Starting /dee2/code/volunteer_pipeline.sh SRR7172510 current disk space = 3059181195264 free memory = 1579867848 SRR7172510 SRAfilesize c5051e0aa343b43bb8d000fb7bdc938d SRR7172510.sra SRR7172510.sra file validated SRR7172510 is paired end SRR7172510 is conventional basespace SRR7172510 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.125 34.0 34.0 34.0 33.0 34.0 2 33.46125 34.0 34.0 34.0 33.0 34.0 3 33.5305 34.0 34.0 34.0 33.0 34.0 4 33.5845 34.0 34.0 34.0 33.0 34.0 5 33.55375 34.0 34.0 34.0 33.0 34.0 6 37.2215 38.0 38.0 38.0 36.0 38.0 7 37.4865 38.0 38.0 38.0 37.0 38.0 8 37.54225 38.0 38.0 38.0 38.0 38.0 9 37.54325 38.0 38.0 38.0 38.0 38.0 10-14 37.40125 38.0 38.0 38.0 37.4 38.0 15-19 37.40945 38.0 38.0 38.0 37.8 38.0 20-24 37.46395 38.0 38.0 38.0 38.0 38.0 25-29 37.376 38.0 38.0 38.0 38.0 38.0 30-34 37.33005 38.0 38.0 38.0 37.2 38.0 35-39 37.162850000000006 38.0 38.0 38.0 36.8 38.0 40-44 36.811350000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.74419999999999 38.0 38.0 38.0 35.4 38.0 50-54 36.61285 38.0 38.0 38.0 35.0 38.0 55-59 36.54115 38.0 38.0 38.0 34.8 38.0 60-64 36.509550000000004 38.0 38.0 38.0 34.4 38.0 65-69 36.3923 38.0 38.0 38.0 34.0 38.0 70-74 36.295550000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.046049999999994 38.0 38.0 38.0 33.4 38.0 80-84 35.950149999999994 38.0 38.0 38.0 32.6 38.0 85-89 35.80985 38.0 37.0 38.0 32.2 38.0 90-94 35.69485 38.0 37.0 38.0 31.2 38.0 95-99 35.512750000000004 38.0 37.0 38.0 30.2 38.0 100-104 35.22165 38.0 36.4 38.0 29.0 38.0 105-109 35.02075000000001 38.0 36.2 38.0 28.4 38.0 110-114 34.728750000000005 38.0 35.8 38.0 26.8 38.0 115-119 34.46569999999999 38.0 35.2 38.0 25.2 38.0 120-124 34.16955 38.0 35.0 38.0 23.6 38.0 125-129 33.768950000000004 38.0 34.4 38.0 19.4 38.0 130-134 33.2126 38.0 33.4 38.0 17.4 38.0 135-139 32.44375 38.0 32.4 38.0 13.8 38.0 140-144 31.5166 38.0 30.6 38.0 12.8 38.0 145-149 30.56065 36.6 31.0 38.0 4.2 38.0 150-151 24.839875 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 2.0 7 2.0 8 1.0 9 1.0 10 6.0 11 3.0 12 5.0 13 4.0 14 3.0 15 3.0 16 7.0 17 2.0 18 16.0 19 14.0 20 16.0 21 25.0 22 18.0 23 17.0 24 19.0 25 20.0 26 30.0 27 33.0 28 40.0 29 34.0 30 53.0 31 67.0 32 86.0 33 124.0 34 215.0 35 367.0 36 868.0 37 1894.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.248226950354606 20.212765957446805 2.988855116514691 36.55015197568389 2 12.65 14.299999999999999 56.675 16.375 3 11.4 21.099999999999998 39.050000000000004 28.449999999999996 4 19.0 28.549999999999997 29.825000000000003 22.625 5 20.5 35.275 26.400000000000002 17.825 6 15.475 34.425 27.975 22.125 7 13.775 25.3 45.7 15.225 8 12.45 21.25 39.675 26.625 9 14.475 18.575 40.8 26.150000000000002 10-14 19.36 28.615000000000002 28.59 23.435 15-19 19.445 28.37 28.925 23.26 20-24 20.044999999999998 27.735 28.194999999999997 24.025 25-29 19.465 28.925 28.48 23.13 30-34 19.965 28.79 28.060000000000002 23.185 35-39 20.03200320032003 28.62786278627863 28.197819781978197 23.142314231423143 40-44 19.70985492746373 28.574287143571787 28.714357178589296 23.001500750375186 45-49 20.31210923823338 28.544990746761368 28.254889211223926 22.888010803781324 50-54 20.24119295436349 27.97237790232186 28.83306645316253 22.953362690152122 55-59 20.112151404395934 29.309567916687527 27.25679667551194 23.321484003404596 60-64 19.731637710909727 28.99914885094878 27.782506383617882 23.486707054523606 65-69 19.859824780976222 28.640801001251564 28.295369211514394 23.204005006257823 70-74 19.81273783296615 29.37612657720809 27.93911476066493 22.872020829160824 75-79 20.467748397435898 28.776041666666668 28.004807692307693 22.751402243589745 80-84 20.357482601512043 28.76883793120713 27.632303609873325 23.2413758574075 85-89 20.130162703379224 28.916145181476843 27.754693366708384 23.198998748435546 90-94 20.595744680851062 28.1351689612015 28.180225281602 23.08886107634543 95-99 20.108124342994444 29.093457476097512 27.711868648946286 23.086549531961754 100-104 20.35562233909341 29.616829451540195 27.27272727272727 22.75482093663912 105-109 20.75112669003505 28.567851777666498 27.72658988482724 22.954431647471207 110-114 20.245675607921783 29.049887189771873 27.525695663073453 23.17874153923289 115-119 20.761990587764092 29.328126564533896 27.49073795934715 22.41914488835486 120-124 20.34 28.799999999999997 27.66 23.200000000000003 125-129 20.77 28.585 27.47 23.175 130-134 21.08 28.92 27.474999999999998 22.525000000000002 135-139 20.95 28.77 27.255000000000003 23.025000000000002 140-144 21.065 29.525000000000002 26.974999999999998 22.435 145-149 21.625 28.32 27.22 22.835 150-151 21.212500000000002 29.075 27.05 22.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 2.0 14 3.0 15 1.5 16 0.5 17 1.0 18 2.5 19 2.5 20 1.5 21 2.0 22 4.0 23 5.5 24 6.5 25 7.0 26 10.5 27 20.0 28 23.5 29 26.5 30 33.5 31 41.0 32 50.0 33 54.0 34 73.5 35 92.5 36 102.5 37 125.0 38 149.0 39 175.0 40 192.5 41 211.0 42 223.0 43 237.5 44 271.0 45 275.0 46 242.0 47 233.5 48 217.0 49 178.5 50 151.0 51 131.0 52 114.5 53 80.5 54 52.5 55 42.5 56 41.0 57 28.5 58 16.5 59 17.5 60 12.0 61 3.0 62 2.5 63 2.0 64 1.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.05 45-49 0.034999999999999996 50-54 0.08 55-59 0.135 60-64 0.135 65-69 0.125 70-74 0.13999999999999999 75-79 0.16 80-84 0.135 85-89 0.125 90-94 0.125 95-99 0.11499999999999999 100-104 0.17500000000000002 105-109 0.15 110-114 0.27499999999999997 115-119 0.13 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.6554071086463322 1.3 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 2.85 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.825 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.575 0.0 0.0 0.0 0.0 118-119 5.075 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 5.800000000000001 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.0875 0.0 0.0 0.0 0.0 130-131 7.6375 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.6125 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCTGC 10 0.006830828 145.0 7 >>END_MODULE SRR7172510 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172510_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4665 33.0 33.0 34.0 32.0 34.0 2 32.73025 33.0 33.0 34.0 32.0 34.0 3 32.79325 34.0 33.0 34.0 32.0 34.0 4 32.612 34.0 33.0 34.0 32.0 34.0 5 32.6455 34.0 33.0 34.0 32.0 34.0 6 36.84075 38.0 38.0 38.0 36.0 38.0 7 36.89 38.0 38.0 38.0 37.0 38.0 8 36.93 38.0 38.0 38.0 37.0 38.0 9 36.87125 38.0 38.0 38.0 37.0 38.0 10-14 36.88645 38.0 38.0 38.0 37.0 38.0 15-19 36.8612 38.0 38.0 38.0 37.0 38.0 20-24 36.837599999999995 38.0 38.0 38.0 37.0 38.0 25-29 36.8486 38.0 38.0 38.0 37.0 38.0 30-34 36.824 38.0 38.0 38.0 37.0 38.0 35-39 36.829100000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.7216 38.0 38.0 38.0 36.6 38.0 45-49 36.70865 38.0 38.0 38.0 36.2 38.0 50-54 36.682550000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.6432 38.0 38.0 38.0 36.0 38.0 60-64 36.5786 38.0 38.0 38.0 36.0 38.0 65-69 36.501 38.0 38.0 38.0 35.8 38.0 70-74 36.36005 38.0 38.0 38.0 34.8 38.0 75-79 36.25295 38.0 38.0 38.0 34.2 38.0 80-84 36.163650000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.0723 38.0 38.0 38.0 34.0 38.0 90-94 35.9036 38.0 38.0 38.0 33.6 38.0 95-99 35.6903 38.0 38.0 38.0 32.2 38.0 100-104 35.39975 38.0 37.4 38.0 30.2 38.0 105-109 35.252250000000004 38.0 37.0 38.0 29.4 38.0 110-114 35.05135 38.0 36.8 38.0 28.8 38.0 115-119 34.7603 38.0 36.6 38.0 26.8 38.0 120-124 34.34395 38.0 35.8 38.0 25.0 38.0 125-129 34.0122 38.0 35.8 38.0 22.8 38.0 130-134 33.24705 38.0 33.2 38.0 16.2 38.0 135-139 32.4214 38.0 33.0 38.0 13.4 38.0 140-144 31.623399999999997 38.0 32.2 38.0 10.0 38.0 145-149 30.2 38.0 29.0 38.0 2.0 38.0 150-151 24.249875 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 8.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 5.0 15 8.0 16 6.0 17 11.0 18 9.0 19 10.0 20 11.0 21 15.0 22 14.0 23 20.0 24 22.0 25 28.0 26 22.0 27 24.0 28 34.0 29 38.0 30 49.0 31 74.0 32 79.0 33 114.0 34 168.0 35 316.0 36 708.0 37 2158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.55345911949686 28.251572327044027 4.452830188679245 26.742138364779873 2 19.73816717019134 20.39274924471299 48.28801611278953 11.581067472306144 3 13.724502644170233 23.822714681440445 41.32460337446487 21.12817929992445 4 18.257365902795268 35.02895995970788 26.81944094686477 19.894233190632082 5 23.067237471669603 38.98262402417527 22.160664819944596 15.789473684210526 6 17.621920563097035 38.58722976370036 24.33383609854198 19.457013574660635 7 16.922303243650994 22.127231581594167 42.21775207442796 18.73271310032688 8 14.282122202665326 22.806135277847623 35.55443801860699 27.35730450088006 9 18.291457286432163 21.4321608040201 35.22613065326633 25.05025125628141 10-14 21.418154387729444 27.518229821473472 28.901181795323104 22.162433995473975 15-19 21.001006036217305 28.169014084507044 29.84406438631791 20.985915492957748 20-24 21.889145961170907 28.493109345136304 28.835127250779603 20.782617442913185 25-29 21.96691638594198 28.266881190607872 28.68419729498718 21.08200512846297 30-34 22.092029167714358 27.94065878803118 28.634649233090272 21.332662811164194 35-39 21.907060953530475 28.123114061557033 29.028364514182257 20.941460470730235 40-44 21.789648408027766 28.051908857703335 28.811427996579646 21.34701473768925 45-49 22.03219315895372 27.821931589537225 28.878269617706238 21.267605633802816 50-54 21.388329979879277 27.756539235412475 29.170020120724345 21.685110663983902 55-59 22.067404426559357 27.671026156941647 28.707243460764587 21.554325955734406 60-64 21.771273385636693 28.268959967813316 28.766847716757194 21.192918929792796 65-69 22.477617945880695 28.13097273916105 28.573584146464135 20.817825168494114 70-74 22.21719229415019 27.609275187364823 28.71082943513908 21.462703083345907 75-79 22.374245472837025 27.70120724346076 29.26559356136821 20.658953722334005 80-84 22.303822937625757 28.078470824949697 28.430583501006033 21.187122736418512 85-89 22.590543259557343 27.94265593561368 27.952716297786722 21.514084507042252 90-94 22.09758551307847 27.842052313883297 28.29476861167002 21.76559356136821 95-99 22.307730999446708 28.147477491071875 28.30843518937679 21.236356320104623 100-104 22.977118430978123 28.051294945939148 28.378174503394522 20.593412119688207 105-109 22.85484357710492 27.869429634845588 28.296952016899706 20.978774771149784 110-114 22.991801217242593 28.23298626829636 28.273225692872593 20.501986821588453 115-119 23.42437503143705 28.469392887681703 27.714903676877423 20.391328404003822 120-124 23.81191853155645 28.227307015338194 27.472969575056577 20.48780487804878 125-129 23.478829327164842 28.311374836568444 28.351604143618626 19.858191692648095 130-134 24.311142397425584 27.690064360418344 28.31858407079646 19.680209171359614 135-139 24.320112602422963 29.000150806816468 26.823505755793498 19.85623083496707 140-144 24.016698521275526 29.041343929182172 26.808168192334776 20.133789357207522 145-149 24.260563380281692 29.09456740442656 27.1830985915493 19.461770623742456 150-151 24.795674588205706 28.643279265685905 27.662517289073307 18.898528857035082 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 21.0 1 11.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 3.0 21 3.5 22 3.0 23 5.0 24 7.5 25 10.0 26 13.0 27 15.5 28 18.0 29 21.0 30 27.0 31 36.5 32 45.5 33 62.0 34 71.5 35 78.5 36 103.5 37 132.5 38 153.5 39 180.5 40 212.5 41 222.0 42 232.0 43 242.0 44 261.0 45 259.0 46 235.0 47 239.5 48 222.5 49 189.5 50 155.0 51 112.5 52 85.0 53 70.5 54 58.0 55 46.5 56 33.5 57 26.5 58 21.5 59 16.5 60 13.5 61 7.5 62 5.5 63 4.0 64 3.0 65 3.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.7000000000000001 3 0.7250000000000001 4 0.7250000000000001 5 0.7250000000000001 6 0.5499999999999999 7 0.575 8 0.575 9 0.5 10-14 0.575 15-19 0.6 20-24 0.59 25-29 0.555 30-34 0.575 35-39 0.58 40-44 0.5950000000000001 45-49 0.6 50-54 0.6 55-59 0.6 60-64 0.58 65-69 0.59 70-74 0.5950000000000001 75-79 0.6 80-84 0.6 85-89 0.6 90-94 0.6 95-99 0.5950000000000001 100-104 0.575 105-109 0.59 110-114 0.5950000000000001 115-119 0.5950000000000001 120-124 0.575 125-129 0.5700000000000001 130-134 0.5599999999999999 135-139 0.5349999999999999 140-144 0.59 145-149 0.6 150-151 0.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11190053285968 97.65 2 0.786602385181426 1.55 3 0.025374270489723422 0.075 4 0.025374270489723422 0.1 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025374270489723422 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.7374999999999998 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.475 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 2.9 0.0 0.0 0.0 0.0 108-109 3.2249999999999996 0.0 0.0 0.0 0.0 110-111 3.5250000000000004 0.0 0.0 0.0 0.0 112-113 3.8499999999999996 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.0375 0.0 0.0 0.0 0.0 120-121 5.4625 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.225 0.0 0.0 0.0 0.0 126-127 6.55 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.1 0.0 0.0 0.0 0.0 138-139 9.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492078 spots for SRR7172510.sra Written 492078 spots for SRR7172510.sra Read 492080 spots for SRR7172510.sra Written 492080 spots for SRR7172510.sra SRR ids: ['SRR7172510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_stn3y3hh SRR7172510.sra spots: 9841562 blocks: [[1, 492078], [492079, 984156], [984157, 1476234], [1476235, 1968312], [1968313, 2460390], [2460391, 2952468], [2952469, 3444546], [3444547, 3936624], [3936625, 4428702], [4428703, 4920780], [4920781, 5412858], [5412859, 5904936], [5904937, 6397014], [6397015, 6889092], [6889093, 7381170], [7381171, 7873248], [7873249, 8365326], [8365327, 8857404], [8857405, 9349482], [9349483, 9841562]] SRR7172510 file size 3313591 SRR7172510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172510 SRR7172510_1.fastq SRR7172510_2.fastq Input file: SRR7172510_1.fastq Paired file: SRR7172510_2.fastq trimmed: SRR7172510-trimmed-pair1.fastq, SRR7172510-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:08:42 2025 >> started Mon Feb 10 15:08:53 2025 >> done (10.829s) 9841562 read pairs processed; of these: 20539 ( 0.21%) short read pairs filtered out after trimming by size control 86482 ( 0.88%) empty read pairs filtered out after trimming by size control 9734541 (98.91%) read pairs available; of these: 6273291 (64.44%) trimmed read pairs available after processing 3461250 (35.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 107 0.00% 19 97 0.00% 20 108 0.00% 21 111 0.00% 22 147 0.00% 23 174 0.00% 24 154 0.00% 25 166 0.00% 26 178 0.00% 27 196 0.00% 28 172 0.00% 29 184 0.00% 30 207 0.00% 31 236 0.00% 32 199 0.00% 33 165 0.00% 34 172 0.00% 35 203 0.00% 36 207 0.00% 37 201 0.00% 38 182 0.00% 39 233 0.00% 40 211 0.00% 41 197 0.00% 42 259 0.00% 43 251 0.00% 44 273 0.00% 45 297 0.00% 46 286 0.00% 47 318 0.00% 48 349 0.00% 49 387 0.00% 50 378 0.00% 51 438 0.00% 52 426 0.00% 53 500 0.01% 54 511 0.01% 55 521 0.01% 56 598 0.01% 57 618 0.01% 58 637 0.01% 59 784 0.01% 60 798 0.01% 61 1014 0.01% 62 1052 0.01% 63 1139 0.01% 64 1249 0.01% 65 1476 0.02% 66 1638 0.02% 67 1803 0.02% 68 2050 0.02% 69 2710 0.03% 70 3205 0.03% 71 2823 0.03% 72 2802 0.03% 73 3155 0.03% 74 3256 0.03% 75 3518 0.04% 76 3649 0.04% 77 3901 0.04% 78 4294 0.04% 79 4803 0.05% 80 5159 0.05% 81 5588 0.06% 82 6382 0.07% 83 6899 0.07% 84 7831 0.08% 85 8709 0.09% 86 9114 0.09% 87 9429 0.10% 88 10028 0.10% 89 10120 0.10% 90 11120 0.11% 91 11651 0.12% 92 12242 0.13% 93 13199 0.14% 94 13871 0.14% 95 14694 0.15% 96 14646 0.15% 97 15559 0.16% 98 15875 0.16% 99 16610 0.17% 100 17400 0.18% 101 17956 0.18% 102 18754 0.19% 103 19491 0.20% 104 19841 0.20% 105 20797 0.21% 106 21093 0.22% 107 22038 0.23% 108 22687 0.23% 109 23608 0.24% 110 23855 0.25% 111 24374 0.25% 112 25370 0.26% 113 25836 0.27% 114 26926 0.28% 115 28274 0.29% 116 28809 0.30% 117 29755 0.31% 118 30341 0.31% 119 31313 0.32% 120 32348 0.33% 121 33530 0.34% 122 34367 0.35% 123 35766 0.37% 124 37076 0.38% 125 38296 0.39% 126 40343 0.41% 127 41297 0.42% 128 42604 0.44% 129 44361 0.46% 130 46074 0.47% 131 47397 0.49% 132 50879 0.52% 133 52770 0.54% 134 55463 0.57% 135 59285 0.61% 136 63046 0.65% 137 68094 0.70% 138 73268 0.75% 139 78720 0.81% 140 85129 0.87% 141 94380 0.97% 142 102354 1.05% 143 114159 1.17% 144 129756 1.33% 145 149815 1.54% 146 185836 1.91% 147 240785 2.47% 148 354727 3.64% 149 639901 6.57% 150 2441848 25.08% 151 3461250 35.56% 9734541 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=20.94 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=3.4 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTTGCTTATTTTTCTCACATAAATAGTTCTGATCATTTTACATATTGATAAAGATAGTAGTATAGCTCTCCATACTTTTAAGCAGTACTCAACTTTGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACCGTACACTGGTGGAAAGGGGTCACTGGGGTAAGTTGGGACTTTGCCGGGGTCAACAGCTCCTCGGGATGCGTCTCGCTCG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=8 prefix-density=0.36 prefix-fanout=2.7 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.51 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7172510 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 15:15:16 Started mapping on | Feb 10 15:15:17 Finished on | Feb 10 15:16:10 Mapping speed, Million of reads per hour | 660.13 Number of input reads | 9718646 Average input read length | 268 UNIQUE READS: Uniquely mapped reads number | 7904307 Uniquely mapped reads % | 81.33% Average mapped length | 269.99 Number of splices: Total | 6799043 Number of splices: Annotated (sjdb) | 6614565 Number of splices: GT/AG | 6661883 Number of splices: GC/AG | 105694 Number of splices: AT/AC | 4104 Number of splices: Non-canonical | 27362 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234563 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 38028 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.78% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1598552 1598552 1598552 N_multimapping 234563 234563 234563 N_noFeature 514053 7753057 598390 N_ambiguous 183634 2665 114444 UnstrandedReadsAssigned:7206620 PositiveStrandReadsAssigned:148585 NegativeStrandReadsAssigned:7191473 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7172510 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172510-trimmed-pair1.fastq SRR7172510-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,718,646 reads, 8,412,572 reads pseudoaligned [quant] estimated average fragment length: 220.825 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR7172510.ke.tsv 34699 SRR7172510.se.tsv 87100 total ==> SRR7172510.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.18 426 31.8469 Potri.005G024800.1.v4.1 1035 815.175 133 21.9326 Potri.004G059700.1.v4.1 961 741.386 26 4.71431 Potri.007G009000.2.v4.1 1416 1196.18 0 0 Potri.003G141000.2.v4.1 2943 2723.18 433.379 21.3935 Potri.016G087400.1.v4.1 270 103.098 286 372.91 Potri.015G069301.1.v4.1 564 353.319 0 0 Potri.010G195200.1.v4.1 1773 1553.18 24 2.07721 Potri.012G127500.1.v4.1 977 757.297 226 40.1173 ==> SRR7172510.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 466 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172510 completed mapping pipeline successfully