Starting /dee2/code/volunteer_pipeline.sh SRR7172511 current disk space = 3059192320000 free memory = 1579866756 SRR7172511 SRAfilesize baee5bf731dce4294d2655aa43e2a27c SRR7172511.sra SRR7172511.sra file validated SRR7172511 is paired end SRR7172511 is conventional basespace SRR7172511 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9995 34.0 33.0 34.0 33.0 34.0 2 33.41425 34.0 34.0 34.0 33.0 34.0 3 33.40925 34.0 34.0 34.0 33.0 34.0 4 33.52225 34.0 34.0 34.0 33.0 34.0 5 33.325 34.0 34.0 34.0 33.0 34.0 6 36.997 38.0 37.0 38.0 36.0 38.0 7 37.37975 38.0 38.0 38.0 37.0 38.0 8 37.47575 38.0 38.0 38.0 37.0 38.0 9 37.5435 38.0 38.0 38.0 38.0 38.0 10-14 37.47709999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.514149999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.500699999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.49979999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.47045 38.0 38.0 38.0 37.4 38.0 35-39 37.3207 38.0 38.0 38.0 37.0 38.0 40-44 37.2376 38.0 38.0 38.0 36.8 38.0 45-49 37.20575 38.0 38.0 38.0 36.4 38.0 50-54 37.04709999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.99695 38.0 38.0 38.0 36.0 38.0 60-64 36.99745 38.0 38.0 38.0 36.0 38.0 65-69 37.04275 38.0 38.0 38.0 36.0 38.0 70-74 36.82835 38.0 38.0 38.0 35.4 38.0 75-79 36.73435 38.0 38.0 38.0 35.0 38.0 80-84 36.63915 38.0 38.0 38.0 34.4 38.0 85-89 36.55375 38.0 38.0 38.0 34.0 38.0 90-94 36.470150000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.3132 38.0 38.0 38.0 34.0 38.0 100-104 36.12025 38.0 37.2 38.0 33.2 38.0 105-109 35.96595000000001 38.0 37.0 38.0 32.4 38.0 110-114 35.7792 38.0 37.0 38.0 31.0 38.0 115-119 35.53585 38.0 36.4 38.0 30.6 38.0 120-124 35.39255000000001 38.0 36.2 38.0 29.6 38.0 125-129 35.15195000000001 38.0 36.0 38.0 28.2 38.0 130-134 34.66165 38.0 35.2 38.0 26.8 38.0 135-139 34.2483 38.0 35.0 38.0 25.0 38.0 140-144 33.65555 38.0 34.2 38.0 22.2 38.0 145-149 32.82195 38.0 33.2 38.0 15.4 38.0 150-151 28.407625000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 3.0 16 1.0 17 0.0 18 4.0 19 3.0 20 7.0 21 5.0 22 7.0 23 11.0 24 15.0 25 14.0 26 20.0 27 21.0 28 39.0 29 44.0 30 45.0 31 77.0 32 72.0 33 92.0 34 182.0 35 284.0 36 689.0 37 2359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.841145173549535 15.125411705092477 10.159614897390423 33.87382822396757 2 21.625 18.15 36.1 24.125 3 18.325 24.975 28.1 28.599999999999998 4 21.625 32.625 22.875 22.875 5 21.163490471414242 37.83851554663992 23.19458375125376 17.803410230692077 6 17.75 36.0 25.624999999999996 20.625 7 14.075 22.475 44.175 19.275000000000002 8 16.675 23.0 33.025 27.3 9 17.925 23.325000000000003 33.0 25.75 10-14 20.16 29.73 26.345000000000002 23.765 15-19 20.03 28.315 28.134999999999998 23.52 20-24 19.759999999999998 28.935 27.689999999999998 23.615 25-29 19.235 28.84 28.025 23.9 30-34 20.064999999999998 29.189999999999998 27.634999999999998 23.11 35-39 19.67893578715743 29.095819163832765 27.700540108021602 23.524704940988197 40-44 20.178071228491394 29.231692677070832 27.29591836734694 23.294317727090835 45-49 20.234105347406334 28.75293882247011 27.272272522635188 23.740683307488368 50-54 20.0070024508578 28.940129045165808 27.504626619316763 23.54824188465963 55-59 19.665648931377948 28.569998498423345 27.69407878272186 24.07027378747685 60-64 20.026033843997197 28.396915990788024 27.665965755482127 23.911084409732652 65-69 19.969962453066334 28.790988735919896 27.964956195244056 23.27409261576971 70-74 19.916887798528013 28.99914885094878 26.806188354278277 24.27777499624493 75-79 19.815760488635227 29.187944327625914 27.135275858616204 23.86101932512266 80-84 20.566594924670905 29.115571349917413 26.688022423544723 23.629811301866958 85-89 20.4644412191582 28.737300435413644 27.315950152645012 23.482308192783144 90-94 20.229160412288604 28.399879915941156 27.944561192834982 23.426398478935255 95-99 20.999699789852897 28.65005503852697 27.16401481036726 23.18623036125288 100-104 20.163310289550147 28.113415489429915 28.2035868149484 23.519687406071537 105-109 20.41551939924906 28.355444305381727 28.260325406758447 22.96871088861076 110-114 20.274535343920647 28.184960673312958 27.578778618305694 23.961725364460698 115-119 20.518596385843722 28.92826750763378 27.336436902437804 23.216699204084698 120-124 21.42 28.439999999999998 27.029999999999998 23.11 125-129 20.615 28.110000000000003 27.445000000000004 23.830000000000002 130-134 21.00713639561765 28.53553120916675 26.912252487687205 23.545079907528397 135-139 21.03274559193955 28.937027707808564 26.332493702770783 23.697732997481108 140-144 21.07133917396746 28.74092615769712 25.732165206508135 24.455569461827285 145-149 21.415 28.575 26.279999999999998 23.73 150-151 21.099999999999998 28.712500000000002 26.5 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 2.0 21 4.0 22 3.0 23 3.0 24 5.5 25 7.5 26 9.0 27 8.0 28 10.0 29 16.0 30 21.5 31 28.5 32 38.5 33 51.5 34 65.0 35 77.0 36 90.0 37 117.0 38 143.5 39 165.0 40 184.5 41 217.5 42 232.5 43 235.5 44 264.5 45 255.5 46 242.0 47 250.0 48 234.5 49 204.5 50 172.5 51 138.0 52 114.5 53 88.5 54 73.0 55 63.0 56 45.5 57 36.0 58 26.0 59 17.5 60 11.0 61 10.0 62 7.5 63 2.0 64 2.0 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.04 45-49 0.045 50-54 0.034999999999999996 55-59 0.105 60-64 0.13 65-69 0.125 70-74 0.135 75-79 0.13 80-84 0.105 85-89 0.095 90-94 0.06999999999999999 95-99 0.06999999999999999 100-104 0.19 105-109 0.125 110-114 0.19499999999999998 115-119 0.11499999999999999 120-124 0.0 125-129 0.0 130-134 0.51 135-139 0.75 140-144 0.125 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.3625 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.425 0.0 0.0 0.0 0.0 132-133 7.137499999999999 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.3625 0.0 0.0 0.0 0.0 138-139 9.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTG 10 0.006830828 145.0 145 AACTCAC 10 0.006830828 145.0 5 GAACTCA 10 0.006830828 145.0 4 GGAACTC 10 0.006830828 145.0 3 >>END_MODULE SRR7172511 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63725 33.0 33.0 34.0 32.0 34.0 2 32.79175 34.0 33.0 34.0 32.0 34.0 3 32.78275 34.0 33.0 34.0 32.0 34.0 4 32.7425 34.0 33.0 34.0 32.0 34.0 5 32.7685 34.0 33.0 34.0 32.0 34.0 6 36.838 38.0 38.0 38.0 36.0 38.0 7 36.81425 38.0 38.0 38.0 36.0 38.0 8 36.86725 38.0 38.0 38.0 36.0 38.0 9 36.92125 38.0 38.0 38.0 37.0 38.0 10-14 36.82715 38.0 38.0 38.0 36.0 38.0 15-19 36.845549999999996 38.0 38.0 38.0 36.4 38.0 20-24 36.86985 38.0 38.0 38.0 36.6 38.0 25-29 36.90235 38.0 38.0 38.0 36.8 38.0 30-34 36.817600000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.723349999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.73515 38.0 38.0 38.0 36.0 38.0 45-49 36.705400000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.7432 38.0 38.0 38.0 36.0 38.0 55-59 36.6887 38.0 38.0 38.0 36.0 38.0 60-64 36.56115 38.0 38.0 38.0 35.8 38.0 65-69 36.4851 38.0 38.0 38.0 35.4 38.0 70-74 36.38885 38.0 38.0 38.0 35.0 38.0 75-79 36.34005 38.0 38.0 38.0 34.8 38.0 80-84 36.2608 38.0 38.0 38.0 34.6 38.0 85-89 36.09875 38.0 38.0 38.0 34.0 38.0 90-94 35.9732 38.0 38.0 38.0 33.2 38.0 95-99 35.82785 38.0 38.0 38.0 33.0 38.0 100-104 35.7827 38.0 38.0 38.0 32.6 38.0 105-109 35.6314 38.0 37.8 38.0 32.0 38.0 110-114 35.38925 38.0 37.2 38.0 31.0 38.0 115-119 35.23805 38.0 37.0 38.0 30.0 38.0 120-124 34.97324999999999 38.0 36.2 38.0 28.0 38.0 125-129 34.62575 38.0 36.0 38.0 26.2 38.0 130-134 34.222950000000004 38.0 35.2 38.0 23.4 38.0 135-139 33.66525 38.0 33.8 38.0 21.4 38.0 140-144 32.92695 38.0 33.2 38.0 13.6 38.0 145-149 31.984850000000005 38.0 33.0 38.0 8.6 38.0 150-151 27.3425 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 3.0 5 1.0 6 2.0 7 4.0 8 3.0 9 5.0 10 4.0 11 3.0 12 3.0 13 6.0 14 5.0 15 4.0 16 4.0 17 8.0 18 6.0 19 8.0 20 6.0 21 9.0 22 13.0 23 12.0 24 14.0 25 26.0 26 25.0 27 28.0 28 38.0 29 31.0 30 54.0 31 61.0 32 87.0 33 99.0 34 132.0 35 242.0 36 544.0 37 2485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.90681362725451 20.89178356713427 11.948897795591181 26.252505010020037 2 24.736842105263158 26.31578947368421 33.20802005012531 15.73934837092732 3 21.840521564694082 26.930792377131397 32.62286860581745 18.60581745235707 4 24.184646261916708 34.219769192172606 22.854992473657802 18.740592072252884 5 23.507275464124437 37.63171098845961 22.629202207727044 16.23181133968891 6 18.44879518072289 37.62550200803213 24.573293172690764 19.352409638554217 7 18.62449799196787 19.954819277108435 40.93875502008032 20.481927710843372 8 20.84796788760662 24.109382839939787 28.901154039136976 26.141495233316608 9 21.109437751004016 25.627510040160644 29.367469879518072 23.895582329317268 10-14 23.49427825737804 28.653884762095966 26.24472997390082 21.607107006625174 15-19 23.296195924922213 27.918297701495533 28.369968884874037 20.41553748870822 20-24 23.024037737742763 28.152757565112662 27.776383800873187 21.04682089627139 25-29 23.301555444054188 28.349222277972906 27.74711490215755 20.602107375815354 30-34 22.799799297541394 27.75213246362268 28.539889613647766 20.90817862518816 35-39 22.70674427940586 28.256724207145723 28.186471296668003 20.85006021678041 40-44 22.674564529893075 28.477486069976404 28.151197229054763 20.69675217107575 45-49 22.87765450072795 27.73231587931121 28.349816757869373 21.04021286209147 50-54 22.671820874541897 27.61684823535318 27.928108840805262 21.783222049299663 55-59 23.145638863796044 27.908260564087122 28.134096155776373 20.81200441634046 60-64 23.166081284495736 27.927747114902157 27.762167586552934 21.144004014049173 65-69 23.455302916227474 27.646438789338955 28.193545148822967 20.7047131456106 70-74 23.18273092369478 28.107429718875505 28.102409638554214 20.6074297188755 75-79 22.95838980073282 27.972694875269788 28.208603122019777 20.860312201977614 80-84 23.619477911646587 27.248995983935743 28.263052208835344 20.86847389558233 85-89 23.446129129430666 27.347123205141077 28.215684305653177 20.99106335977508 90-94 23.457038115803748 28.031938934364486 27.8159995982524 20.69502335157937 95-99 22.914678853010596 27.84613066840757 28.428664691407622 20.810525787174207 100-104 24.105215601626426 27.66427388183324 27.824908388133125 20.405602128407207 105-109 23.881945490137028 28.47462731516338 27.169602971440042 20.473824223259548 110-114 23.674042852125044 28.11480756686236 28.019469115359524 20.191680465653068 115-119 24.46541511896396 27.788374661178594 27.110731854231503 20.635478365625943 120-124 23.734939759036145 27.75602409638554 28.11746987951807 20.39156626506024 125-129 24.498092752459346 27.840795021080105 27.986348122866893 19.674764103593656 130-134 25.253386853988964 27.53135975915705 27.461113898645255 19.75413948820873 135-139 24.89212242849975 28.178625188158556 27.084796788760663 19.844455594581035 140-144 24.710075807018423 28.384959084291378 26.903961042221 20.0010040664692 145-149 25.12302902480667 28.080747213015968 27.34759465702521 19.448629105152154 150-151 25.674827369742626 27.558066541117388 27.63339610797238 19.133709981167605 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 6.0 2 2.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 0.5 22 1.0 23 1.5 24 3.0 25 6.0 26 5.5 27 5.0 28 8.0 29 13.5 30 24.0 31 29.0 32 27.5 33 37.5 34 62.0 35 77.0 36 89.0 37 107.5 38 133.0 39 160.5 40 188.0 41 206.0 42 221.0 43 253.5 44 282.5 45 279.5 46 257.5 47 245.0 48 218.5 49 195.5 50 169.0 51 138.5 52 121.0 53 98.0 54 82.0 55 61.0 56 46.0 57 38.5 58 25.5 59 20.0 60 13.0 61 7.0 62 9.0 63 7.5 64 2.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.25 3 0.3 4 0.35000000000000003 5 0.35000000000000003 6 0.4 7 0.4 8 0.35000000000000003 9 0.4 10-14 0.38 15-19 0.37 20-24 0.365 25-29 0.35000000000000003 30-34 0.35000000000000003 35-39 0.36 40-44 0.395 45-49 0.40499999999999997 50-54 0.40499999999999997 55-59 0.37 60-64 0.35000000000000003 65-69 0.385 70-74 0.4 75-79 0.385 80-84 0.4 85-89 0.41000000000000003 90-94 0.43499999999999994 95-99 0.43499999999999994 100-104 0.395 105-109 0.385 110-114 0.35500000000000004 115-119 0.38999999999999996 120-124 0.4 125-129 0.38 130-134 0.35000000000000003 135-139 0.35000000000000003 140-144 0.40499999999999997 145-149 0.43 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.45305814246161585 0.8999999999999999 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025169896803423106 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114-115 3.15 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.737500000000001 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.55 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138-139 8.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGGT 10 0.006830828 145.0 6 >>END_MODULE Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625469 spots for SRR7172511.sra Written 625469 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra Read 625467 spots for SRR7172511.sra Written 625467 spots for SRR7172511.sra SRR ids: ['SRR7172511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i3zkjc89 SRR7172511.sra spots: 12509342 blocks: [[1, 625467], [625468, 1250934], [1250935, 1876401], [1876402, 2501868], [2501869, 3127335], [3127336, 3752802], [3752803, 4378269], [4378270, 5003736], [5003737, 5629203], [5629204, 6254670], [6254671, 6880137], [6880138, 7505604], [7505605, 8131071], [8131072, 8756538], [8756539, 9382005], [9382006, 10007472], [10007473, 10632939], [10632940, 11258406], [11258407, 11883873], [11883874, 12509342]] SRR7172511 file size 4217305 SRR7172511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172511 SRR7172511_1.fastq SRR7172511_2.fastq Input file: SRR7172511_1.fastq Paired file: SRR7172511_2.fastq trimmed: SRR7172511-trimmed-pair1.fastq, SRR7172511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:09:38 2025 >> started Mon Feb 10 15:09:52 2025 >> done (13.167s) 12509342 read pairs processed; of these: 24659 ( 0.20%) short read pairs filtered out after trimming by size control 63121 ( 0.50%) empty read pairs filtered out after trimming by size control 12421562 (99.30%) read pairs available; of these: 6406604 (51.58%) trimmed read pairs available after processing 6014958 (48.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 11 0.00% 22 2 0.00% 23 8 0.00% 24 12 0.00% 25 11 0.00% 26 9 0.00% 27 6 0.00% 28 7 0.00% 29 11 0.00% 30 14 0.00% 31 11 0.00% 32 11 0.00% 33 12 0.00% 34 9 0.00% 35 15 0.00% 36 17 0.00% 37 45 0.00% 38 25 0.00% 39 26 0.00% 40 27 0.00% 41 26 0.00% 42 28 0.00% 43 38 0.00% 44 50 0.00% 45 96 0.00% 46 84 0.00% 47 98 0.00% 48 93 0.00% 49 85 0.00% 50 101 0.00% 51 119 0.00% 52 142 0.00% 53 151 0.00% 54 151 0.00% 55 178 0.00% 56 180 0.00% 57 217 0.00% 58 235 0.00% 59 285 0.00% 60 301 0.00% 61 364 0.00% 62 406 0.00% 63 429 0.00% 64 525 0.00% 65 598 0.00% 66 691 0.01% 67 810 0.01% 68 995 0.01% 69 1253 0.01% 70 1353 0.01% 71 1369 0.01% 72 1432 0.01% 73 1589 0.01% 74 1764 0.01% 75 1972 0.02% 76 2214 0.02% 77 2266 0.02% 78 2706 0.02% 79 3005 0.02% 80 3245 0.03% 81 3767 0.03% 82 4346 0.03% 83 4696 0.04% 84 6053 0.05% 85 7045 0.06% 86 7094 0.06% 87 7576 0.06% 88 8099 0.07% 89 8518 0.07% 90 9156 0.07% 91 10113 0.08% 92 10771 0.09% 93 11868 0.10% 94 12520 0.10% 95 12383 0.10% 96 13327 0.11% 97 13723 0.11% 98 14241 0.11% 99 14669 0.12% 100 15589 0.13% 101 16479 0.13% 102 17654 0.14% 103 18251 0.15% 104 19229 0.15% 105 20413 0.16% 106 20975 0.17% 107 21411 0.17% 108 22391 0.18% 109 23226 0.19% 110 23926 0.19% 111 24889 0.20% 112 25950 0.21% 113 27223 0.22% 114 28219 0.23% 115 29591 0.24% 116 30360 0.24% 117 31337 0.25% 118 32038 0.26% 119 32553 0.26% 120 33617 0.27% 121 34735 0.28% 122 36184 0.29% 123 37497 0.30% 124 39201 0.32% 125 40676 0.33% 126 41858 0.34% 127 43101 0.35% 128 44149 0.36% 129 46173 0.37% 130 47359 0.38% 131 48382 0.39% 132 50608 0.41% 133 53191 0.43% 134 55500 0.45% 135 58633 0.47% 136 61107 0.49% 137 64602 0.52% 138 68156 0.55% 139 71713 0.58% 140 75677 0.61% 141 81560 0.66% 142 88659 0.71% 143 98631 0.79% 144 112306 0.90% 145 130911 1.05% 146 159288 1.28% 147 211160 1.70% 148 314741 2.53% 149 620985 5.00% 150 2842633 22.88% 151 6014958 48.42% 12421562 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=36.91 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.0 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=22 prefix-density=0.43 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=42.91 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172511 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:10:36 Started mapping on | Feb 10 15:10:36 Finished on | Feb 10 15:12:10 Mapping speed, Million of reads per hour | 475.72 Number of input reads | 12421562 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11531040 Uniquely mapped reads % | 92.83% Average mapped length | 291.04 Number of splices: Total | 10187156 Number of splices: Annotated (sjdb) | 9910060 Number of splices: GT/AG | 9980435 Number of splices: GC/AG | 163181 Number of splices: AT/AC | 7189 Number of splices: Non-canonical | 36351 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357068 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 26687 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 553603 553603 553603 N_multimapping 357068 357068 357068 N_noFeature 539406 11344968 633401 N_ambiguous 187045 1183 94105 UnstrandedReadsAssigned:10804589 PositiveStrandReadsAssigned:184889 NegativeStrandReadsAssigned:10803534 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172511-trimmed-pair1.fastq SRR7172511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,421,562 reads, 10,818,429 reads pseudoaligned [quant] estimated average fragment length: 233.583 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 966 rounds 52401 SRR7172511.ke.tsv 34699 SRR7172511.se.tsv 87100 total ==> SRR7172511.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.42 403 21.1158 Potri.005G024800.1.v4.1 1035 802.417 133 15.5058 Potri.004G059700.1.v4.1 961 728.504 10 1.28414 Potri.007G009000.2.v4.1 1416 1183.42 0 0 Potri.003G141000.2.v4.1 2943 2710.42 294.201 10.1543 Potri.016G087400.1.v4.1 270 87.8958 651 692.876 Potri.015G069301.1.v4.1 564 337.841 0 0 Potri.010G195200.1.v4.1 1773 1540.42 13 0.789493 Potri.012G127500.1.v4.1 977 744.463 133 16.7129 ==> SRR7172511.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 596 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172511 completed mapping pipeline successfully