19 37.518899999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.49375 38.0 38.0 38.0 37.8 38.0 25-29 37.49745 38.0 38.0 38.0 37.8 38.0 30-34 37.441700000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.33985 38.0 38.0 38.0 37.0 38.0 40-44 37.268950000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.22045 38.0 38.0 38.0 37.0 38.0 50-54 37.16775 38.0 38.0 38.0 36.2 38.0 55-59 37.03585 38.0 38.0 38.0 36.0 38.0 60-64 36.977050000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.01205 38.0 38.0 38.0 36.0 38.0 70-74 36.86605 38.0 38.0 38.0 35.8 38.0 75-79 36.69175 38.0 38.0 38.0 35.0 38.0 80-84 36.5824 38.0 38.0 38.0 34.6 38.0 85-89 36.57465 38.0 38.0 38.0 34.2 38.0 90-94 36.4466 38.0 38.0 38.0 34.0 38.0 95-99 36.389649999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.12945 38.0 37.8 38.0 33.2 38.0 105-109 35.98755 38.0 37.2 38.0 32.6 38.0 110-114 35.82135 38.0 37.0 38.0 32.2 38.0 115-119 35.6537 38.0 37.0 38.0 31.4 38.0 120-124 35.44645 38.0 36.4 38.0 30.4 38.0 125-129 35.123200000000004 38.0 36.0 38.0 28.0 38.0 130-134 34.65220000000001 38.0 35.4 38.0 27.0 38.0 135-139 34.26455 38.0 35.0 38.0 24.0 38.0 140-144 33.83305 38.0 34.8 38.0 22.6 38.0 145-149 33.054 38.0 33.2 38.0 17.8 38.0 150-151 28.76225 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 1.0 11 2.0 12 1.0 13 0.0 14 5.0 15 4.0 16 2.0 17 0.0 18 3.0 19 4.0 20 5.0 21 7.0 22 8.0 23 11.0 24 10.0 25 17.0 26 14.0 27 23.0 28 32.0 29 47.0 30 53.0 31 48.0 32 72.0 33 108.0 34 166.0 35 282.0 36 662.0 37 2410.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.105691056910565 14.380081300813007 9.044715447154472 32.46951219512195 2 21.175 19.950000000000003 35.15 23.724999999999998 3 19.275000000000002 25.724999999999998 27.025 27.975 4 22.650000000000002 32.824999999999996 22.125 22.400000000000002 5 20.882426673351716 38.85685635497618 22.31135622963149 17.949360742040614 6 18.224999999999998 35.3 24.85 21.625 7 14.099999999999998 23.200000000000003 41.925000000000004 20.775 8 18.125 21.6 32.425 27.85 9 17.625 23.625 32.6 26.150000000000002 10-14 21.005 29.025000000000002 26.145000000000003 23.825 15-19 20.23 27.765 28.060000000000002 23.945 20-24 20.0 28.16 27.839999999999996 24.0 25-29 20.14 28.310000000000002 27.779999999999998 23.77 30-34 20.645 28.92 26.775 23.66 35-39 20.66826730692277 28.57142857142857 27.25090036014406 23.5094037615046 40-44 20.373242607695 28.358432981437936 27.462850853054487 23.80547355781258 45-49 20.863561314854657 28.518537049081903 26.802421574023118 23.815480062040326 50-54 20.476261944069236 28.14047726249437 27.234979238581218 24.14828155485517 55-59 20.14521782674011 28.212318477716575 27.32098147220831 24.321482223335003 60-64 19.947914058196023 28.09135072870236 28.011218510542395 23.949516702559222 65-69 20.366476419345148 28.431961550015018 27.66095924702113 23.540602783618706 70-74 20.685164780126215 28.132825803866574 27.53681258138836 23.64519683461885 75-79 20.348662458671477 28.52419597234746 27.26179741508867 23.865344153892394 80-84 20.303348851178857 28.247484607298396 27.34144265905792 24.107723882464835 85-89 20.97993093438767 28.39697712827186 27.330964416195386 23.292127521145087 90-94 21.259133219897908 28.40056050445401 26.423781403262936 23.916524872385146 95-99 20.743669302372133 28.03022720448404 27.094384946451804 24.131718546692024 100-104 20.717650596371655 28.540643480004007 27.017139420667537 23.7245665029568 105-109 20.688273305615386 28.407553974853478 26.894755297300005 24.009417422231127 110-114 20.710741316224752 28.95092977795599 27.281840509247658 23.056488396571602 115-119 21.314102564102562 27.944711538461537 27.263621794871796 23.477564102564102 120-124 20.990000000000002 27.529999999999998 26.905 24.575 125-129 20.921046052302618 28.361418070903543 26.761338066903345 23.956197809890494 130-134 21.051309111010603 28.101914669078848 26.895823910749282 23.950952309161263 135-139 21.186013704151552 27.650141072148326 26.964933494558647 24.198911729141475 140-144 21.737171464330412 27.544430538172715 26.988735919899874 23.729662077597 145-149 21.15 27.955000000000002 26.825 24.07 150-151 21.5375 27.9375 27.075 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 3.5 25 3.0 26 5.0 27 7.0 28 10.0 29 14.0 30 17.0 31 21.0 32 32.0 33 41.0 34 49.0 35 69.5 36 88.5 37 98.0 38 121.5 39 159.5 40 176.5 41 184.0 42 226.5 43 263.0 44 251.0 45 250.5 46 256.0 47 254.0 48 241.5 49 223.0 50 208.0 51 157.5 52 118.5 53 101.5 54 80.0 55 67.5 56 51.0 57 31.5 58 23.0 59 21.0 60 21.5 61 20.0 62 11.5 63 4.5 64 3.5 65 2.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.065 45-49 0.065 50-54 0.055 55-59 0.15 60-64 0.165 65-69 0.13 70-74 0.16999999999999998 75-79 0.19 80-84 0.11499999999999999 85-89 0.095 90-94 0.09 95-99 0.09 100-104 0.22999999999999998 105-109 0.185 110-114 0.245 115-119 0.16 120-124 0.0 125-129 0.005 130-134 0.505 135-139 0.76 140-144 0.125 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.4749999999999996 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGAAGA 10 0.0068590776 144.79999 145 TCAGAGC 10 0.0068590776 144.79999 9 >>END_MODULE SRR7172508 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172508_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56425 33.0 33.0 34.0 32.0 34.0 2 32.683 33.0 33.0 34.0 32.0 34.0 3 32.75 34.0 33.0 34.0 32.0 34.0 4 32.599 34.0 33.0 34.0 32.0 34.0 5 32.588 34.0 33.0 34.0 32.0 34.0 6 36.58675 38.0 38.0 38.0 36.0 38.0 7 36.7465 38.0 38.0 38.0 36.0 38.0 8 36.67975 38.0 38.0 38.0 36.0 38.0 9 36.72425 38.0 38.0 38.0 36.0 38.0 10-14 36.654199999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.678250000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.6868 38.0 38.0 38.0 36.0 38.0 25-29 36.64835 38.0 38.0 38.0 36.0 38.0 30-34 36.631449999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.60485 38.0 38.0 38.0 36.0 38.0 40-44 36.5695 38.0 38.0 38.0 35.8 38.0 45-49 36.5648 38.0 38.0 38.0 35.6 38.0 50-54 36.517399999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.49755 38.0 38.0 38.0 35.0 38.0 60-64 36.42805 38.0 38.0 38.0 35.0 38.0 65-69 36.308299999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.228249999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.20700000000001 38.0 38.0 38.0 34.0 38.0 80-84 36.14255 38.0 38.0 38.0 34.0 38.0 85-89 35.966300000000004 38.0 38.0 38.0 33.6 38.0 90-94 35.8342 38.0 38.0 38.0 32.6 38.0 95-99 35.71275 38.0 38.0 38.0 31.8 38.0 100-104 35.56505 38.0 37.6 38.0 30.6 38.0 105-109 35.51325 38.0 37.6 38.0 31.4 38.0 110-114 35.1383 38.0 37.0 38.0 28.8 38.0 115-119 34.93695 38.0 36.4 38.0 27.8 38.0 120-124 34.71585 38.0 36.2 38.0 27.0 38.0 125-129 34.36299999999999 38.0 35.8 38.0 24.2 38.0 130-134 33.97675 38.0 35.0 38.0 22.2 38.0 135-139 33.40285 38.0 33.8 38.0 16.2 38.0 140-144 32.7584 38.0 33.2 38.0 13.6 38.0 145-149 31.8202 38.0 32.4 38.0 8.6 38.0 150-151 27.198125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 6.0 4 3.0 5 1.0 6 3.0 7 0.0 8 0.0 9 4.0 10 3.0 11 4.0 12 1.0 13 4.0 14 3.0 15 10.0 16 4.0 17 4.0 18 10.0 19 7.0 20 15.0 21 14.0 22 11.0 23 20.0 24 23.0 25 22.0 26 20.0 27 35.0 28 45.0 29 38.0 30 37.0 31 63.0 32 81.0 33 114.0 34 163.0 35 250.0 36 535.0 37 2417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.79267986964152 19.754324392078214 12.358987214840813 25.09400852343946 2 27.313769751693002 23.87760220717331 31.326812139453224 17.481815901680463 3 21.77621675865529 26.467636728549927 31.008529854490718 20.747616658304064 4 23.98394380331159 34.8469643753136 22.980431510286 18.18866031108881 5 24.00903161063723 37.68188660311089 21.726041144004014 16.583040642247866 6 18.261743280582767 37.47802059783974 24.516453152474252 19.74378296910324 7 18.939964832956544 19.21627731725697 40.91936699321778 20.9243908565687 8 18.99020346646571 24.79276563677468 28.585782466716907 27.631248430042703 9 22.406430545089172 24.415975885455914 29.037930168299418 24.139663401155488 10-14 23.86335091685506 28.219040442099974 26.42049736247174 21.49711127857322 15-19 23.1600100477267 28.158754081888972 27.94775182115046 20.733484049233862 20-24 23.148799356977793 27.790615894705113 27.976489500653067 21.08409524766402 25-29 23.08619650391802 28.003817560779588 27.637130801687764 21.272855133614627 30-34 22.75900165720886 28.554210817054187 27.409230151157537 21.27755737457942 35-39 22.87292817679558 28.372677046710198 27.805123053741838 20.949271722752385 40-44 23.62220547601105 27.802059783973874 27.68651092690279 20.889223813112284 45-49 22.692790756091437 27.63627229339362 27.93770409444863 21.733232856066316 50-54 23.5468475257473 27.47048480281336 27.460437076111532 21.522230595327805 55-59 23.912388224655885 27.554506179041493 26.981814528282932 21.551291068019694 60-64 22.896468578891845 27.442608127794244 27.829406741347263 21.831516551966644 65-69 23.556895252449134 27.26450640542577 27.66641547349912 21.512182868625974 70-74 23.014318010550113 27.214267771916607 28.028133634765133 21.743280582768147 75-79 23.30955490806792 27.89108811413644 27.33849090726414 21.460866070531498 80-84 24.15473499120824 27.485556392866112 26.942979150967094 21.416729464958554 85-89 23.828183873398643 27.43029389600603 27.701582516955536 21.03993971363979 90-94 23.383409536250817 27.53353765763955 27.94051148068131 21.142541325428326 95-99 23.9399115755627 27.155345659163988 27.647709003215432 21.25703376205788 100-104 23.48153730218538 26.937955287616177 28.11856317508164 21.461944235116807 105-109 23.702587289625722 27.60612911328812 27.80708364732479 20.884199949761367 110-114 24.133427107404803 27.39375062795137 27.418868682809205 21.053953581834623 115-119 23.84827932680231 27.560914343129866 27.842250690781214 20.74855563928661 120-124 24.08942476764632 27.38005526249686 27.596081386586285 20.934438583270534 125-129 23.9638281838734 27.82717910072846 27.078623461441847 21.130369253956292 130-134 24.008235412272775 27.227076428643166 27.74932208496535 21.01536607411871 135-139 24.490308325800942 26.63955006528071 28.216330219945768 20.65381138897258 140-144 24.817884953529266 27.05852800803818 27.661391610148208 20.46219542828435 145-149 24.859324758842444 28.114951768488744 26.477090032154344 20.548633440514468 150-151 25.43330821401658 27.932680231097713 27.229339361969355 19.404672192916355 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 7.5 2 2.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 2.0 25 5.0 26 8.0 27 8.0 28 9.0 29 11.0 30 11.5 31 14.0 32 22.0 33 29.0 34 32.5 35 51.5 36 82.0 37 97.0 38 123.5 39 154.5 40 184.5 41 213.5 42 225.5 43 252.0 44 265.0 45 256.5 46 254.5 47 251.0 48 245.5 49 215.5 50 174.0 51 155.5 52 127.0 53 108.0 54 105.0 55 66.5 56 39.0 57 43.5 58 34.5 59 25.0 60 23.0 61 17.5 62 12.0 63 7.0 64 3.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.325 3 0.35000000000000003 4 0.35000000000000003 5 0.35000000000000003 6 0.475 7 0.475 8 0.475 9 0.475 10-14 0.475 15-19 0.475 20-24 0.47000000000000003 25-29 0.45999999999999996 30-34 0.43499999999999994 35-39 0.44999999999999996 40-44 0.475 45-49 0.475 50-54 0.475 55-59 0.47000000000000003 60-64 0.46499999999999997 65-69 0.475 70-74 0.475 75-79 0.47000000000000003 80-84 0.475 85-89 0.475 90-94 0.485 95-99 0.48 100-104 0.475 105-109 0.475 110-114 0.47000000000000003 115-119 0.475 120-124 0.475 125-129 0.475 130-134 0.43 135-139 0.43 140-144 0.475 145-149 0.48 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2137966015724 97.8 2 0.6086735987826528 1.2 3 0.025361399949277198 0.075 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0760841998478316 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.725 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.300000000000001 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.699999999999999 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra Read 1062242 spots for SRR7172508.sra Written 1062242 spots for SRR7172508.sra SRR ids: ['SRR7172508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1kzh2zol SRR7172508.sra spots: 21244840 blocks: [[1, 1062242], [1062243, 2124484], [2124485, 3186726], [3186727, 4248968], [4248969, 5311210], [5311211, 6373452], [6373453, 7435694], [7435695, 8497936], [8497937, 9560178], [9560179, 10622420], [10622421, 11684662], [11684663, 12746904], [12746905, 13809146], [13809147, 14871388], [14871389, 15933630], [15933631, 16995872], [16995873, 18058114], [18058115, 19120356], [19120357, 20182598], [20182599, 21244840]] SRR7172508 file size 7177478 SRR7172508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172508 SRR7172508_1.fastq SRR7172508_2.fastq Input file: SRR7172508_1.fastq Paired file: SRR7172508_2.fastq trimmed: SRR7172508-trimmed-pair1.fastq, SRR7172508-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:08:23 2025 >> started Mon Feb 10 14:08:47 2025 >> done (23.529s) 21244840 read pairs processed; of these: 39862 ( 0.19%) short read pairs filtered out after trimming by size control 112461 ( 0.53%) empty read pairs filtered out after trimming by size control 21092517 (99.28%) read pairs available; of these: 10516245 (49.86%) trimmed read pairs available after processing 10576272 (50.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 13 0.00% 20 14 0.00% 21 15 0.00% 22 20 0.00% 23 11 0.00% 24 16 0.00% 25 18 0.00% 26 19 0.00% 27 14 0.00% 28 10 0.00% 29 19 0.00% 30 20 0.00% 31 20 0.00% 32 23 0.00% 33 28 0.00% 34 30 0.00% 35 20 0.00% 36 31 0.00% 37 55 0.00% 38 31 0.00% 39 48 0.00% 40 41 0.00% 41 45 0.00% 42 52 0.00% 43 62 0.00% 44 68 0.00% 45 158 0.00% 46 144 0.00% 47 142 0.00% 48 136 0.00% 49 130 0.00% 50 179 0.00% 51 167 0.00% 52 196 0.00% 53 241 0.00% 54 250 0.00% 55 288 0.00% 56 307 0.00% 57 305 0.00% 58 421 0.00% 59 485 0.00% 60 574 0.00% 61 638 0.00% 62 758 0.00% 63 802 0.00% 64 875 0.00% 65 1011 0.00% 66 1106 0.01% 67 1234 0.01% 68 1522 0.01% 69 1983 0.01% 70 2124 0.01% 71 2186 0.01% 72 2467 0.01% 73 2719 0.01% 74 3010 0.01% 75 3263 0.02% 76 3631 0.02% 77 3849 0.02% 78 4239 0.02% 79 4807 0.02% 80 5266 0.02% 81 5946 0.03% 82 6616 0.03% 83 7423 0.04% 84 9187 0.04% 85 10325 0.05% 86 10922 0.05% 87 11199 0.05% 88 11910 0.06% 89 12557 0.06% 90 13499 0.06% 91 14296 0.07% 92 15473 0.07% 93 16851 0.08% 94 17631 0.08% 95 17877 0.08% 96 18287 0.09% 97 18663 0.09% 98 19346 0.09% 99 20229 0.10% 100 21408 0.10% 101 22063 0.10% 102 24046 0.11% 103 25190 0.12% 104 26165 0.12% 105 27213 0.13% 106 28249 0.13% 107 29143 0.14% 108 30268 0.14% 109 31181 0.15% 110 32249 0.15% 111 33324 0.16% 112 35241 0.17% 113 36786 0.17% 114 38112 0.18% 115 39636 0.19% 116 41273 0.20% 117 42524 0.20% 118 43739 0.21% 119 44845 0.21% 120 46632 0.22% 121 48357 0.23% 122 50102 0.24% 123 52493 0.25% 124 55110 0.26% 125 57448 0.27% 126 59852 0.28% 127 61065 0.29% 128 64021 0.30% 129 67295 0.32% 130 69347 0.33% 131 71148 0.34% 132 75788 0.36% 133 79791 0.38% 134 83830 0.40% 135 88826 0.42% 136 93768 0.44% 137 99147 0.47% 138 105557 0.50% 139 112447 0.53% 140 119570 0.57% 141 130807 0.62% 142 142771 0.68% 143 160372 0.76% 144 183828 0.87% 145 218238 1.03% 146 266878 1.27% 147 355774 1.69% 148 538754 2.55% 149 1072003 5.08% 150 4921957 23.34% 151 10576272 50.14% 21092517 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=7.59 fanout-score-rank=5 prefix-density=0.43 prefix-fanout=5.1 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=28.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.4 sequence=CTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATTCCACC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=31 prefix-density=0.50 prefix-fanout=2.1 sequence=TCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=45.00 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTC SRR7172508 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:09:33 Started mapping on | Feb 10 14:09:33 Finished on | Feb 10 14:11:40 Mapping speed, Million of reads per hour | 597.90 Number of input reads | 21092517 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19730016 Uniquely mapped reads % | 93.54% Average mapped length | 292.38 Number of splices: Total | 18565261 Number of splices: Annotated (sjdb) | 18173836 Number of splices: GT/AG | 18195288 Number of splices: GC/AG | 304766 Number of splices: AT/AC | 11243 Number of splices: Non-canonical | 53964 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 566659 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 167851 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 828275 828275 828275 N_multimapping 566659 566659 566659 N_noFeature 743827 19371629 957579 N_ambiguous 276533 1916 130547 UnstrandedReadsAssigned:18709656 PositiveStrandReadsAssigned:356471 NegativeStrandReadsAssigned:18641890 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172508 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172508-trimmed-pair1.fastq SRR7172508-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,092,517 reads, 18,745,445 reads pseudoaligned [quant] estimated average fragment length: 253.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7172508.ke.tsv 34699 SRR7172508.se.tsv 87100 total ==> SRR7172508.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766 428 12.7629 Potri.005G024800.1.v4.1 1035 782.996 169 11.3663 Potri.004G059700.1.v4.1 961 709.182 6 0.44554 Potri.007G009000.2.v4.1 1416 1164 0 0 Potri.003G141000.2.v4.1 2943 2691 454 8.88457 Potri.016G087400.1.v4.1 270 83.8086 990.675 622.496 Potri.015G069301.1.v4.1 564 323.238 0 0 Potri.010G195200.1.v4.1 1773 1521 5 0.173115 Potri.012G127500.1.v4.1 977 725.104 1642 119.252 ==> SRR7172508.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR7172508 completed mapping pipeline successfully