Starting /dee2/code/volunteer_pipeline.sh SRR7172514 current disk space = 3058895450112 free memory = 1408823272 SRR7172514 SRAfilesize 5cef313f5a98adf9d052fc14c0a6a69c SRR7172514.sra SRR7172514.sra file validated SRR7172514 is paired end SRR7172514 is conventional basespace SRR7172514 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97175 34.0 33.0 34.0 33.0 34.0 2 33.41375 34.0 34.0 34.0 33.0 34.0 3 33.44775 34.0 34.0 34.0 33.0 34.0 4 33.46175 34.0 34.0 34.0 33.0 34.0 5 33.36 34.0 34.0 34.0 33.0 34.0 6 37.1625 38.0 38.0 38.0 36.0 38.0 7 37.47375 38.0 38.0 38.0 37.0 38.0 8 37.551 38.0 38.0 38.0 38.0 38.0 9 37.5655 38.0 38.0 38.0 38.0 38.0 10-14 37.57835 38.0 38.0 38.0 38.0 38.0 15-19 37.5637 38.0 38.0 38.0 38.0 38.0 20-24 37.5433 38.0 38.0 38.0 38.0 38.0 25-29 37.515 38.0 38.0 38.0 38.0 38.0 30-34 37.511399999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.35325 38.0 38.0 38.0 37.2 38.0 40-44 37.300850000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.1934 38.0 38.0 38.0 36.4 38.0 50-54 37.08045 38.0 38.0 38.0 36.0 38.0 55-59 37.0437 38.0 38.0 38.0 36.0 38.0 60-64 37.0266 38.0 38.0 38.0 36.0 38.0 65-69 37.0121 38.0 38.0 38.0 36.0 38.0 70-74 36.877050000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.694250000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.5966 38.0 38.0 38.0 34.6 38.0 85-89 36.61065 38.0 38.0 38.0 34.4 38.0 90-94 36.46195 38.0 38.0 38.0 34.2 38.0 95-99 36.3625 38.0 38.0 38.0 34.0 38.0 100-104 36.1712 38.0 37.6 38.0 33.4 38.0 105-109 35.995799999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.67705 38.0 37.0 38.0 31.2 38.0 115-119 35.606 38.0 36.8 38.0 31.0 38.0 120-124 35.5058 38.0 36.4 38.0 30.2 38.0 125-129 35.1396 38.0 35.8 38.0 28.4 38.0 130-134 34.7395 38.0 35.2 38.0 27.6 38.0 135-139 34.306200000000004 38.0 35.0 38.0 24.6 38.0 140-144 33.8104 38.0 34.6 38.0 22.6 38.0 145-149 32.81994999999999 38.0 33.2 38.0 15.4 38.0 150-151 28.409125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 4.0 10 2.0 11 0.0 12 3.0 13 0.0 14 2.0 15 1.0 16 1.0 17 1.0 18 4.0 19 8.0 20 6.0 21 10.0 22 4.0 23 8.0 24 7.0 25 12.0 26 8.0 27 16.0 28 28.0 29 45.0 30 49.0 31 62.0 32 85.0 33 115.0 34 188.0 35 292.0 36 665.0 37 2374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.21166032953106 14.423320659062103 9.91128010139417 38.453738910012675 2 21.099999999999998 19.05 35.55 24.3 3 19.2 26.325 25.474999999999998 28.999999999999996 4 21.7 34.575 22.625 21.099999999999998 5 20.67151089952393 35.83061889250814 24.580305687797544 18.917564520170384 6 17.299999999999997 34.775 27.0 20.925 7 13.65 21.275 45.824999999999996 19.25 8 18.0 23.1 31.374999999999996 27.525 9 17.9 23.05 33.175 25.874999999999996 10-14 20.424999999999997 28.205000000000002 27.515 23.855 15-19 19.835 28.125 27.97 24.07 20-24 20.055 28.139999999999997 28.275 23.53 25-29 19.77 28.439999999999998 27.855 23.935000000000002 30-34 19.82 28.82 27.705000000000002 23.655 35-39 20.264184929450614 28.19973981787251 28.074652256579608 23.461422996097266 40-44 19.860853896591422 28.29971470043546 27.969367836228038 23.87006356674508 45-49 19.75673240564621 28.756632295525076 27.720492541795977 23.766142757032735 50-54 20.18316484836353 28.08527674907417 28.34551095986388 23.38604744269843 55-59 19.96993987975952 28.45190380761523 28.186372745490985 23.39178356713427 60-64 20.019041892162758 29.028863499699337 27.505512126678695 23.44658248145921 65-69 20.792624881006063 27.99238438799539 27.38614159026003 23.828849140738516 70-74 20.305764411027567 28.26065162907268 27.81453634085213 23.61904761904762 75-79 20.680497093605933 27.93144918821407 27.515534175185408 23.87251954299459 80-84 19.99899804619007 28.570712890135763 27.403436701568058 24.02685236210611 85-89 20.219372933987778 28.46839627366523 27.877391565661625 23.434839226685362 90-94 19.955931694125894 28.30387100005008 28.088537232710703 23.651660073113327 95-99 20.759252767065657 28.567135774027147 27.695697901537535 22.977913557369657 100-104 20.971058835331295 28.55996388624166 27.56181973215629 22.907157546270753 105-109 20.816837885241792 28.173390127787524 27.97795038837384 23.031821598596842 110-114 20.564920730483642 28.66245233794903 27.518563114589607 23.254063816977723 115-119 20.697255059106393 28.701662993388098 27.03366058906031 23.567421358445202 120-124 20.885 27.725 27.529999999999998 23.86 125-129 21.21 28.599999999999998 26.86 23.330000000000002 130-134 20.62606773188624 28.28358958898603 27.821324490001004 23.269018189126722 135-139 20.86667673259852 28.078916905732548 27.308873118928982 23.745533242739945 140-144 20.73298953587343 28.102938967606267 27.69739147849597 23.466680018024334 145-149 20.905 28.599999999999998 26.88 23.615 150-151 21.1875 28.175 27.737499999999997 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 2.5 17 1.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 2.5 25 2.5 26 5.0 27 10.0 28 13.5 29 15.0 30 19.0 31 24.5 32 36.0 33 47.5 34 57.0 35 79.0 36 99.5 37 107.0 38 127.5 39 157.5 40 188.5 41 232.0 42 256.0 43 259.5 44 258.0 45 262.0 46 261.0 47 239.5 48 216.0 49 186.0 50 162.5 51 141.0 52 111.0 53 95.5 54 81.0 55 60.0 56 47.0 57 37.5 58 25.5 59 18.5 60 15.0 61 11.5 62 9.0 63 4.5 64 2.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06999999999999999 40-44 0.105 45-49 0.11 50-54 0.09 55-59 0.2 60-64 0.22 65-69 0.20500000000000002 70-74 0.25 75-79 0.22 80-84 0.19499999999999998 85-89 0.16999999999999998 90-94 0.155 95-99 0.165 100-104 0.315 105-109 0.22499999999999998 110-114 0.33999999999999997 115-119 0.18 120-124 0.0 125-129 0.0 130-134 0.49 135-139 0.655 140-144 0.135 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.0625 0.0 0.0 0.025 0.0 66-67 0.1 0.0 0.0 0.025 0.0 68-69 0.1 0.0 0.0 0.025 0.0 70-71 0.1125 0.0 0.0 0.025 0.0 72-73 0.125 0.0 0.0 0.025 0.0 74-75 0.125 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.15 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.15 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.4625 0.0 0.0 0.025 0.0 92-93 0.625 0.0 0.0 0.025 0.0 94-95 0.7625 0.0 0.0 0.025 0.0 96-97 0.8999999999999999 0.0 0.0 0.025 0.0 98-99 1.025 0.0 0.0 0.025 0.0 100-101 1.1875 0.0 0.0 0.025 0.0 102-103 1.3 0.0 0.0 0.025 0.0 104-105 1.4375 0.0 0.0 0.025 0.0 106-107 1.6124999999999998 0.0 0.0 0.025 0.0 108-109 1.8125 0.0 0.0 0.025 0.0 110-111 2.0250000000000004 0.0 0.0 0.025 0.0 112-113 2.2375 0.0 0.0 0.025 0.0 114-115 2.5374999999999996 0.0 0.0 0.025 0.0 116-117 2.925 0.0 0.0 0.025 0.0 118-119 3.375 0.0 0.0 0.025 0.0 120-121 3.7625 0.0 0.0 0.025 0.0 122-123 4.05 0.0 0.0 0.025 0.0 124-125 4.3 0.0 0.0 0.025 0.0 126-127 4.637499999999999 0.0 0.0 0.025 0.0 128-129 5.05 0.0 0.0 0.025 0.0 130-131 5.525 0.0 0.0 0.025 0.0 132-133 6.0 0.0 0.0 0.025 0.0 134-135 6.6 0.0 0.0 0.025 0.0 136-137 7.074999999999999 0.0 0.0 0.025 0.0 138-139 7.5125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTTT 10 0.0069808904 143.95 4 GCTTTTC 10 0.0069808904 143.95 5 >>END_MODULE SRR7172514 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172514_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57575 33.0 33.0 34.0 32.0 34.0 2 32.70175 33.0 33.0 34.0 32.0 34.0 3 32.65325 34.0 33.0 34.0 32.0 34.0 4 32.65275 34.0 33.0 34.0 32.0 34.0 5 32.60525 34.0 33.0 34.0 32.0 34.0 6 36.69025 38.0 38.0 38.0 36.0 38.0 7 36.85175 38.0 38.0 38.0 36.0 38.0 8 36.7745 38.0 38.0 38.0 36.0 38.0 9 36.80475 38.0 38.0 38.0 36.0 38.0 10-14 36.8418 38.0 38.0 38.0 36.4 38.0 15-19 36.8618 38.0 38.0 38.0 36.4 38.0 20-24 36.84275 38.0 38.0 38.0 36.6 38.0 25-29 36.822500000000005 38.0 38.0 38.0 36.6 38.0 30-34 36.7863 38.0 38.0 38.0 36.6 38.0 35-39 36.70145 38.0 38.0 38.0 36.0 38.0 40-44 36.7021 38.0 38.0 38.0 36.0 38.0 45-49 36.7166 38.0 38.0 38.0 36.0 38.0 50-54 36.676750000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.67335 38.0 38.0 38.0 36.0 38.0 60-64 36.562400000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.5395 38.0 38.0 38.0 35.6 38.0 70-74 36.43435 38.0 38.0 38.0 35.0 38.0 75-79 36.371300000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.2846 38.0 38.0 38.0 34.4 38.0 85-89 36.10015 38.0 38.0 38.0 34.0 38.0 90-94 35.97625 38.0 38.0 38.0 33.6 38.0 95-99 35.78360000000001 38.0 38.0 38.0 32.6 38.0 100-104 35.77329999999999 38.0 38.0 38.0 33.0 38.0 105-109 35.543600000000005 38.0 37.6 38.0 31.4 38.0 110-114 35.30975 38.0 37.0 38.0 30.2 38.0 115-119 35.13265 38.0 37.0 38.0 28.6 38.0 120-124 34.84825 38.0 36.2 38.0 27.4 38.0 125-129 34.591499999999996 38.0 35.8 38.0 25.8 38.0 130-134 34.15045 38.0 35.2 38.0 23.4 38.0 135-139 33.496500000000005 38.0 33.8 38.0 17.4 38.0 140-144 32.92915000000001 38.0 33.2 38.0 13.8 38.0 145-149 31.95365 38.0 32.6 38.0 8.6 38.0 150-151 26.98825 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 4.0 4 1.0 5 3.0 6 1.0 7 4.0 8 0.0 9 1.0 10 2.0 11 4.0 12 4.0 13 4.0 14 5.0 15 3.0 16 5.0 17 7.0 18 5.0 19 5.0 20 8.0 21 5.0 22 13.0 23 10.0 24 16.0 25 20.0 26 26.0 27 35.0 28 33.0 29 49.0 30 47.0 31 62.0 32 91.0 33 111.0 34 156.0 35 218.0 36 573.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.040201005025125 19.42211055276382 12.462311557788945 30.075376884422113 2 26.20724346076459 26.03118712273642 32.99798792756539 14.763581488933603 3 20.20125786163522 27.899371069182386 31.572327044025155 20.32704402515723 4 23.055625471935564 35.86710294487793 22.954945884721873 18.122325698464635 5 21.5706015605336 38.560281902844196 22.904606091115028 16.964510445507173 6 18.001007049345418 38.5448136958711 25.226586102719033 18.22759315206445 7 18.52970795568983 18.328298086606242 42.14501510574018 20.996978851963746 8 19.71299093655589 24.269889224572 30.060422960725074 25.956696878147028 9 22.054380664652566 24.093655589123866 28.902316213494462 24.949647532729106 10-14 23.40382678751259 28.54984894259819 26.691842900302117 21.354481369587113 15-19 22.824773413897283 28.192346424974822 28.016112789526687 20.966767371601208 20-24 22.70392749244713 28.167170191339373 27.875125881168177 21.253776435045317 25-29 22.20543806646526 28.09667673716012 28.444108761329307 21.253776435045317 30-34 22.081256607763176 28.550571414187182 28.51533001057242 20.85284196747722 35-39 22.616050750176218 27.832041083475982 28.3959319303192 21.155976236028597 40-44 22.94058408862034 27.567975830815712 28.479355488418932 21.012084592145015 45-49 22.04431017119839 28.041289023162136 28.34340382678751 21.570996978851966 50-54 22.371601208459214 28.308157099697883 28.293051359516618 21.027190332326285 55-59 22.774420946626385 27.603222557905337 28.444108761329307 21.17824773413897 60-64 22.813554201701827 28.039877146165853 28.11036705100448 21.03620160112784 65-69 22.69889224572004 27.744209466263847 28.650553877139977 20.90634441087613 70-74 22.97583081570997 27.16515609264854 28.413897280966765 21.44511581067472 75-79 22.744209466263847 27.134944612286 28.6908358509567 21.430010070493456 80-84 23.27291037260826 28.066465256797585 27.920443101711985 20.740181268882175 85-89 22.93554884189325 27.985901309164152 27.99093655589124 21.087613293051362 90-94 22.799597180261834 27.779456193353475 27.80966767371601 21.61127895266868 95-99 23.569989929506548 27.663645518630414 28.036253776435043 20.730110775427995 100-104 23.318227593152063 28.700906344410875 27.30614300100705 20.674723061430008 105-109 23.53474320241692 28.303121852970797 27.729103726082577 20.433031218529706 110-114 23.962739174219536 27.759315206445116 27.935548841893254 20.342396777442097 115-119 23.93756294058409 28.22759315206445 27.603222557905337 20.231621349446122 120-124 24.370594159113796 28.26283987915408 27.764350453172206 19.60221550855992 125-129 24.355488418932527 28.172205438066467 27.43705941591138 20.03524672708963 130-134 24.952169972812406 27.771624207028495 27.529956701238547 19.746249118920552 135-139 24.62491189205518 27.630651495317693 27.93273587755513 19.811700735071998 140-144 24.86908358509567 28.157099697885197 27.61832829808661 19.355488418932527 145-149 24.99496475327291 28.26283987915408 27.280966767371602 19.461228600201412 150-151 24.899295065458208 28.02114803625378 27.316213494461227 19.763343403826788 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 23.0 1 13.5 2 2.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 3.0 24 2.0 25 1.0 26 5.0 27 7.5 28 10.0 29 16.0 30 19.5 31 27.0 32 34.5 33 41.0 34 51.0 35 74.5 36 98.5 37 117.5 38 148.5 39 171.5 40 199.0 41 228.5 42 236.0 43 246.0 44 269.5 45 263.5 46 242.5 47 220.0 48 192.0 49 189.0 50 172.5 51 136.5 52 110.0 53 99.0 54 88.5 55 70.0 56 47.0 57 33.0 58 29.0 59 21.0 60 13.0 61 7.5 62 6.5 63 3.5 64 3.5 65 4.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.6 3 0.625 4 0.675 5 0.675 6 0.7000000000000001 7 0.7000000000000001 8 0.7000000000000001 9 0.7000000000000001 10-14 0.7000000000000001 15-19 0.7000000000000001 20-24 0.7000000000000001 25-29 0.7000000000000001 30-34 0.685 35-39 0.69 40-44 0.7000000000000001 45-49 0.7000000000000001 50-54 0.7000000000000001 55-59 0.7000000000000001 60-64 0.695 65-69 0.7000000000000001 70-74 0.7000000000000001 75-79 0.7000000000000001 80-84 0.7000000000000001 85-89 0.7000000000000001 90-94 0.7000000000000001 95-99 0.7000000000000001 100-104 0.7000000000000001 105-109 0.7000000000000001 110-114 0.7000000000000001 115-119 0.7000000000000001 120-124 0.7000000000000001 125-129 0.7000000000000001 130-134 0.69 135-139 0.69 140-144 0.7000000000000001 145-149 0.7000000000000001 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1637100861632 97.82499999999999 2 0.7602635580334516 1.5 3 0.025342118601115054 0.075 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 4.95 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.8625 0.0 0.0 0.0 0.0 134-135 6.425000000000001 0.0 0.0 0.0 0.0 136-137 6.925 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709955 spots for SRR7172514.sra Written 709955 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra Read 709937 spots for SRR7172514.sra Written 709937 spots for SRR7172514.sra SRR ids: ['SRR7172514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ouq3lqx_ SRR7172514.sra spots: 14198758 blocks: [[1, 709937], [709938, 1419874], [1419875, 2129811], [2129812, 2839748], [2839749, 3549685], [3549686, 4259622], [4259623, 4969559], [4969560, 5679496], [5679497, 6389433], [6389434, 7099370], [7099371, 7809307], [7809308, 8519244], [8519245, 9229181], [9229182, 9939118], [9939119, 10649055], [10649056, 11358992], [11358993, 12068929], [12068930, 12778866], [12778867, 13488803], [13488804, 14198758]] SRR7172514 file size 4789792 SRR7172514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172514 SRR7172514_1.fastq SRR7172514_2.fastq Input file: SRR7172514_1.fastq Paired file: SRR7172514_2.fastq trimmed: SRR7172514-trimmed-pair1.fastq, SRR7172514-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:28:00 2025 >> started Mon Feb 10 14:28:16 2025 >> done (15.956s) 14198758 read pairs processed; of these: 22230 ( 0.16%) short read pairs filtered out after trimming by size control 66056 ( 0.47%) empty read pairs filtered out after trimming by size control 14110472 (99.38%) read pairs available; of these: 7094377 (50.28%) trimmed read pairs available after processing 7016095 (49.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 2 0.00% 21 11 0.00% 22 7 0.00% 23 11 0.00% 24 6 0.00% 25 10 0.00% 26 6 0.00% 27 20 0.00% 28 7 0.00% 29 10 0.00% 30 14 0.00% 31 9 0.00% 32 11 0.00% 33 8 0.00% 34 18 0.00% 35 11 0.00% 36 15 0.00% 37 28 0.00% 38 21 0.00% 39 30 0.00% 40 32 0.00% 41 23 0.00% 42 36 0.00% 43 47 0.00% 44 36 0.00% 45 103 0.00% 46 74 0.00% 47 76 0.00% 48 83 0.00% 49 68 0.00% 50 71 0.00% 51 108 0.00% 52 112 0.00% 53 128 0.00% 54 106 0.00% 55 147 0.00% 56 159 0.00% 57 185 0.00% 58 222 0.00% 59 225 0.00% 60 259 0.00% 61 360 0.00% 62 361 0.00% 63 392 0.00% 64 459 0.00% 65 524 0.00% 66 576 0.00% 67 677 0.00% 68 776 0.01% 69 1138 0.01% 70 1187 0.01% 71 1070 0.01% 72 1225 0.01% 73 1380 0.01% 74 1569 0.01% 75 1646 0.01% 76 1829 0.01% 77 2060 0.01% 78 2278 0.02% 79 2557 0.02% 80 2954 0.02% 81 3210 0.02% 82 3619 0.03% 83 4222 0.03% 84 5362 0.04% 85 5991 0.04% 86 6481 0.05% 87 6903 0.05% 88 7268 0.05% 89 7619 0.05% 90 8386 0.06% 91 9040 0.06% 92 10049 0.07% 93 10869 0.08% 94 11691 0.08% 95 11758 0.08% 96 12122 0.09% 97 12824 0.09% 98 13472 0.10% 99 14018 0.10% 100 14809 0.10% 101 15748 0.11% 102 16541 0.12% 103 17551 0.12% 104 18911 0.13% 105 19725 0.14% 106 20326 0.14% 107 21172 0.15% 108 21978 0.16% 109 22717 0.16% 110 23556 0.17% 111 24883 0.18% 112 25751 0.18% 113 27265 0.19% 114 28195 0.20% 115 29589 0.21% 116 30763 0.22% 117 31682 0.22% 118 32577 0.23% 119 33215 0.24% 120 34380 0.24% 121 36064 0.26% 122 37160 0.26% 123 39113 0.28% 124 40760 0.29% 125 41944 0.30% 126 43873 0.31% 127 45319 0.32% 128 46316 0.33% 129 47988 0.34% 130 49766 0.35% 131 51528 0.37% 132 53995 0.38% 133 56995 0.40% 134 59456 0.42% 135 62535 0.44% 136 65794 0.47% 137 69220 0.49% 138 73787 0.52% 139 77734 0.55% 140 83109 0.59% 141 89017 0.63% 142 97076 0.69% 143 108637 0.77% 144 124045 0.88% 145 145935 1.03% 146 178304 1.26% 147 236413 1.68% 148 354827 2.51% 149 701993 4.97% 150 3271855 23.19% 151 7016095 49.72% 14110472 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=10 prefix-density=0.47 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=593.57 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=20.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=33.87 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172514 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:29:05 Started mapping on | Feb 10 14:29:05 Finished on | Feb 10 14:30:48 Mapping speed, Million of reads per hour | 493.18 Number of input reads | 14110472 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13184073 Uniquely mapped reads % | 93.43% Average mapped length | 292.22 Number of splices: Total | 12374201 Number of splices: Annotated (sjdb) | 12077098 Number of splices: GT/AG | 12117521 Number of splices: GC/AG | 207971 Number of splices: AT/AC | 7170 Number of splices: Non-canonical | 41539 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368756 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 87303 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575337 575337 575337 N_multimapping 368756 368756 368756 N_noFeature 605995 12971167 712028 N_ambiguous 211238 1004 103651 UnstrandedReadsAssigned:12366840 PositiveStrandReadsAssigned:211902 NegativeStrandReadsAssigned:12368394 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172514 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172514-trimmed-pair1.fastq SRR7172514-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,110,472 reads, 12,396,780 reads pseudoaligned [quant] estimated average fragment length: 243.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7172514.ke.tsv 34699 SRR7172514.se.tsv 87100 total ==> SRR7172514.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.62 818 38.2108 Potri.005G024800.1.v4.1 1035 792.625 77 8.05763 Potri.004G059700.1.v4.1 961 718.769 12 1.38476 Potri.007G009000.2.v4.1 1416 1173.62 0 0 Potri.003G141000.2.v4.1 2943 2700.62 467.132 14.3469 Potri.016G087400.1.v4.1 270 85.8839 637 615.193 Potri.015G069301.1.v4.1 564 330.865 0 0 Potri.010G195200.1.v4.1 1773 1530.62 29 1.5715 Potri.012G127500.1.v4.1 977 734.722 134 15.1275 ==> SRR7172514.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 642 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7172514 completed mapping pipeline successfully