Starting /dee2/code/volunteer_pipeline.sh SRR7172512 current disk space = 3058992840704 free memory = 1351161524 SRR7172512 SRAfilesize 5081e722bd495aff7e305b717831145c SRR7172512.sra SRR7172512.sra file validated SRR7172512 is paired end SRR7172512 is conventional basespace SRR7172512 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34125 34.0 33.0 34.0 32.0 34.0 2 33.23275 34.0 33.0 34.0 32.0 34.0 3 33.34825 34.0 33.0 34.0 32.0 34.0 4 33.45525 34.0 34.0 34.0 33.0 34.0 5 33.427 34.0 33.0 34.0 33.0 34.0 6 37.27125 38.0 38.0 38.0 36.0 38.0 7 37.4435 38.0 38.0 38.0 37.0 38.0 8 37.502 38.0 38.0 38.0 37.0 38.0 9 37.53625 38.0 38.0 38.0 38.0 38.0 10-14 37.46015 38.0 38.0 38.0 37.0 38.0 15-19 37.45315 38.0 38.0 38.0 37.2 38.0 20-24 37.47580000000001 38.0 38.0 38.0 37.6 38.0 25-29 37.4152 38.0 38.0 38.0 37.2 38.0 30-34 37.413199999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.30005 38.0 38.0 38.0 37.2 38.0 40-44 37.076350000000005 38.0 38.0 38.0 36.0 38.0 45-49 37.0039 38.0 38.0 38.0 36.0 38.0 50-54 36.926199999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.8 38.0 38.0 38.0 35.2 38.0 60-64 36.806799999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.66175 38.0 38.0 38.0 34.8 38.0 70-74 36.5346 38.0 38.0 38.0 34.2 38.0 75-79 36.4378 38.0 38.0 38.0 34.0 38.0 80-84 36.17635 38.0 37.4 38.0 33.4 38.0 85-89 36.1642 38.0 37.0 38.0 33.4 38.0 90-94 36.04155 38.0 37.2 38.0 33.0 38.0 95-99 35.8208 38.0 37.0 38.0 31.6 38.0 100-104 35.53574999999999 38.0 36.8 38.0 30.6 38.0 105-109 35.16815 38.0 36.0 38.0 28.8 38.0 110-114 34.7824 38.0 35.4 38.0 26.8 38.0 115-119 34.695299999999996 38.0 35.2 38.0 26.6 38.0 120-124 34.38035 38.0 34.8 38.0 24.6 38.0 125-129 33.7042 38.0 34.0 38.0 19.8 38.0 130-134 32.809400000000004 37.6 32.8 38.0 15.0 38.0 135-139 31.881549999999997 36.6 31.4 38.0 14.0 38.0 140-144 31.08885 36.0 31.0 38.0 13.2 38.0 145-149 29.34085 35.6 27.4 38.0 4.2 38.0 150-151 23.362125 30.5 8.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 1.0 12 3.0 13 1.0 14 1.0 15 3.0 16 5.0 17 4.0 18 5.0 19 12.0 20 7.0 21 11.0 22 9.0 23 15.0 24 24.0 25 17.0 26 33.0 27 30.0 28 40.0 29 63.0 30 56.0 31 90.0 32 132.0 33 149.0 34 262.0 35 443.0 36 1068.0 37 1512.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.99612102404965 16.369278510473233 8.352728213085078 30.281872252392034 2 20.525 18.099999999999998 34.925 26.450000000000003 3 16.925 26.025 28.7 28.349999999999998 4 23.75 33.25 22.025 20.974999999999998 5 21.325 36.95 24.075 17.65 6 17.275 36.675000000000004 26.05 20.0 7 14.075 23.5 44.9 17.525 8 16.775000000000002 22.925 33.375 26.924999999999997 9 18.175 24.325 31.3 26.200000000000003 10-14 19.805 29.64 26.52 24.035 15-19 19.785 28.665000000000003 27.98 23.57 20-24 20.294999999999998 28.875 27.865000000000002 22.965 25-29 19.645000000000003 29.39 27.91 23.055 30-34 19.86 28.89 27.755000000000003 23.494999999999997 35-39 20.09 29.310000000000002 27.925 22.675 40-44 20.3031212484994 28.906562625050018 27.646058423369347 23.144257703081234 45-49 20.04900980196039 28.975795159031808 27.485497099419888 23.489697939587916 50-54 19.95798319327731 28.94157663065226 28.021208483393355 23.07923169267707 55-59 20.54671072394112 28.757384599979975 28.226694703114045 22.469209972964855 60-64 20.15220547739448 29.03419616482251 27.412006208381314 23.401592149401694 65-69 20.05207029489811 28.703750062584486 27.427026485755768 23.817153156761627 70-74 20.202323717948715 28.771033653846157 27.44391025641026 23.582732371794872 75-79 20.054091956325752 28.70379645397175 27.997595913052187 23.244515676650305 80-84 20.188263568996597 28.85539755657921 27.628680152213096 23.327658722211094 85-89 19.970962250926206 28.912586362270954 27.685991789326124 23.43045959747672 90-94 20.303424794712598 28.665131183657124 27.49349088724214 23.537953134388143 95-99 19.78275016268709 28.96330780397457 27.226310256795315 24.027631776543025 100-104 20.511793279583355 28.168661425209073 27.7980870349041 23.521458260303472 105-109 20.0681294459473 28.82476705740908 27.567378018234646 23.539725478408975 110-114 20.33355035809085 28.35178043772224 28.126408574147344 23.188260630039565 115-119 20.414601171698962 29.08216914526063 27.564969205347754 22.938260477692655 120-124 20.595 28.46 27.415 23.53 125-129 20.74092615769712 28.640801001251564 27.774718397997493 22.84355444305382 130-134 20.59683435830225 28.55630607924186 27.31122088920254 23.535638673253352 135-139 20.853128474679067 28.156272111594056 27.271808349337917 23.71879106438896 140-144 20.35064804581533 28.72500753541646 27.554506179041493 23.369838239726715 145-149 20.73207320732073 29.067906790679064 27.007700770077008 23.192319231923193 150-151 20.3375 28.7375 26.4625 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.5 19 2.0 20 2.0 21 2.0 22 2.5 23 2.5 24 3.5 25 5.5 26 6.0 27 9.0 28 11.5 29 13.0 30 22.5 31 30.5 32 36.5 33 49.0 34 72.5 35 89.5 36 97.5 37 114.0 38 130.0 39 164.0 40 206.0 41 219.5 42 240.5 43 268.5 44 265.0 45 255.0 46 249.5 47 248.5 48 241.5 49 209.5 50 172.5 51 128.5 52 95.5 53 87.0 54 68.0 55 44.0 56 36.5 57 31.0 58 20.0 59 12.5 60 9.5 61 9.5 62 6.0 63 2.5 64 1.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.04 45-49 0.02 50-54 0.04 55-59 0.13 60-64 0.135 65-69 0.135 70-74 0.16 75-79 0.16999999999999998 80-84 0.13999999999999999 85-89 0.13 90-94 0.13999999999999999 95-99 0.11499999999999999 100-104 0.155 105-109 0.19 110-114 0.165 115-119 0.145 120-124 0.0 125-129 0.125 130-134 0.8099999999999999 135-139 1.0699999999999998 140-144 0.47000000000000003 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.503651473180559 1.0 3 0.07554772097708386 0.22499999999999998 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.925 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172512 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172512_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6305 33.0 33.0 34.0 32.0 34.0 2 32.66725 33.0 33.0 34.0 32.0 34.0 3 32.63575 34.0 33.0 34.0 32.0 34.0 4 32.62625 34.0 33.0 34.0 32.0 34.0 5 32.66575 34.0 33.0 34.0 32.0 34.0 6 36.80425 38.0 38.0 38.0 36.0 38.0 7 36.83875 38.0 38.0 38.0 36.0 38.0 8 36.88075 38.0 38.0 38.0 36.0 38.0 9 36.7675 38.0 38.0 38.0 36.0 38.0 10-14 36.8246 38.0 38.0 38.0 36.0 38.0 15-19 36.80625 38.0 38.0 38.0 36.0 38.0 20-24 36.75115 38.0 38.0 38.0 36.0 38.0 25-29 36.7692 38.0 38.0 38.0 36.0 38.0 30-34 36.70085 38.0 38.0 38.0 36.0 38.0 35-39 36.633050000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.560500000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.643950000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.58879999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.585049999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.48585 38.0 38.0 38.0 35.2 38.0 65-69 36.36165 38.0 38.0 38.0 34.8 38.0 70-74 36.297250000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.17205 38.0 38.0 38.0 34.0 38.0 80-84 36.05325 38.0 38.0 38.0 33.8 38.0 85-89 35.868050000000004 38.0 38.0 38.0 32.4 38.0 90-94 35.7168 38.0 38.0 38.0 32.2 38.0 95-99 35.6561 38.0 38.0 38.0 31.6 38.0 100-104 35.5015 38.0 37.6 38.0 30.6 38.0 105-109 35.4005 38.0 37.2 38.0 30.6 38.0 110-114 35.107549999999996 38.0 37.0 38.0 28.4 38.0 115-119 34.8905 38.0 36.4 38.0 27.8 38.0 120-124 34.61605 38.0 36.0 38.0 26.2 38.0 125-129 34.2208 38.0 35.4 38.0 23.4 38.0 130-134 33.81679999999999 38.0 35.0 38.0 20.6 38.0 135-139 33.28705 38.0 34.2 38.0 14.6 38.0 140-144 32.50055 38.0 33.2 38.0 13.2 38.0 145-149 31.53955 38.0 32.2 38.0 6.4 38.0 150-151 27.1645 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 7.0 4 8.0 5 2.0 6 2.0 7 1.0 8 4.0 9 2.0 10 0.0 11 8.0 12 1.0 13 3.0 14 5.0 15 9.0 16 11.0 17 11.0 18 8.0 19 9.0 20 8.0 21 17.0 22 15.0 23 17.0 24 13.0 25 16.0 26 27.0 27 34.0 28 35.0 29 44.0 30 48.0 31 63.0 32 87.0 33 121.0 34 148.0 35 218.0 36 571.0 37 2407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.224999999999994 21.475 11.225 23.075000000000003 2 26.231557889472366 25.331332833208304 32.13303325831458 16.30407601900475 3 19.344344344344343 28.403403403403406 32.232232232232235 20.02002002002002 4 23.823823823823822 36.06106106106106 22.17217217217217 17.942942942942945 5 22.59194395796848 38.37878408806605 23.067300475356518 15.961971478608957 6 18.375 39.675 24.224999999999998 17.724999999999998 7 18.025 19.7 41.975 20.3 8 20.275000000000002 24.075 28.599999999999998 27.05 9 21.175 25.0 30.625000000000004 23.200000000000003 10-14 23.415 29.220000000000002 26.255 21.11 15-19 22.685 28.449999999999996 28.09 20.775 20-24 22.325 28.23 28.449999999999996 20.995 25-29 22.59 28.055000000000003 28.38 20.974999999999998 30-34 22.155 28.299999999999997 28.595 20.95 35-39 23.27 28.365000000000002 27.639999999999997 20.724999999999998 40-44 22.830000000000002 28.425 28.549999999999997 20.195 45-49 23.145 28.444999999999997 28.33 20.080000000000002 50-54 22.564999999999998 27.815 28.749999999999996 20.87 55-59 22.63 28.310000000000002 28.365000000000002 20.695 60-64 22.96 28.08 28.51 20.45 65-69 22.439999999999998 27.785 28.395 21.38 70-74 23.115 27.71 28.155 21.02 75-79 22.64 27.505000000000003 28.38 21.475 80-84 23.565 27.944999999999997 27.72 20.77 85-89 22.825 27.865000000000002 28.33 20.979999999999997 90-94 23.055 28.09 27.83 21.025 95-99 22.61 29.080000000000002 28.225 20.085 100-104 22.900000000000002 28.485 28.199999999999996 20.415 105-109 22.89 27.650000000000002 28.904999999999998 20.555 110-114 23.32 28.22 28.389999999999997 20.07 115-119 24.154999999999998 28.02 27.515 20.31 120-124 23.98 28.575 27.639999999999997 19.805 125-129 23.799999999999997 27.93 28.115000000000002 20.155 130-134 23.867220748009814 27.882641566114252 27.872628047864616 20.377509638011315 135-139 24.14882414882415 27.974727974727976 27.989770846913704 19.886677029534173 140-144 24.43 28.465 27.405 19.7 145-149 24.515 28.515 26.88 20.09 150-151 24.7 28.275 27.200000000000003 19.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 5.0 25 6.0 26 5.5 27 9.0 28 15.0 29 20.0 30 25.0 31 27.5 32 26.0 33 33.5 34 57.0 35 73.5 36 80.5 37 115.5 38 148.5 39 175.5 40 201.5 41 221.5 42 270.0 43 297.0 44 278.5 45 253.5 46 251.5 47 233.5 48 212.5 49 196.0 50 167.0 51 137.5 52 104.5 53 88.5 54 71.0 55 48.0 56 36.0 57 29.0 58 18.5 59 13.5 60 10.5 61 7.5 62 4.5 63 4.0 64 3.0 65 1.5 66 2.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.1 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.135 135-139 0.28500000000000003 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16519099418163 98.0 2 0.6577283076144701 1.3 3 0.05059448520111307 0.15 4 0.07589172780166961 0.3 5 0.05059448520111307 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.55 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGCTC 10 0.006830828 145.0 9 GTTGCAG 10 0.006830828 145.0 8 >>END_MODULE Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra Read 754740 spots for SRR7172512.sra Written 754740 spots for SRR7172512.sra Read 754723 spots for SRR7172512.sra Written 754723 spots for SRR7172512.sra SRR ids: ['SRR7172512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_90rbi31c SRR7172512.sra spots: 15094477 blocks: [[1, 754723], [754724, 1509446], [1509447, 2264169], [2264170, 3018892], [3018893, 3773615], [3773616, 4528338], [4528339, 5283061], [5283062, 6037784], [6037785, 6792507], [6792508, 7547230], [7547231, 8301953], [8301954, 9056676], [9056677, 9811399], [9811400, 10566122], [10566123, 11320845], [11320846, 12075568], [12075569, 12830291], [12830292, 13585014], [13585015, 14339737], [14339738, 15094477]] SRR7172512 file size 5093322 SRR7172512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172512 SRR7172512_1.fastq SRR7172512_2.fastq Input file: SRR7172512_1.fastq Paired file: SRR7172512_2.fastq trimmed: SRR7172512-trimmed-pair1.fastq, SRR7172512-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:09:33 2025 >> started Mon Feb 10 14:09:51 2025 >> done (18.510s) 15094477 read pairs processed; of these: 29984 ( 0.20%) short read pairs filtered out after trimming by size control 73384 ( 0.49%) empty read pairs filtered out after trimming by size control 14991109 (99.32%) read pairs available; of these: 9230445 (61.57%) trimmed read pairs available after processing 5760664 (38.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 9 0.00% 21 10 0.00% 22 9 0.00% 23 9 0.00% 24 11 0.00% 25 9 0.00% 26 12 0.00% 27 10 0.00% 28 16 0.00% 29 12 0.00% 30 14 0.00% 31 14 0.00% 32 11 0.00% 33 14 0.00% 34 13 0.00% 35 23 0.00% 36 17 0.00% 37 16 0.00% 38 22 0.00% 39 25 0.00% 40 31 0.00% 41 24 0.00% 42 42 0.00% 43 33 0.00% 44 33 0.00% 45 51 0.00% 46 59 0.00% 47 45 0.00% 48 65 0.00% 49 86 0.00% 50 88 0.00% 51 107 0.00% 52 102 0.00% 53 138 0.00% 54 119 0.00% 55 162 0.00% 56 146 0.00% 57 177 0.00% 58 216 0.00% 59 232 0.00% 60 260 0.00% 61 291 0.00% 62 350 0.00% 63 416 0.00% 64 447 0.00% 65 491 0.00% 66 546 0.00% 67 652 0.00% 68 739 0.00% 69 891 0.01% 70 1002 0.01% 71 1042 0.01% 72 1200 0.01% 73 1361 0.01% 74 1491 0.01% 75 1580 0.01% 76 1772 0.01% 77 1966 0.01% 78 2179 0.01% 79 2509 0.02% 80 2699 0.02% 81 3128 0.02% 82 3528 0.02% 83 4184 0.03% 84 5592 0.04% 85 6228 0.04% 86 6617 0.04% 87 7008 0.05% 88 7421 0.05% 89 7718 0.05% 90 8431 0.06% 91 8931 0.06% 92 10157 0.07% 93 10642 0.07% 94 10869 0.07% 95 11419 0.08% 96 11610 0.08% 97 12382 0.08% 98 13044 0.09% 99 13851 0.09% 100 14514 0.10% 101 15086 0.10% 102 16878 0.11% 103 17543 0.12% 104 17778 0.12% 105 18999 0.13% 106 19767 0.13% 107 20312 0.14% 108 21401 0.14% 109 22339 0.15% 110 23188 0.15% 111 24134 0.16% 112 25687 0.17% 113 27313 0.18% 114 28404 0.19% 115 29759 0.20% 116 30830 0.21% 117 32384 0.22% 118 33904 0.23% 119 34680 0.23% 120 36983 0.25% 121 37620 0.25% 122 39165 0.26% 123 42031 0.28% 124 44252 0.30% 125 46549 0.31% 126 49012 0.33% 127 50851 0.34% 128 53879 0.36% 129 56154 0.37% 130 58978 0.39% 131 62180 0.41% 132 65847 0.44% 133 70051 0.47% 134 75052 0.50% 135 80705 0.54% 136 86946 0.58% 137 93665 0.62% 138 102019 0.68% 139 111905 0.75% 140 122021 0.81% 141 136059 0.91% 142 152400 1.02% 143 174080 1.16% 144 208970 1.39% 145 256448 1.71% 146 327278 2.18% 147 429613 2.87% 148 612808 4.09% 149 1086349 7.25% 150 3796782 25.33% 151 5760664 38.43% 14991109 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=12 prefix-density=0.47 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=292.25 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=53.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7172512 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:11:54 Started mapping on | Feb 10 14:11:55 Finished on | Feb 10 14:13:26 Mapping speed, Million of reads per hour | 593.05 Number of input reads | 14991109 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13090457 Uniquely mapped reads % | 87.32% Average mapped length | 287.37 Number of splices: Total | 12527516 Number of splices: Annotated (sjdb) | 12214119 Number of splices: GT/AG | 12279657 Number of splices: GC/AG | 196021 Number of splices: AT/AC | 7390 Number of splices: Non-canonical | 44448 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 374317 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 31061 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.91% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1554395 1554395 1554395 N_multimapping 374317 374317 374317 N_noFeature 574194 12847714 691089 N_ambiguous 282107 2489 154272 UnstrandedReadsAssigned:12234156 PositiveStrandReadsAssigned:240254 NegativeStrandReadsAssigned:12245096 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7172512 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172512-trimmed-pair1.fastq SRR7172512-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,991,109 reads, 13,178,882 reads pseudoaligned [quant] estimated average fragment length: 247.903 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7172512.ke.tsv 34699 SRR7172512.se.tsv 87100 total ==> SRR7172512.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.1 710 29.2668 Potri.005G024800.1.v4.1 1035 788.097 304 28.1613 Potri.004G059700.1.v4.1 961 714.259 3 0.306637 Potri.007G009000.2.v4.1 1416 1169.1 0 0 Potri.003G141000.2.v4.1 2943 2696.1 571.688 15.4804 Potri.016G087400.1.v4.1 270 85.3224 556.255 475.96 Potri.015G069301.1.v4.1 564 327.647 0 0 Potri.010G195200.1.v4.1 1773 1526.1 20 0.95677 Potri.012G127500.1.v4.1 977 730.212 151 15.0969 ==> SRR7172512.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 681 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7172512 completed mapping pipeline successfully