Starting /dee2/code/volunteer_pipeline.sh SRR7172509 current disk space = 3059057283072 free memory = 1290401716 SRR7172509 SRAfilesize b7f69d912a7427ebde74a57a4f3f7d64 SRR7172509.sra SRR7172509.sra file validated SRR7172509 is paired end SRR7172509 is conventional basespace SRR7172509 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.26775 34.0 33.0 34.0 32.0 34.0 2 33.1865 34.0 33.0 34.0 32.0 34.0 3 33.29075 34.0 33.0 34.0 32.0 34.0 4 33.401 34.0 33.0 34.0 33.0 34.0 5 33.1775 34.0 33.0 34.0 32.0 34.0 6 37.06175 38.0 37.0 38.0 36.0 38.0 7 37.37325 38.0 38.0 38.0 37.0 38.0 8 37.46425 38.0 38.0 38.0 37.0 38.0 9 37.494 38.0 38.0 38.0 37.0 38.0 10-14 37.330200000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.146249999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.098850000000006 38.0 38.0 38.0 36.2 38.0 25-29 37.36750000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.2644 38.0 38.0 38.0 36.8 38.0 35-39 37.1726 38.0 38.0 38.0 36.2 38.0 40-44 37.1528 38.0 38.0 38.0 36.2 38.0 45-49 36.62955 38.0 37.6 38.0 34.2 38.0 50-54 37.01615 38.0 38.0 38.0 36.0 38.0 55-59 37.052800000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.990050000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.83 38.0 38.0 38.0 35.2 38.0 70-74 36.5231 38.0 38.0 38.0 34.2 38.0 75-79 36.49505 38.0 37.6 38.0 34.0 38.0 80-84 36.2073 38.0 37.0 38.0 33.2 38.0 85-89 36.182 38.0 37.2 38.0 32.4 38.0 90-94 35.6409 38.0 36.6 38.0 30.6 38.0 95-99 36.237849999999995 38.0 37.0 38.0 33.6 38.0 100-104 36.093999999999994 38.0 37.0 38.0 33.0 38.0 105-109 35.64255000000001 38.0 36.6 38.0 30.4 38.0 110-114 35.51635 38.0 36.0 38.0 30.6 38.0 115-119 35.32000000000001 38.0 36.0 38.0 29.2 38.0 120-124 35.115750000000006 38.0 35.8 38.0 28.6 38.0 125-129 34.68984999999999 38.0 35.0 38.0 27.0 38.0 130-134 34.2405 38.0 34.8 38.0 24.4 38.0 135-139 33.728049999999996 38.0 34.0 38.0 21.4 38.0 140-144 32.82805 37.6 33.6 38.0 15.8 38.0 145-149 30.94925 36.0 30.4 38.0 11.2 38.0 150-151 27.758000000000003 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 5.0 19 5.0 20 5.0 21 9.0 22 5.0 23 11.0 24 12.0 25 13.0 26 19.0 27 36.0 28 34.0 29 44.0 30 65.0 31 73.0 32 94.0 33 160.0 34 240.0 35 428.0 36 972.0 37 1763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.39358675976209 14.533229893974658 9.438841479182829 41.63434186708043 2 21.3 19.575 36.425000000000004 22.7 3 19.7 24.325 26.55 29.425 4 23.275000000000002 31.4 22.925 22.400000000000002 5 22.3 34.725 23.875 19.1 6 17.825 35.075 27.3 19.8 7 14.549999999999999 21.925 44.625 18.9 8 16.625 24.275 31.8 27.3 9 17.4 22.125 33.675 26.8 10-14 19.89 29.830000000000002 26.395000000000003 23.885 15-19 19.759999999999998 28.799999999999997 27.54 23.9 20-24 19.97 28.235 27.905 23.89 25-29 19.645000000000003 29.330000000000002 27.845 23.18 30-34 20.015 28.749999999999996 27.525 23.71 35-39 20.044999999999998 28.68 27.76 23.515 40-44 20.549999999999997 28.54 27.355 23.555 45-49 20.195 28.315 27.91 23.580000000000002 50-54 20.09 28.685 27.485 23.74 55-59 20.32 28.015 27.544999999999998 24.12 60-64 20.445 28.505000000000003 27.245 23.805 65-69 19.77 28.389999999999997 27.900000000000002 23.94 70-74 20.155 28.675 27.365000000000002 23.805 75-79 20.355 28.1 27.800000000000004 23.745 80-84 20.175 27.894999999999996 28.12 23.810000000000002 85-89 20.355 28.735 27.16 23.75 90-94 20.325 27.639999999999997 28.005000000000003 24.03 95-99 20.735 27.560000000000002 27.775 23.93 100-104 20.535 28.605000000000004 27.644999999999996 23.215 105-109 20.365 28.48 27.41 23.745 110-114 20.94 28.175 27.634999999999998 23.25 115-119 20.695 28.494999999999997 26.779999999999998 24.03 120-124 20.25 28.77 27.169999999999998 23.810000000000002 125-129 20.895 27.97 27.38 23.755000000000003 130-134 21.065 28.189999999999998 27.175 23.57 135-139 21.14 28.685 26.340000000000003 23.835 140-144 21.154999999999998 28.78 26.36 23.705000000000002 145-149 21.165 28.110000000000003 26.540000000000003 24.185000000000002 150-151 20.1875 28.65 26.9125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 3.5 25 4.5 26 6.0 27 10.0 28 13.0 29 14.0 30 18.0 31 28.0 32 42.5 33 53.0 34 60.5 35 76.5 36 88.5 37 105.5 38 135.0 39 155.5 40 185.5 41 229.0 42 244.0 43 246.0 44 254.5 45 243.0 46 249.5 47 252.0 48 218.5 49 192.5 50 161.5 51 125.0 52 109.0 53 99.0 54 84.0 55 71.5 56 63.5 57 47.5 58 28.0 59 24.0 60 19.5 61 10.5 62 6.0 63 3.5 64 3.0 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.1125 0.0 0.0 0.0 0.0 138-139 6.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTCA 10 0.006836113 144.9625 3 >>END_MODULE SRR7172509 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172509_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07775 33.0 33.0 34.0 32.0 34.0 2 33.2105 34.0 33.0 34.0 33.0 34.0 3 33.26675 34.0 33.0 34.0 33.0 34.0 4 33.276 34.0 33.0 34.0 33.0 34.0 5 33.234 34.0 33.0 34.0 33.0 34.0 6 37.38375 38.0 38.0 38.0 38.0 38.0 7 37.415 38.0 38.0 38.0 38.0 38.0 8 37.39925 38.0 38.0 38.0 38.0 38.0 9 37.15825 38.0 38.0 38.0 37.0 38.0 10-14 37.24055 38.0 38.0 38.0 36.8 38.0 15-19 37.3514 38.0 38.0 38.0 37.4 38.0 20-24 37.05735 38.0 38.0 38.0 36.6 38.0 25-29 36.9961 38.0 38.0 38.0 36.4 38.0 30-34 37.11565 38.0 38.0 38.0 36.8 38.0 35-39 37.13885 38.0 38.0 38.0 37.0 38.0 40-44 36.88785 38.0 38.0 38.0 35.6 38.0 45-49 37.0266 38.0 38.0 38.0 36.4 38.0 50-54 36.72285000000001 38.0 38.0 38.0 34.6 38.0 55-59 37.05465 38.0 38.0 38.0 36.4 38.0 60-64 37.098699999999994 38.0 38.0 38.0 36.4 38.0 65-69 36.83045 38.0 38.0 38.0 35.6 38.0 70-74 36.9551 38.0 38.0 38.0 36.0 38.0 75-79 37.037099999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.8639 38.0 38.0 38.0 35.4 38.0 85-89 36.28165 38.0 37.8 38.0 33.4 38.0 90-94 36.586349999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.626099999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.2601 38.0 37.6 38.0 33.4 38.0 105-109 36.2752 38.0 38.0 38.0 34.0 38.0 110-114 36.1234 38.0 37.8 38.0 33.4 38.0 115-119 36.1409 38.0 37.8 38.0 33.8 38.0 120-124 35.87905 38.0 37.0 38.0 33.0 38.0 125-129 35.723699999999994 38.0 37.0 38.0 32.2 38.0 130-134 34.8916 38.0 35.6 38.0 26.8 38.0 135-139 34.702099999999994 38.0 35.0 38.0 27.0 38.0 140-144 34.5421 38.0 35.0 38.0 27.4 38.0 145-149 33.864799999999995 38.0 34.2 38.0 23.6 38.0 150-151 29.799750000000003 36.0 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 2.0 14 4.0 15 1.0 16 2.0 17 2.0 18 3.0 19 8.0 20 4.0 21 7.0 22 10.0 23 7.0 24 8.0 25 11.0 26 15.0 27 20.0 28 30.0 29 30.0 30 50.0 31 49.0 32 72.0 33 113.0 34 140.0 35 268.0 36 551.0 37 2581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.574999999999996 19.5 14.025000000000002 28.9 2 25.6 25.825 33.15 15.425 3 20.025000000000002 29.349999999999998 30.8 19.825 4 24.3 35.825 21.675 18.2 5 25.074999999999996 37.15 21.349999999999998 16.425 6 18.525 39.574999999999996 23.25 18.65 7 18.875 19.025 41.575 20.525 8 20.925 24.375 28.65 26.05 9 20.625 25.05 31.424999999999997 22.900000000000002 10-14 23.865 28.970000000000002 26.305 20.86 15-19 22.58 28.02 28.16 21.240000000000002 20-24 22.765 28.199999999999996 28.449999999999996 20.585 25-29 22.865 27.685 28.38 21.07 30-34 22.735 28.09 28.560000000000002 20.615 35-39 23.095 27.715 28.310000000000002 20.880000000000003 40-44 23.405 28.01 27.665 20.919999999999998 45-49 23.11 28.43 27.794999999999998 20.665 50-54 23.630000000000003 27.800000000000004 27.485 21.085 55-59 22.63 27.375 28.804999999999996 21.19 60-64 23.119999999999997 27.875 28.065 20.94 65-69 23.275000000000002 28.17 27.49 21.065 70-74 22.775000000000002 27.77 27.68 21.775 75-79 22.985 28.065 27.76 21.19 80-84 23.72 27.04 27.975 21.265 85-89 23.815 28.365000000000002 27.605 20.215 90-94 24.21 27.395000000000003 27.725 20.669999999999998 95-99 23.705000000000002 27.765 28.044999999999998 20.485 100-104 23.635 27.715 28.000000000000004 20.65 105-109 23.674999999999997 27.66 28.060000000000002 20.605 110-114 23.43 28.439999999999998 28.194999999999997 19.935 115-119 24.285 27.644999999999996 27.66 20.41 120-124 24.215 27.845 28.12 19.82 125-129 24.34 27.794999999999998 27.339999999999996 20.525 130-134 24.64 27.650000000000002 27.46 20.25 135-139 24.92 27.785 27.76 19.535 140-144 24.87 27.750000000000004 27.125 20.255000000000003 145-149 24.865000000000002 28.105000000000004 27.21 19.82 150-151 25.1875 27.3125 27.825 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 1.5 22 1.0 23 2.0 24 3.5 25 5.0 26 6.0 27 5.0 28 7.5 29 14.0 30 21.0 31 26.5 32 33.5 33 44.0 34 58.5 35 73.0 36 86.0 37 100.5 38 124.0 39 158.5 40 181.5 41 211.0 42 253.5 43 273.0 44 273.5 45 260.5 46 253.0 47 246.5 48 214.5 49 195.0 50 176.5 51 144.5 52 115.0 53 89.5 54 77.0 55 61.0 56 53.0 57 47.5 58 30.0 59 21.0 60 13.5 61 9.5 62 8.5 63 6.0 64 3.0 65 1.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98682877406281 97.7 2 0.8611955420466059 1.7000000000000002 3 0.07598784194528875 0.22499999999999998 4 0.025329280648429587 0.1 5 0.025329280648429587 0.125 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.8 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGAC 10 0.006830828 145.0 2 >>END_MODULE Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra Read 1088721 spots for SRR7172509.sra Written 1088721 spots for SRR7172509.sra Read 1088706 spots for SRR7172509.sra Written 1088706 spots for SRR7172509.sra SRR ids: ['SRR7172509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6wyckt_o SRR7172509.sra spots: 21774135 blocks: [[1, 1088706], [1088707, 2177412], [2177413, 3266118], [3266119, 4354824], [4354825, 5443530], [5443531, 6532236], [6532237, 7620942], [7620943, 8709648], [8709649, 9798354], [9798355, 10887060], [10887061, 11975766], [11975767, 13064472], [13064473, 14153178], [14153179, 15241884], [15241885, 16330590], [16330591, 17419296], [17419297, 18508002], [18508003, 19596708], [19596709, 20685414], [20685415, 21774135]] SRR7172509 file size 7356839 SRR7172509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172509 SRR7172509_1.fastq SRR7172509_2.fastq Input file: SRR7172509_1.fastq Paired file: SRR7172509_2.fastq trimmed: SRR7172509-trimmed-pair1.fastq, SRR7172509-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:09:27 2025 >> started Mon Feb 10 14:09:51 2025 >> done (24.175s) 21774135 read pairs processed; of these: 13519 ( 0.06%) short read pairs filtered out after trimming by size control 10577 ( 0.05%) empty read pairs filtered out after trimming by size control 21750039 (99.89%) read pairs available; of these: 10297915 (47.35%) trimmed read pairs available after processing 11452124 (52.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 7 0.00% 21 7 0.00% 22 7 0.00% 23 8 0.00% 24 10 0.00% 25 8 0.00% 26 14 0.00% 27 10 0.00% 28 10 0.00% 29 6 0.00% 30 11 0.00% 31 9 0.00% 32 7 0.00% 33 13 0.00% 34 19 0.00% 35 12 0.00% 36 17 0.00% 37 16 0.00% 38 23 0.00% 39 22 0.00% 40 33 0.00% 41 38 0.00% 42 41 0.00% 43 34 0.00% 44 37 0.00% 45 43 0.00% 46 47 0.00% 47 86 0.00% 48 77 0.00% 49 98 0.00% 50 85 0.00% 51 134 0.00% 52 109 0.00% 53 111 0.00% 54 142 0.00% 55 160 0.00% 56 171 0.00% 57 231 0.00% 58 241 0.00% 59 319 0.00% 60 327 0.00% 61 340 0.00% 62 416 0.00% 63 481 0.00% 64 494 0.00% 65 553 0.00% 66 630 0.00% 67 748 0.00% 68 1006 0.00% 69 1411 0.01% 70 1326 0.01% 71 1287 0.01% 72 1414 0.01% 73 1531 0.01% 74 1847 0.01% 75 1858 0.01% 76 2115 0.01% 77 2334 0.01% 78 2547 0.01% 79 2987 0.01% 80 3182 0.01% 81 3715 0.02% 82 4124 0.02% 83 4758 0.02% 84 5764 0.03% 85 6890 0.03% 86 7203 0.03% 87 7811 0.04% 88 8500 0.04% 89 9189 0.04% 90 9827 0.05% 91 10578 0.05% 92 11467 0.05% 93 12585 0.06% 94 13584 0.06% 95 14492 0.07% 96 15627 0.07% 97 16574 0.08% 98 17102 0.08% 99 18350 0.08% 100 19656 0.09% 101 20078 0.09% 102 21454 0.10% 103 23219 0.11% 104 24323 0.11% 105 26012 0.12% 106 27001 0.12% 107 28122 0.13% 108 29438 0.14% 109 31042 0.14% 110 32221 0.15% 111 33742 0.16% 112 35662 0.16% 113 37124 0.17% 114 38805 0.18% 115 41289 0.19% 116 43062 0.20% 117 44342 0.20% 118 45747 0.21% 119 47233 0.22% 120 49116 0.23% 121 51234 0.24% 122 52834 0.24% 123 54962 0.25% 124 58019 0.27% 125 59238 0.27% 126 62458 0.29% 127 65075 0.30% 128 66946 0.31% 129 69270 0.32% 130 72158 0.33% 131 74761 0.34% 132 77949 0.36% 133 81086 0.37% 134 85584 0.39% 135 90683 0.42% 136 95330 0.44% 137 101955 0.47% 138 107650 0.49% 139 114608 0.53% 140 121532 0.56% 141 131764 0.61% 142 145057 0.67% 143 159560 0.73% 144 183863 0.85% 145 214001 0.98% 146 264182 1.21% 147 351957 1.62% 148 523543 2.41% 149 1006441 4.63% 150 4826062 22.19% 151 11452124 52.65% 21750039 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=17 prefix-density=0.37 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=315.98 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=23 prefix-density=0.69 prefix-fanout=2.4 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=16.37 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA SRR7172509 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:10:39 Started mapping on | Feb 10 14:10:40 Finished on | Feb 10 14:13:20 Mapping speed, Million of reads per hour | 489.38 Number of input reads | 21750039 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20038044 Uniquely mapped reads % | 92.13% Average mapped length | 293.29 Number of splices: Total | 18558324 Number of splices: Annotated (sjdb) | 18115264 Number of splices: GT/AG | 18212144 Number of splices: GC/AG | 272931 Number of splices: AT/AC | 11925 Number of splices: Non-canonical | 61324 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595040 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 312777 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1131495 1131495 1131495 N_multimapping 595040 595040 595040 N_noFeature 963117 19615573 1157015 N_ambiguous 359520 1904 129719 UnstrandedReadsAssigned:18715407 PositiveStrandReadsAssigned:420567 NegativeStrandReadsAssigned:18751310 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172509 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172509-trimmed-pair1.fastq SRR7172509-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,750,039 reads, 18,888,443 reads pseudoaligned [quant] estimated average fragment length: 240.521 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7172509.ke.tsv 34699 SRR7172509.se.tsv 87100 total ==> SRR7172509.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.48 670 16.5647 Potri.005G024800.1.v4.1 1035 795.479 245 13.5424 Potri.004G059700.1.v4.1 961 721.555 11 0.670318 Potri.007G009000.2.v4.1 1416 1176.48 0 0 Potri.003G141000.2.v4.1 2943 2703.48 1080.27 17.5699 Potri.016G087400.1.v4.1 270 83.2495 1208 638.033 Potri.015G069301.1.v4.1 564 331.197 0 0 Potri.010G195200.1.v4.1 1773 1533.48 119 3.41214 Potri.012G127500.1.v4.1 977 737.525 221 13.1757 ==> SRR7172509.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1395 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 125 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172509 completed mapping pipeline successfully