Starting /dee2/code/volunteer_pipeline.sh SRR7172515 current disk space = 3059029315584 free memory = 1413133780 SRR7172515 SRAfilesize f6b76ca716fc3bca2e362df9f5a29b21 SRR7172515.sra SRR7172515.sra file validated SRR7172515 is paired end SRR7172515 is conventional basespace SRR7172515 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07175 34.0 33.0 34.0 33.0 34.0 2 33.41925 34.0 34.0 34.0 33.0 34.0 3 33.425 34.0 34.0 34.0 33.0 34.0 4 33.445 34.0 34.0 34.0 33.0 34.0 5 33.43475 34.0 34.0 34.0 33.0 34.0 6 37.045 38.0 38.0 38.0 36.0 38.0 7 37.34525 38.0 38.0 38.0 37.0 38.0 8 37.427 38.0 38.0 38.0 37.0 38.0 9 37.49075 38.0 38.0 38.0 38.0 38.0 10-14 37.487049999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.47279999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.48695 38.0 38.0 38.0 37.8 38.0 25-29 37.46805 38.0 38.0 38.0 37.8 38.0 30-34 37.362649999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.3051 38.0 38.0 38.0 37.0 38.0 40-44 37.1765 38.0 38.0 38.0 36.6 38.0 45-49 37.0944 38.0 38.0 38.0 36.0 38.0 50-54 37.03495 38.0 38.0 38.0 36.0 38.0 55-59 36.976350000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.906549999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.8935 38.0 38.0 38.0 35.8 38.0 70-74 36.7766 38.0 38.0 38.0 35.2 38.0 75-79 36.641200000000005 38.0 38.0 38.0 34.6 38.0 80-84 36.5144 38.0 38.0 38.0 34.2 38.0 85-89 36.44885 38.0 38.0 38.0 34.0 38.0 90-94 36.29945 38.0 37.8 38.0 34.0 38.0 95-99 36.172799999999995 38.0 37.6 38.0 33.6 38.0 100-104 35.927949999999996 38.0 37.0 38.0 32.6 38.0 105-109 35.77035 38.0 37.0 38.0 31.8 38.0 110-114 35.5025 38.0 37.0 38.0 31.0 38.0 115-119 35.324799999999996 38.0 36.0 38.0 29.4 38.0 120-124 35.19685 38.0 36.0 38.0 29.2 38.0 125-129 34.765750000000004 38.0 35.6 38.0 27.4 38.0 130-134 34.32795 38.0 35.0 38.0 24.8 38.0 135-139 33.8755 38.0 34.8 38.0 22.6 38.0 140-144 33.38465 38.0 34.0 38.0 17.4 38.0 145-149 32.6418 38.0 33.2 38.0 15.0 38.0 150-151 28.1625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 3.0 14 1.0 15 1.0 16 0.0 17 2.0 18 11.0 19 6.0 20 11.0 21 5.0 22 5.0 23 13.0 24 16.0 25 20.0 26 27.0 27 30.0 28 23.0 29 34.0 30 62.0 31 61.0 32 81.0 33 116.0 34 162.0 35 292.0 36 742.0 37 2270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.54844421958006 15.532506956741715 9.309385277004807 30.60966354667341 2 22.5 16.650000000000002 33.575 27.275 3 18.35 24.3 27.675 29.675 4 21.575 31.6 23.549999999999997 23.275000000000002 5 21.67167167167167 36.286286286286284 24.074074074074073 17.96796796796797 6 17.9 35.375 26.700000000000003 20.025000000000002 7 14.899999999999999 22.650000000000002 44.074999999999996 18.375 8 15.7 23.1 32.35 28.849999999999998 9 17.0 24.65 32.025 26.325 10-14 19.6 30.0 26.765 23.635 15-19 19.96 29.04 27.425 23.575 20-24 19.825 28.835 28.08 23.26 25-29 19.53 28.87 28.105000000000004 23.494999999999997 30-34 19.405 29.74 27.755000000000003 23.1 35-39 19.976991947181514 29.385284849697396 27.42459860951333 23.213124593607763 40-44 19.77587673220271 29.030967031867526 27.435089299114512 23.758066936815247 45-49 19.890940017009356 28.670768922907598 27.845314923207766 23.592976136875283 50-54 20.025012506253127 28.91445722861431 27.34367183591796 23.716858429214607 55-59 20.29826844159744 28.926033430087077 27.474727254529075 23.300970873786408 60-64 20.45045045045045 28.18818818818819 27.45745745745746 23.903903903903903 65-69 19.938941994895153 28.23682498373455 27.986587257895003 23.8376457634753 70-74 20.25227750525578 28.466312944238663 27.560316347982784 23.721093202522773 75-79 20.38038038038038 29.084084084084083 26.76176176176176 23.773773773773772 80-84 20.093083775397858 28.725853267941147 27.32459213291963 23.856470823741365 85-89 20.240180135101326 28.97673254941206 27.20040030022517 23.582687015261445 90-94 20.529370559391573 28.585009506654657 27.604323026118283 23.281296907835486 95-99 20.540405303977984 28.281210908181137 27.35551663747811 23.82286715036277 100-104 20.15433954700341 28.632992583684103 27.640809781519344 23.571858087793146 105-109 20.67067067067067 28.15815815815816 27.547547547547545 23.623623623623622 110-114 20.706589827111 28.023051866700076 27.45176647456778 23.81859183162115 115-119 20.656525220176142 28.507806244995997 27.04163330664532 23.794035228182548 120-124 20.525 28.535 27.145000000000003 23.794999999999998 125-129 20.535 27.92 27.105 24.44 130-134 20.550900607094476 28.1872459986955 27.30921679795294 23.952636596257086 135-139 21.0454888162855 28.22819803970847 26.559437044483538 24.166876099522494 140-144 20.53334667533897 28.10326712363036 27.37779556711863 23.985590633912043 145-149 21.23 27.79 27.37 23.61 150-151 20.8875 27.9375 26.6625 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.0 24 4.5 25 4.0 26 4.5 27 8.5 28 10.0 29 13.0 30 23.0 31 33.0 32 37.0 33 43.5 34 62.5 35 80.5 36 99.5 37 116.0 38 127.0 39 154.5 40 187.0 41 222.0 42 244.5 43 246.5 44 259.5 45 254.0 46 238.5 47 247.5 48 234.5 49 204.5 50 175.5 51 142.0 52 127.0 53 101.0 54 67.5 55 47.0 56 38.5 57 36.5 58 26.0 59 18.5 60 14.0 61 10.5 62 7.0 63 2.0 64 1.0 65 2.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.055 45-49 0.055 50-54 0.05 55-59 0.09 60-64 0.1 65-69 0.095 70-74 0.11 75-79 0.1 80-84 0.09 85-89 0.075 90-94 0.06999999999999999 95-99 0.075 100-104 0.22 105-109 0.1 110-114 0.22499999999999998 115-119 0.08 120-124 0.0 125-129 0.0 130-134 0.345 135-139 0.525 140-144 0.065 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5545752457776657 1.0999999999999999 3 0.10083186286866651 0.3 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4625000000000004 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172515 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172515_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59225 33.0 33.0 34.0 32.0 34.0 2 32.69725 33.0 33.0 34.0 32.0 34.0 3 32.7965 34.0 33.0 34.0 32.0 34.0 4 32.6685 34.0 33.0 34.0 32.0 34.0 5 32.63575 34.0 33.0 34.0 32.0 34.0 6 36.7065 38.0 38.0 38.0 36.0 38.0 7 36.8805 38.0 38.0 38.0 36.0 38.0 8 36.8945 38.0 38.0 38.0 36.0 38.0 9 36.87625 38.0 38.0 38.0 37.0 38.0 10-14 36.81185000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.79545 38.0 38.0 38.0 36.4 38.0 20-24 36.80735 38.0 38.0 38.0 36.4 38.0 25-29 36.78875 38.0 38.0 38.0 36.4 38.0 30-34 36.74195 38.0 38.0 38.0 36.2 38.0 35-39 36.67229999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.58555 38.0 38.0 38.0 36.0 38.0 45-49 36.620799999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.5911 38.0 38.0 38.0 36.0 38.0 55-59 36.54145 38.0 38.0 38.0 36.0 38.0 60-64 36.5024 38.0 38.0 38.0 35.6 38.0 65-69 36.4437 38.0 38.0 38.0 35.8 38.0 70-74 36.3713 38.0 38.0 38.0 35.0 38.0 75-79 36.35925 38.0 38.0 38.0 35.0 38.0 80-84 36.2699 38.0 38.0 38.0 34.4 38.0 85-89 36.1904 38.0 38.0 38.0 34.2 38.0 90-94 36.0245 38.0 38.0 38.0 33.8 38.0 95-99 35.88815 38.0 38.0 38.0 33.6 38.0 100-104 35.76705 38.0 38.0 38.0 33.0 38.0 105-109 35.6811 38.0 38.0 38.0 33.0 38.0 110-114 35.38775 38.0 37.2 38.0 31.0 38.0 115-119 35.22885 38.0 37.0 38.0 30.6 38.0 120-124 34.953900000000004 38.0 36.8 38.0 28.4 38.0 125-129 34.702600000000004 38.0 36.0 38.0 27.8 38.0 130-134 34.25915 38.0 35.4 38.0 24.0 38.0 135-139 33.826750000000004 38.0 34.4 38.0 22.2 38.0 140-144 33.088649999999994 38.0 33.2 38.0 13.6 38.0 145-149 32.2943 38.0 33.0 38.0 10.8 38.0 150-151 27.860375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 9.0 4 3.0 5 2.0 6 5.0 7 5.0 8 7.0 9 6.0 10 4.0 11 0.0 12 1.0 13 3.0 14 2.0 15 4.0 16 5.0 17 8.0 18 8.0 19 12.0 20 10.0 21 10.0 22 10.0 23 10.0 24 19.0 25 18.0 26 21.0 27 21.0 28 47.0 29 22.0 30 41.0 31 49.0 32 51.0 33 94.0 34 149.0 35 256.0 36 563.0 37 2503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.31563126252505 20.415831663326653 12.5250501002004 21.743486973947896 2 26.980942828485453 26.654964894684053 29.1123370110331 17.251755265797392 3 21.50564617314931 27.42785445420326 31.54328732747804 19.523212045169387 4 24.202862164197843 34.797891036906854 22.24453929199096 18.754707506904346 5 23.71987951807229 38.002008032128515 21.937751004016064 16.340361445783135 6 19.587628865979383 37.01282373648479 24.163942670354537 19.235604727181293 7 20.422004521477017 19.467470484802814 39.76387842250691 20.346646571213263 8 21.828686259733736 23.486561165536298 27.882441597588546 26.80231097714142 9 22.473604826546005 24.057315233785822 30.21618903971845 23.252890899949723 10-14 23.8930492033975 28.06453234155903 26.948786249183293 21.09363220586018 15-19 23.063008742839916 28.62526379258366 27.52487187217365 20.786855592402773 20-24 23.305361539621124 27.70715039445254 27.93829455806241 21.049193507863926 25-29 23.360964581763376 28.073348404923387 27.63627229339362 20.929414719919617 30-34 23.198232132991812 27.57772085781729 28.13520164733062 21.08884536186028 35-39 23.14531116580441 27.987342407956202 27.67592546084685 21.191420965392535 40-44 24.239835151027794 27.923807609187314 27.401115746092376 20.435241493692516 45-49 23.32009850731266 27.933859375785293 28.250490023621648 20.495552093280395 50-54 22.714932126696834 27.45600804424334 28.235294117647058 21.59376571141277 55-59 23.297653148399416 27.9863309714056 27.197346600331674 21.51866927986331 60-64 23.946350529964334 27.52298186567539 27.678705982820112 20.85196162154016 65-69 23.554840655474013 27.53594048456821 27.7018196441138 21.20739921584397 70-74 24.203277370061326 27.158942394691866 27.93304513923796 20.704735096008847 75-79 23.746105136194593 27.69122524876872 27.620866418735552 20.941803196301137 80-84 23.645592521861495 27.947532415318122 27.299226052869635 21.107649009950748 85-89 23.128362411383176 27.87973251546081 28.065764995726283 20.926140077429736 90-94 23.895006788354202 27.525519183386134 28.033388645849044 20.54608538241062 95-99 23.72259102796218 27.574934620800644 27.695634681150672 21.006839670086503 100-104 23.221557488311294 27.41943592579559 28.595847368156452 20.763159217736664 105-109 23.83177570093458 27.384182494221687 28.293638830268314 20.49040297457542 110-114 23.38608389851796 27.79703592062296 28.22406430545089 20.59281587540819 115-119 24.057694240627196 27.98773746105136 27.550507588702384 20.404060709619056 120-124 24.151796933902993 27.75571751696406 27.725559185725057 20.36692636340789 125-129 24.06914225415808 27.606652932013464 27.506155469574395 20.818049344254057 130-134 25.119292782158826 27.560399819177256 26.922497363001657 20.397810035662264 135-139 24.611984529609725 27.525239841277816 27.937113868099857 19.92566176101261 140-144 24.5148315736551 27.76269482151835 27.430869783810962 20.291603821015585 145-149 25.177287129708798 27.681939345169237 27.08846753508022 20.052305990041745 150-151 24.783100716710678 28.655853137180937 27.08411920030177 19.476926945806614 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 7.0 2 3.5 3 2.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.5 22 2.0 23 3.5 24 5.0 25 2.5 26 1.5 27 4.0 28 5.5 29 9.0 30 15.0 31 22.0 32 25.0 33 29.5 34 39.0 35 55.5 36 73.5 37 85.0 38 111.0 39 148.0 40 182.0 41 221.0 42 244.0 43 264.0 44 279.0 45 275.5 46 260.0 47 247.0 48 252.0 49 231.0 50 185.5 51 142.5 52 112.5 53 100.0 54 89.5 55 71.0 56 51.0 57 33.5 58 24.0 59 21.0 60 18.0 61 10.5 62 5.0 63 4.0 64 3.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.3 3 0.375 4 0.42500000000000004 5 0.4 6 0.575 7 0.475 8 0.475 9 0.5499999999999999 10-14 0.515 15-19 0.49 20-24 0.49500000000000005 25-29 0.475 30-34 0.445 35-39 0.455 40-44 0.515 45-49 0.515 50-54 0.5499999999999999 55-59 0.505 60-64 0.46499999999999997 65-69 0.53 70-74 0.53 75-79 0.51 80-84 0.51 85-89 0.555 90-94 0.565 95-99 0.58 100-104 0.545 105-109 0.49 110-114 0.475 115-119 0.51 120-124 0.525 125-129 0.49500000000000005 130-134 0.455 135-139 0.455 140-144 0.5499999999999999 145-149 0.585 150-151 0.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52128999748048 98.75 2 0.4283194759385236 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05039052658100278 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 8 0.2 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAAT 10 0.00682755 145.0 7 >>END_MODULE Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900517 spots for SRR7172515.sra Written 900517 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra Read 900510 spots for SRR7172515.sra Written 900510 spots for SRR7172515.sra SRR ids: ['SRR7172515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b31mg5os SRR7172515.sra spots: 18010207 blocks: [[1, 900510], [900511, 1801020], [1801021, 2701530], [2701531, 3602040], [3602041, 4502550], [4502551, 5403060], [5403061, 6303570], [6303571, 7204080], [7204081, 8104590], [8104591, 9005100], [9005101, 9905610], [9905611, 10806120], [10806121, 11706630], [11706631, 12607140], [12607141, 13507650], [13507651, 14408160], [14408161, 15308670], [15308671, 16209180], [16209181, 17109690], [17109691, 18010207]] SRR7172515 file size 6081367 SRR7172515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172515 SRR7172515_1.fastq SRR7172515_2.fastq Input file: SRR7172515_1.fastq Paired file: SRR7172515_2.fastq trimmed: SRR7172515-trimmed-pair1.fastq, SRR7172515-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:45:19 2025 >> started Mon Feb 10 14:45:38 2025 >> done (18.550s) 18010207 read pairs processed; of these: 38585 ( 0.21%) short read pairs filtered out after trimming by size control 95338 ( 0.53%) empty read pairs filtered out after trimming by size control 17876284 (99.26%) read pairs available; of these: 8900274 (49.79%) trimmed read pairs available after processing 8976010 (50.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 10 0.00% 21 8 0.00% 22 9 0.00% 23 12 0.00% 24 13 0.00% 25 12 0.00% 26 18 0.00% 27 15 0.00% 28 17 0.00% 29 19 0.00% 30 26 0.00% 31 23 0.00% 32 23 0.00% 33 18 0.00% 34 26 0.00% 35 19 0.00% 36 37 0.00% 37 60 0.00% 38 31 0.00% 39 35 0.00% 40 38 0.00% 41 47 0.00% 42 37 0.00% 43 45 0.00% 44 61 0.00% 45 156 0.00% 46 135 0.00% 47 128 0.00% 48 108 0.00% 49 123 0.00% 50 118 0.00% 51 137 0.00% 52 146 0.00% 53 140 0.00% 54 166 0.00% 55 186 0.00% 56 221 0.00% 57 224 0.00% 58 251 0.00% 59 328 0.00% 60 400 0.00% 61 424 0.00% 62 487 0.00% 63 533 0.00% 64 596 0.00% 65 652 0.00% 66 780 0.00% 67 892 0.00% 68 1012 0.01% 69 1580 0.01% 70 1677 0.01% 71 1501 0.01% 72 1620 0.01% 73 1768 0.01% 74 1946 0.01% 75 2139 0.01% 76 2260 0.01% 77 2615 0.01% 78 2862 0.02% 79 3273 0.02% 80 3689 0.02% 81 4110 0.02% 82 4717 0.03% 83 5177 0.03% 84 7221 0.04% 85 8132 0.05% 86 8498 0.05% 87 9091 0.05% 88 9454 0.05% 89 9851 0.06% 90 10577 0.06% 91 11285 0.06% 92 12041 0.07% 93 13326 0.07% 94 13995 0.08% 95 14318 0.08% 96 14643 0.08% 97 15225 0.09% 98 15939 0.09% 99 16360 0.09% 100 17794 0.10% 101 18468 0.10% 102 19723 0.11% 103 20903 0.12% 104 21581 0.12% 105 23160 0.13% 106 23740 0.13% 107 24114 0.13% 108 25171 0.14% 109 26505 0.15% 110 27049 0.15% 111 28027 0.16% 112 29390 0.16% 113 30871 0.17% 114 32537 0.18% 115 33514 0.19% 116 34878 0.20% 117 36166 0.20% 118 36777 0.21% 119 37443 0.21% 120 38944 0.22% 121 40483 0.23% 122 41881 0.23% 123 44301 0.25% 124 46349 0.26% 125 47603 0.27% 126 49837 0.28% 127 51546 0.29% 128 53453 0.30% 129 56253 0.31% 130 57410 0.32% 131 59644 0.33% 132 62698 0.35% 133 65700 0.37% 134 69384 0.39% 135 73854 0.41% 136 77418 0.43% 137 82892 0.46% 138 87447 0.49% 139 93698 0.52% 140 99646 0.56% 141 107879 0.60% 142 118603 0.66% 143 133189 0.75% 144 152645 0.85% 145 180929 1.01% 146 222237 1.24% 147 300821 1.68% 148 458723 2.57% 149 921299 5.15% 150 4215792 23.58% 151 8976010 50.21% 17876284 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=239.64 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=0.93 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=17.97 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7172515 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:46:24 Started mapping on | Feb 10 14:46:25 Finished on | Feb 10 14:48:26 Mapping speed, Million of reads per hour | 531.86 Number of input reads | 17876284 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16669390 Uniquely mapped reads % | 93.25% Average mapped length | 292.85 Number of splices: Total | 15701968 Number of splices: Annotated (sjdb) | 15405615 Number of splices: GT/AG | 15393458 Number of splices: GC/AG | 256415 Number of splices: AT/AC | 8863 Number of splices: Non-canonical | 43232 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505517 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 27484 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734700 734700 734700 N_multimapping 505517 505517 505517 N_noFeature 498111 16352385 638009 N_ambiguous 276502 1060 98850 UnstrandedReadsAssigned:15894777 PositiveStrandReadsAssigned:315945 NegativeStrandReadsAssigned:15932531 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172515 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172515-trimmed-pair1.fastq SRR7172515-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,876,284 reads, 15,955,989 reads pseudoaligned [quant] estimated average fragment length: 250.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7172515.ke.tsv 34699 SRR7172515.se.tsv 87100 total ==> SRR7172515.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.84 433 13.7403 Potri.005G024800.1.v4.1 1035 785.844 133 9.49978 Potri.004G059700.1.v4.1 961 711.919 45 3.54797 Potri.007G009000.2.v4.1 1416 1166.84 0 0 Potri.003G141000.2.v4.1 2943 2693.84 771 16.065 Potri.016G087400.1.v4.1 270 82.5677 892.686 606.857 Potri.015G069301.1.v4.1 564 323.317 0 0 Potri.010G195200.1.v4.1 1773 1523.84 13 0.478852 Potri.012G127500.1.v4.1 977 727.879 160 12.3384 ==> SRR7172515.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7172515 completed mapping pipeline successfully