Starting /dee2/code/volunteer_pipeline.sh SRR7172513 current disk space = 3058957664256 free memory = 1285546108 SRR7172513 SRAfilesize d9a36c34cdc625a8c63e88bd0d401952 SRR7172513.sra SRR7172513.sra file validated SRR7172513 is paired end SRR7172513 is conventional basespace SRR7172513 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41375 34.0 33.0 34.0 32.0 34.0 2 33.285 34.0 33.0 34.0 33.0 34.0 3 33.41025 34.0 34.0 34.0 33.0 34.0 4 33.50625 34.0 34.0 34.0 33.0 34.0 5 33.47375 34.0 34.0 34.0 33.0 34.0 6 37.263 38.0 38.0 38.0 36.0 38.0 7 37.44175 38.0 38.0 38.0 37.0 38.0 8 37.575 38.0 38.0 38.0 38.0 38.0 9 37.53925 38.0 38.0 38.0 38.0 38.0 10-14 37.52290000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.529849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.54795 38.0 38.0 38.0 38.0 38.0 25-29 37.451350000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.44395000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.3529 38.0 38.0 38.0 37.0 38.0 40-44 37.12864999999999 38.0 38.0 38.0 36.0 38.0 45-49 37.0523 38.0 38.0 38.0 36.0 38.0 50-54 36.9799 38.0 38.0 38.0 36.0 38.0 55-59 36.832950000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.85245 38.0 38.0 38.0 35.8 38.0 65-69 36.71805 38.0 38.0 38.0 35.0 38.0 70-74 36.5355 38.0 38.0 38.0 34.2 38.0 75-79 36.41805 38.0 38.0 38.0 34.0 38.0 80-84 36.19375 38.0 37.6 38.0 33.2 38.0 85-89 36.20385 38.0 38.0 38.0 33.6 38.0 90-94 36.084399999999995 38.0 37.4 38.0 33.2 38.0 95-99 35.964299999999994 38.0 37.0 38.0 33.0 38.0 100-104 35.73015 38.0 37.0 38.0 32.0 38.0 105-109 35.412349999999996 38.0 36.6 38.0 29.4 38.0 110-114 35.11965 38.0 36.0 38.0 28.2 38.0 115-119 35.036 38.0 36.0 38.0 27.8 38.0 120-124 34.88975000000001 38.0 35.4 38.0 28.0 38.0 125-129 34.567949999999996 38.0 35.0 38.0 26.4 38.0 130-134 33.98695 38.0 34.4 38.0 22.2 38.0 135-139 33.310649999999995 38.0 33.8 38.0 18.6 38.0 140-144 32.6575 38.0 33.2 38.0 14.2 38.0 145-149 31.22185 37.4 30.8 38.0 8.2 38.0 150-151 26.238 33.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 2.0 11 1.0 12 3.0 13 1.0 14 2.0 15 4.0 16 3.0 17 5.0 18 9.0 19 4.0 20 3.0 21 5.0 22 15.0 23 9.0 24 12.0 25 16.0 26 21.0 27 30.0 28 33.0 29 45.0 30 68.0 31 84.0 32 97.0 33 136.0 34 197.0 35 363.0 36 828.0 37 2000.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.93638479441427 13.964313421256788 8.973364365140936 39.125937419188 2 21.125 19.175 37.275000000000006 22.425 3 19.375 23.849999999999998 26.974999999999998 29.799999999999997 4 23.200000000000003 32.375 21.65 22.775000000000002 5 21.85 35.6 24.474999999999998 18.075 6 18.425 36.199999999999996 26.025 19.35 7 13.700000000000001 23.025000000000002 44.175 19.1 8 16.650000000000002 22.75 32.875 27.725 9 18.025 22.75 34.275 24.95 10-14 20.169999999999998 29.4 26.85 23.580000000000002 15-19 20.275000000000002 27.894999999999996 27.87 23.96 20-24 19.84 28.52 27.935 23.705000000000002 25-29 19.925 28.895 27.755000000000003 23.425 30-34 19.66 28.51 28.044999999999998 23.785 35-39 20.124024804960992 28.515703140628123 27.795559111822364 23.564712942588518 40-44 20.14111289031225 28.722978382706167 27.577061649319457 23.55884707766213 45-49 20.434195387924568 27.927567405332397 27.912560652293532 23.7256765544495 50-54 19.459594696022016 29.056792594445835 27.74080560420315 23.742807105328996 55-59 19.82974461692539 28.607911867801704 27.230846269404108 24.331497245868803 60-64 19.866786858974358 28.51061698717949 28.195112179487182 23.427483974358974 65-69 20.075112669003506 27.84176264396595 28.03204807210816 24.051076614922383 70-74 20.27054108216433 28.67234468937876 27.710420841683366 23.34669338677355 75-79 19.658248145921025 28.948687111645622 27.97153738224093 23.421527360192425 80-84 20.283467721740873 28.476987028597183 27.645615265187562 23.593929984474382 85-89 20.657018378486654 28.409034002704193 27.117031398667933 23.81691622014122 90-94 20.252403846153847 28.074919871794872 27.814503205128204 23.858173076923077 95-99 20.307415010263856 28.468432383718017 27.807540179241975 23.416612426776148 100-104 20.236425566018834 28.912041675015026 27.198958124624323 23.652574634341818 105-109 20.619486768243785 28.343023255813954 27.551122694466716 23.48636728147554 110-114 20.504083780127274 28.8921180538157 27.143358220173376 23.46043994588365 115-119 20.694493160294634 28.801924136894325 27.043142756927395 23.46043994588365 120-124 20.9 28.465 27.595 23.04 125-129 20.47047047047047 28.023023023023026 27.74774774774775 23.75875875875876 130-134 20.762307034746318 27.83728063559109 27.500377130788955 23.90003519887364 135-139 20.744439400817065 27.86604125687194 27.992131941292175 23.39738740101881 140-144 20.859880600010033 27.93859429087443 26.940249836953793 24.261275272161743 145-149 21.054210842168434 28.395679135827166 26.830366073214645 23.71974394878976 150-151 21.6875 28.349999999999998 26.387500000000003 23.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 1.5 19 2.5 20 1.0 21 1.0 22 3.0 23 3.0 24 3.0 25 5.0 26 5.5 27 8.0 28 12.0 29 15.0 30 18.0 31 26.0 32 37.5 33 47.5 34 56.0 35 78.5 36 105.0 37 113.5 38 128.5 39 162.5 40 191.5 41 200.5 42 218.0 43 251.5 44 257.5 45 260.5 46 282.0 47 274.0 48 238.0 49 196.0 50 160.5 51 127.0 52 108.5 53 88.0 54 68.0 55 60.5 56 48.0 57 39.5 58 30.0 59 21.0 60 14.0 61 10.0 62 6.5 63 5.5 64 3.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.08 45-49 0.045 50-54 0.075 55-59 0.15 60-64 0.16 65-69 0.15 70-74 0.2 75-79 0.22 80-84 0.165 85-89 0.155 90-94 0.16 95-99 0.135 100-104 0.18 105-109 0.24 110-114 0.215 115-119 0.215 120-124 0.0 125-129 0.1 130-134 0.565 135-139 0.865 140-144 0.335 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.574999999999999 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGCC 10 0.00693757 144.25 6 >>END_MODULE SRR7172513 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172513_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.738 33.0 33.0 34.0 32.0 34.0 2 32.838 34.0 33.0 34.0 32.0 34.0 3 32.82525 34.0 33.0 34.0 32.0 34.0 4 32.7675 34.0 33.0 34.0 32.0 34.0 5 32.7545 34.0 33.0 34.0 32.0 34.0 6 36.96275 38.0 38.0 38.0 36.0 38.0 7 36.973 38.0 38.0 38.0 37.0 38.0 8 36.94275 38.0 38.0 38.0 36.0 38.0 9 36.81 38.0 38.0 38.0 36.0 38.0 10-14 36.93685000000001 38.0 38.0 38.0 36.6 38.0 15-19 36.87525 38.0 38.0 38.0 36.0 38.0 20-24 36.851150000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.91605 38.0 38.0 38.0 36.6 38.0 30-34 36.8508 38.0 38.0 38.0 36.2 38.0 35-39 36.744550000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.700450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.6971 38.0 38.0 38.0 36.0 38.0 50-54 36.630250000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.631600000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.545899999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.39205 38.0 38.0 38.0 35.0 38.0 70-74 36.33295 38.0 38.0 38.0 34.6 38.0 75-79 36.2387 38.0 38.0 38.0 34.0 38.0 80-84 36.09230000000001 38.0 38.0 38.0 34.0 38.0 85-89 35.94414999999999 38.0 38.0 38.0 33.2 38.0 90-94 35.741699999999994 38.0 38.0 38.0 32.6 38.0 95-99 35.60455 38.0 37.8 38.0 31.8 38.0 100-104 35.49305 38.0 37.4 38.0 31.4 38.0 105-109 35.37105 38.0 37.0 38.0 31.0 38.0 110-114 35.220499999999994 38.0 37.0 38.0 29.4 38.0 115-119 34.932 38.0 36.4 38.0 28.0 38.0 120-124 34.69165 38.0 36.2 38.0 26.6 38.0 125-129 34.3612 38.0 35.6 38.0 24.2 38.0 130-134 33.9376 38.0 35.0 38.0 22.6 38.0 135-139 33.418350000000004 38.0 34.2 38.0 17.8 38.0 140-144 32.6171 38.0 33.2 38.0 13.6 38.0 145-149 31.591049999999996 38.0 32.0 38.0 8.6 38.0 150-151 27.199125000000002 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 4.0 5 2.0 6 3.0 7 5.0 8 5.0 9 1.0 10 4.0 11 3.0 12 3.0 13 8.0 14 8.0 15 4.0 16 5.0 17 11.0 18 2.0 19 8.0 20 14.0 21 8.0 22 13.0 23 22.0 24 19.0 25 16.0 26 28.0 27 30.0 28 32.0 29 51.0 30 45.0 31 55.0 32 75.0 33 122.0 34 153.0 35 254.0 36 606.0 37 2361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.825 21.325 12.625 29.225 2 25.268951713785338 26.1195896922692 33.55016262196647 15.061295971978982 3 18.823529411764707 27.934918648310386 32.090112640801 21.151439299123904 4 22.478097622027533 36.395494367959955 23.178973717146434 17.94743429286608 5 23.773773773773772 38.213213213213216 22.44744744744745 15.565565565565564 6 18.675 39.574999999999996 24.0 17.75 7 19.275000000000002 18.2 42.425000000000004 20.1 8 20.65 23.775 28.849999999999998 26.724999999999998 9 21.8 25.174999999999997 30.675 22.35 10-14 23.13 28.810000000000002 26.650000000000002 21.41 15-19 22.82 27.685 28.675 20.82 20-24 23.055 28.18 28.050000000000004 20.715 25-29 22.564999999999998 28.720000000000002 28.09 20.625 30-34 22.575 28.03 28.794999999999998 20.599999999999998 35-39 22.58 27.905 27.839999999999996 21.675 40-44 22.605 28.67 27.735 20.990000000000002 45-49 23.735 27.12 28.215 20.93 50-54 22.689999999999998 27.725 28.389999999999997 21.195 55-59 22.795 27.185 28.9 21.12 60-64 22.900000000000002 28.335 28.16 20.605 65-69 22.32 27.779999999999998 28.475 21.425 70-74 23.025000000000002 27.339999999999996 28.444999999999997 21.19 75-79 23.365 27.79 28.27 20.575 80-84 22.71 27.955000000000002 28.265 21.07 85-89 23.400000000000002 28.17 27.224999999999998 21.205 90-94 23.395 28.555000000000003 27.339999999999996 20.71 95-99 22.93 28.360000000000003 27.889999999999997 20.82 100-104 23.11 28.15 27.860000000000003 20.880000000000003 105-109 23.34 27.689999999999998 28.294999999999998 20.674999999999997 110-114 23.015 28.994999999999997 27.965 20.025000000000002 115-119 23.555 26.834999999999997 28.715000000000003 20.895 120-124 23.77 27.98 28.015 20.235 125-129 23.97 28.04 27.584999999999997 20.405 130-134 24.084084084084083 27.3973973973974 27.97797797797798 20.54054054054054 135-139 23.593648249261136 27.711265841807343 28.167109151931076 20.527976757000452 140-144 24.154999999999998 27.805000000000003 27.76 20.28 145-149 24.545 28.189999999999998 27.250000000000004 20.015 150-151 25.2875 28.225 26.937499999999996 19.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 2.0 23 2.0 24 4.5 25 7.0 26 9.5 27 10.5 28 13.0 29 18.0 30 20.0 31 25.5 32 36.0 33 46.0 34 61.0 35 67.0 36 81.0 37 110.5 38 143.5 39 176.5 40 183.5 41 203.5 42 244.0 43 273.5 44 278.5 45 261.0 46 257.5 47 246.0 48 217.5 49 193.5 50 162.5 51 126.0 52 101.0 53 88.0 54 75.0 55 58.5 56 47.0 57 41.5 58 29.0 59 17.5 60 15.0 61 10.5 62 8.5 63 8.0 64 4.5 65 4.0 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.125 4 0.125 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.1 135-139 0.185 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26749179085628 98.25 2 0.5304369790351099 1.05 3 0.1262945188178833 0.375 4 0.050517807527153326 0.2 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.2625 0.0 0.0 0.0 0.0 134-135 4.574999999999999 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699199 spots for SRR7172513.sra Written 699199 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra Read 699189 spots for SRR7172513.sra Written 699189 spots for SRR7172513.sra SRR ids: ['SRR7172513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d2v9iv6o SRR7172513.sra spots: 13983790 blocks: [[1, 699189], [699190, 1398378], [1398379, 2097567], [2097568, 2796756], [2796757, 3495945], [3495946, 4195134], [4195135, 4894323], [4894324, 5593512], [5593513, 6292701], [6292702, 6991890], [6991891, 7691079], [7691080, 8390268], [8390269, 9089457], [9089458, 9788646], [9788647, 10487835], [10487836, 11187024], [11187025, 11886213], [11886214, 12585402], [12585403, 13284591], [13284592, 13983790]] SRR7172513 file size 4716947 SRR7172513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172513 SRR7172513_1.fastq SRR7172513_2.fastq Input file: SRR7172513_1.fastq Paired file: SRR7172513_2.fastq trimmed: SRR7172513-trimmed-pair1.fastq, SRR7172513-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:18:53 2025 >> started Mon Feb 10 14:19:09 2025 >> done (15.333s) 13983790 read pairs processed; of these: 20257 ( 0.14%) short read pairs filtered out after trimming by size control 84709 ( 0.61%) empty read pairs filtered out after trimming by size control 13878824 (99.25%) read pairs available; of these: 7223682 (52.05%) trimmed read pairs available after processing 6655142 (47.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 10 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 7 0.00% 26 9 0.00% 27 14 0.00% 28 8 0.00% 29 12 0.00% 30 10 0.00% 31 13 0.00% 32 17 0.00% 33 10 0.00% 34 12 0.00% 35 5 0.00% 36 17 0.00% 37 12 0.00% 38 20 0.00% 39 26 0.00% 40 18 0.00% 41 28 0.00% 42 25 0.00% 43 24 0.00% 44 23 0.00% 45 28 0.00% 46 49 0.00% 47 39 0.00% 48 58 0.00% 49 66 0.00% 50 77 0.00% 51 64 0.00% 52 102 0.00% 53 92 0.00% 54 109 0.00% 55 101 0.00% 56 133 0.00% 57 127 0.00% 58 163 0.00% 59 194 0.00% 60 213 0.00% 61 248 0.00% 62 281 0.00% 63 310 0.00% 64 349 0.00% 65 400 0.00% 66 467 0.00% 67 508 0.00% 68 577 0.00% 69 710 0.01% 70 722 0.01% 71 776 0.01% 72 858 0.01% 73 984 0.01% 74 1101 0.01% 75 1235 0.01% 76 1386 0.01% 77 1547 0.01% 78 1743 0.01% 79 1907 0.01% 80 2194 0.02% 81 2421 0.02% 82 2835 0.02% 83 3228 0.02% 84 4120 0.03% 85 4801 0.03% 86 5092 0.04% 87 5467 0.04% 88 5889 0.04% 89 6242 0.04% 90 6667 0.05% 91 7124 0.05% 92 8284 0.06% 93 8595 0.06% 94 8657 0.06% 95 9423 0.07% 96 9444 0.07% 97 9977 0.07% 98 10541 0.08% 99 11098 0.08% 100 11756 0.08% 101 12530 0.09% 102 13477 0.10% 103 14222 0.10% 104 14776 0.11% 105 15592 0.11% 106 16089 0.12% 107 16718 0.12% 108 17169 0.12% 109 18256 0.13% 110 18751 0.14% 111 19530 0.14% 112 20968 0.15% 113 22028 0.16% 114 23105 0.17% 115 24314 0.18% 116 25330 0.18% 117 26423 0.19% 118 27346 0.20% 119 28113 0.20% 120 29126 0.21% 121 30326 0.22% 122 31457 0.23% 123 33979 0.24% 124 35452 0.26% 125 36627 0.26% 126 38531 0.28% 127 39854 0.29% 128 41782 0.30% 129 43681 0.31% 130 45083 0.32% 131 47305 0.34% 132 49983 0.36% 133 52743 0.38% 134 55498 0.40% 135 59563 0.43% 136 63294 0.46% 137 67026 0.48% 138 72379 0.52% 139 77045 0.56% 140 83850 0.60% 141 91927 0.66% 142 100949 0.73% 143 114200 0.82% 144 133400 0.96% 145 161526 1.16% 146 202715 1.46% 147 270140 1.95% 148 401105 2.89% 149 772774 5.57% 150 3403700 24.52% 151 6655142 47.95% 13878824 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=19.68 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.6 sequence=TCAAGCTCACGGTTCTTGGCAAA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=165.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.2 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR7172513 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:19:55 Started mapping on | Feb 10 14:19:55 Finished on | Feb 10 14:21:37 Mapping speed, Million of reads per hour | 489.84 Number of input reads | 13878824 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12964755 Uniquely mapped reads % | 93.41% Average mapped length | 293.17 Number of splices: Total | 12193522 Number of splices: Annotated (sjdb) | 11902843 Number of splices: GT/AG | 11953723 Number of splices: GC/AG | 196376 Number of splices: AT/AC | 6845 Number of splices: Non-canonical | 36578 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360948 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 60795 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568615 568615 568615 N_multimapping 360948 360948 360948 N_noFeature 573989 12757050 679505 N_ambiguous 200621 1049 97702 UnstrandedReadsAssigned:12190145 PositiveStrandReadsAssigned:206656 NegativeStrandReadsAssigned:12187548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172513 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172513-trimmed-pair1.fastq SRR7172513-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,878,824 reads, 12,235,121 reads pseudoaligned [quant] estimated average fragment length: 251.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 955 rounds 52401 SRR7172513.ke.tsv 34699 SRR7172513.se.tsv 87100 total ==> SRR7172513.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.15 618 29.4389 Potri.005G024800.1.v4.1 1035 784.148 148 15.888 Potri.004G059700.1.v4.1 961 710.287 6 0.711087 Potri.007G009000.2.v4.1 1416 1165.15 0 0 Potri.003G141000.2.v4.1 2943 2692.15 380 11.882 Potri.016G087400.1.v4.1 270 81.4042 491 507.739 Potri.015G069301.1.v4.1 564 322.374 0 0 Potri.010G195200.1.v4.1 1773 1522.15 63 3.48409 Potri.012G127500.1.v4.1 977 726.202 144 16.6921 ==> SRR7172513.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 673 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 92 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7172513 completed mapping pipeline successfully