Starting /dee2/code/volunteer_pipeline.sh SRR7172516 current disk space = 3059039543296 free memory = 1289534640 SRR7172516 SRAfilesize bf3b8fd7237fa364f0a9a25c56e1b227 SRR7172516.sra SRR7172516.sra file validated SRR7172516 is paired end SRR7172516 is conventional basespace SRR7172516 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50725 34.0 33.0 34.0 32.0 34.0 2 33.327 34.0 33.0 34.0 33.0 34.0 3 33.416 34.0 34.0 34.0 33.0 34.0 4 33.50775 34.0 34.0 34.0 33.0 34.0 5 33.45675 34.0 34.0 34.0 33.0 34.0 6 37.324 38.0 38.0 38.0 37.0 38.0 7 37.47625 38.0 38.0 38.0 37.0 38.0 8 37.59225 38.0 38.0 38.0 38.0 38.0 9 37.536 38.0 38.0 38.0 38.0 38.0 10-14 37.562349999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.55695 38.0 38.0 38.0 38.0 38.0 20-24 37.5769 38.0 38.0 38.0 38.0 38.0 25-29 37.50834999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.504949999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.3995 38.0 38.0 38.0 37.4 38.0 40-44 37.248850000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.1898 38.0 38.0 38.0 36.8 38.0 50-54 37.09995 38.0 38.0 38.0 36.0 38.0 55-59 37.01515 38.0 38.0 38.0 36.0 38.0 60-64 37.043949999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.97755 38.0 38.0 38.0 36.0 38.0 70-74 36.8192 38.0 38.0 38.0 35.6 38.0 75-79 36.715250000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.59675 38.0 38.0 38.0 34.8 38.0 85-89 36.54085 38.0 38.0 38.0 34.2 38.0 90-94 36.48705 38.0 38.0 38.0 34.4 38.0 95-99 36.34394999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.1633 38.0 37.8 38.0 33.8 38.0 105-109 35.940099999999994 38.0 37.2 38.0 33.2 38.0 110-114 35.61435 38.0 37.0 38.0 31.4 38.0 115-119 35.545550000000006 38.0 37.0 38.0 31.0 38.0 120-124 35.59505 38.0 36.6 38.0 31.6 38.0 125-129 35.0696 38.0 36.0 38.0 28.2 38.0 130-134 34.6813 38.0 35.4 38.0 27.4 38.0 135-139 34.12785 38.0 34.6 38.0 24.4 38.0 140-144 33.4941 38.0 33.4 38.0 21.4 38.0 145-149 32.5713 38.0 33.0 38.0 12.2 38.0 150-151 27.598875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 3.0 10 2.0 11 1.0 12 1.0 13 4.0 14 4.0 15 4.0 16 3.0 17 3.0 18 2.0 19 3.0 20 3.0 21 11.0 22 9.0 23 13.0 24 13.0 25 9.0 26 14.0 27 30.0 28 26.0 29 32.0 30 28.0 31 73.0 32 70.0 33 111.0 34 158.0 35 275.0 36 736.0 37 2357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.96907216494846 13.505154639175258 8.685567010309278 38.84020618556701 2 20.9 17.7 36.975 24.425 3 17.775 22.575 28.249999999999996 31.4 4 23.7 31.374999999999996 21.224999999999998 23.7 5 21.875 36.4 23.849999999999998 17.875 6 17.325 35.525 26.950000000000003 20.200000000000003 7 14.05 23.125 44.45 18.375 8 18.075 22.525000000000002 32.85 26.55 9 16.900000000000002 24.675 32.75 25.674999999999997 10-14 20.19 29.115000000000002 26.57 24.125 15-19 19.535 28.965000000000003 27.465 24.035 20-24 19.985 28.455000000000002 27.855 23.705000000000002 25-29 19.805 28.299999999999997 27.584999999999997 24.310000000000002 30-34 19.39 28.62 27.465 24.525 35-39 20.40438416495671 28.66723387217857 27.165807517141282 23.762574445723438 40-44 19.648490310950876 28.586450353011866 27.95052826598568 23.814531070051576 45-49 20.995194233079694 27.92350820985182 27.032438926712054 24.048858630356428 50-54 19.742639695573803 28.955537752853992 27.333266573202486 23.968555978369718 55-59 19.73255872189112 28.61221014674212 27.440276456152652 24.214954675214102 60-64 20.215376909591786 28.805409466566488 27.523165539694467 23.45604808414726 65-69 20.803285256410255 28.23016826923077 27.468950320512818 23.497596153846153 70-74 20.5730601612984 28.768221209237087 27.3405800731353 23.31813855632921 75-79 21.047094188376754 28.041082164328657 27.359719438877754 23.552104208416832 80-84 21.211058799959932 28.503455874987477 27.246318741861163 23.039166583191424 85-89 21.079781639705512 28.787499373967044 26.689036910902992 23.443682075424448 90-94 20.785335069618352 28.43834518681759 27.496744465591505 23.279575277972555 95-99 20.331513846462016 28.70449196254194 27.317341879913865 23.64665231108218 100-104 20.91869959424936 28.76321194209287 27.03000551019386 23.28808295346391 105-109 20.78989574979952 27.370689655172413 27.79671210906175 24.04270248596632 110-114 21.098251415401574 27.947291948494414 27.170699934866477 23.78375670123754 115-119 21.196332849055658 28.555683582986823 27.52868092780923 22.71930264014829 120-124 21.26 27.93 26.695 24.115000000000002 125-129 21.45716573258607 27.93234587670136 27.02161729383507 23.588871096877504 130-134 21.818181818181817 28.262179809141134 26.956303365143143 22.963335007533903 135-139 21.349162432717943 28.376678907389707 26.565722621862264 23.708436038030083 140-144 21.474391099528916 27.698707026160168 27.097323844843142 23.729578029467778 145-149 21.84 27.58 26.765 23.815 150-151 22.287499999999998 27.3625 26.75 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.0 17 0.5 18 1.5 19 3.5 20 2.5 21 0.5 22 1.5 23 2.5 24 3.5 25 3.0 26 2.5 27 8.0 28 11.0 29 14.0 30 21.0 31 23.5 32 36.0 33 54.5 34 68.0 35 73.0 36 81.0 37 111.0 38 134.5 39 141.5 40 175.5 41 207.5 42 226.5 43 232.5 44 251.0 45 256.5 46 255.5 47 258.0 48 235.5 49 204.5 50 181.0 51 155.0 52 115.5 53 100.0 54 88.5 55 70.0 56 53.5 57 35.0 58 21.0 59 26.5 60 20.0 61 11.0 62 8.0 63 4.5 64 2.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.095 40-44 0.145 45-49 0.12 50-54 0.13999999999999999 55-59 0.165 60-64 0.17500000000000002 65-69 0.16 70-74 0.185 75-79 0.2 80-84 0.16999999999999998 85-89 0.165 90-94 0.16999999999999998 95-99 0.155 100-104 0.185 105-109 0.24 110-114 0.20500000000000002 115-119 0.19499999999999998 120-124 0.0 125-129 0.08 130-134 0.44999999999999996 135-139 0.605 140-144 0.22999999999999998 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.1375 0.0 0.0 0.0 0.0 136-137 6.8375 0.0 0.0 0.0 0.0 138-139 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172516 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172516_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8135 33.0 33.0 34.0 32.0 34.0 2 32.8465 34.0 33.0 34.0 32.0 34.0 3 32.90725 34.0 33.0 34.0 32.0 34.0 4 32.82675 34.0 33.0 34.0 32.0 34.0 5 32.8665 34.0 33.0 34.0 32.0 34.0 6 37.09075 38.0 38.0 38.0 37.0 38.0 7 37.09675 38.0 38.0 38.0 37.0 38.0 8 36.9675 38.0 38.0 38.0 37.0 38.0 9 36.96225 38.0 38.0 38.0 36.0 38.0 10-14 37.073299999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.05995 38.0 38.0 38.0 37.0 38.0 20-24 36.9796 38.0 38.0 38.0 37.0 38.0 25-29 37.066500000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.9793 38.0 38.0 38.0 36.6 38.0 35-39 36.92325 38.0 38.0 38.0 36.4 38.0 40-44 36.834450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.887600000000006 38.0 38.0 38.0 36.2 38.0 50-54 36.879200000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.8177 38.0 38.0 38.0 36.2 38.0 60-64 36.79944999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.7081 38.0 38.0 38.0 36.0 38.0 70-74 36.691449999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.569100000000006 38.0 38.0 38.0 35.4 38.0 80-84 36.40260000000001 38.0 38.0 38.0 34.8 38.0 85-89 36.31655 38.0 38.0 38.0 34.0 38.0 90-94 36.1418 38.0 38.0 38.0 33.8 38.0 95-99 35.99945 38.0 38.0 38.0 33.4 38.0 100-104 35.95705 38.0 38.0 38.0 33.2 38.0 105-109 35.817550000000004 38.0 38.0 38.0 32.6 38.0 110-114 35.586149999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.3741 38.0 37.0 38.0 30.2 38.0 120-124 35.17445 38.0 36.6 38.0 29.4 38.0 125-129 34.825649999999996 38.0 36.0 38.0 27.8 38.0 130-134 34.4382 38.0 35.6 38.0 25.6 38.0 135-139 33.90605 38.0 34.4 38.0 22.6 38.0 140-144 33.0963 38.0 33.2 38.0 15.4 38.0 145-149 32.14475 38.0 33.0 38.0 8.6 38.0 150-151 27.911875000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 1.0 6 4.0 7 3.0 8 2.0 9 1.0 10 3.0 11 2.0 12 1.0 13 5.0 14 3.0 15 7.0 16 11.0 17 1.0 18 5.0 19 8.0 20 13.0 21 8.0 22 11.0 23 15.0 24 18.0 25 26.0 26 25.0 27 31.0 28 32.0 29 37.0 30 41.0 31 59.0 32 66.0 33 111.0 34 152.0 35 218.0 36 544.0 37 2524.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 20.474999999999998 13.100000000000001 27.675 2 25.43815723585378 26.43965948923385 33.09964947421132 15.022533800701051 3 21.106659989984976 27.541311967951927 32.14822233350025 19.203805708562843 4 24.236354531797698 35.37806710065098 21.88282423635453 18.502754131196795 5 24.261392088132197 36.029043565348026 22.30846269404106 17.40110165247872 6 18.525 38.475 24.675 18.325 7 18.775 19.025 40.675 21.525 8 20.05 24.25 29.5 26.200000000000003 9 22.15 24.925 28.925 24.0 10-14 23.119999999999997 28.549999999999997 26.474999999999998 21.855 15-19 22.915 28.225 27.310000000000002 21.55 20-24 23.115 27.925 27.644999999999996 21.315 25-29 23.315 27.395000000000003 28.110000000000003 21.18 30-34 22.79 27.87 27.875 21.465 35-39 23.215 27.115000000000002 28.435 21.235 40-44 22.884999999999998 28.185 27.750000000000004 21.18 45-49 23.27 27.685 27.49 21.555 50-54 22.884999999999998 27.705000000000002 27.834999999999997 21.575 55-59 23.145 27.560000000000002 27.805000000000003 21.490000000000002 60-64 22.605 27.6 28.110000000000003 21.685 65-69 23.605 26.450000000000003 28.444999999999997 21.5 70-74 22.875 27.875 27.725 21.525 75-79 23.09 27.425 28.084999999999997 21.4 80-84 23.69 27.615000000000002 27.48 21.215 85-89 23.02 27.384999999999998 27.834999999999997 21.759999999999998 90-94 23.649729945989197 27.975595119023804 27.410482096419287 20.964192838567712 95-99 23.585 27.425 27.985 21.005 100-104 23.405 27.97 27.71 20.915 105-109 23.635 27.71 27.46 21.195 110-114 23.705000000000002 27.605 28.18 20.51 115-119 23.52 28.095 27.63 20.755000000000003 120-124 23.915 27.925 27.57 20.59 125-129 24.295 27.985 27.284999999999997 20.435 130-134 24.809847878302644 27.6371096877502 27.632105684547636 19.92093674939952 135-139 24.664463141025642 27.764423076923077 27.358774038461537 20.212339743589745 140-144 25.130000000000003 27.355 27.36 20.155 145-149 25.385 28.050000000000004 26.715 19.85 150-151 25.5 26.950000000000003 27.650000000000002 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 1.5 22 1.5 23 2.0 24 2.5 25 3.0 26 6.0 27 9.0 28 12.5 29 12.5 30 14.0 31 20.0 32 29.5 33 43.0 34 52.0 35 56.5 36 69.5 37 91.5 38 114.0 39 144.5 40 191.5 41 214.0 42 220.5 43 260.5 44 274.0 45 268.5 46 263.0 47 243.5 48 221.0 49 201.5 50 176.5 51 144.0 52 136.5 53 121.5 54 103.5 55 81.0 56 49.5 57 38.0 58 30.5 59 23.0 60 16.0 61 8.0 62 6.5 63 6.5 64 4.0 65 1.5 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.08 135-139 0.16 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8076728924785461 1.6 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.25 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATCCA 10 0.006830828 145.0 2 CTGATGC 10 0.006830828 145.0 9 TATCCAT 10 0.006830828 145.0 3 TCCATAT 10 0.006830828 145.0 5 >>END_MODULE Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746992 spots for SRR7172516.sra Written 746992 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra Read 746976 spots for SRR7172516.sra Written 746976 spots for SRR7172516.sra SRR ids: ['SRR7172516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4y6h18ko SRR7172516.sra spots: 14939536 blocks: [[1, 746976], [746977, 1493952], [1493953, 2240928], [2240929, 2987904], [2987905, 3734880], [3734881, 4481856], [4481857, 5228832], [5228833, 5975808], [5975809, 6722784], [6722785, 7469760], [7469761, 8216736], [8216737, 8963712], [8963713, 9710688], [9710689, 10457664], [10457665, 11204640], [11204641, 11951616], [11951617, 12698592], [12698593, 13445568], [13445569, 14192544], [14192545, 14939536]] SRR7172516 file size 5040818 SRR7172516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172516 SRR7172516_1.fastq SRR7172516_2.fastq Input file: SRR7172516_1.fastq Paired file: SRR7172516_2.fastq trimmed: SRR7172516-trimmed-pair1.fastq, SRR7172516-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:32:11 2025 >> started Mon Feb 10 14:32:28 2025 >> done (16.276s) 14939536 read pairs processed; of these: 15759 ( 0.11%) short read pairs filtered out after trimming by size control 61509 ( 0.41%) empty read pairs filtered out after trimming by size control 14862268 (99.48%) read pairs available; of these: 7413927 (49.88%) trimmed read pairs available after processing 7448341 (50.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 4 0.00% 21 6 0.00% 22 11 0.00% 23 6 0.00% 24 4 0.00% 25 9 0.00% 26 10 0.00% 27 13 0.00% 28 12 0.00% 29 9 0.00% 30 10 0.00% 31 14 0.00% 32 11 0.00% 33 7 0.00% 34 16 0.00% 35 18 0.00% 36 18 0.00% 37 12 0.00% 38 23 0.00% 39 25 0.00% 40 26 0.00% 41 39 0.00% 42 22 0.00% 43 44 0.00% 44 34 0.00% 45 50 0.00% 46 55 0.00% 47 70 0.00% 48 69 0.00% 49 92 0.00% 50 93 0.00% 51 94 0.00% 52 126 0.00% 53 117 0.00% 54 158 0.00% 55 152 0.00% 56 165 0.00% 57 198 0.00% 58 227 0.00% 59 228 0.00% 60 271 0.00% 61 363 0.00% 62 356 0.00% 63 405 0.00% 64 469 0.00% 65 515 0.00% 66 590 0.00% 67 671 0.00% 68 746 0.01% 69 1095 0.01% 70 1259 0.01% 71 1050 0.01% 72 1217 0.01% 73 1348 0.01% 74 1584 0.01% 75 1697 0.01% 76 1820 0.01% 77 2049 0.01% 78 2279 0.02% 79 2648 0.02% 80 2904 0.02% 81 3265 0.02% 82 3797 0.03% 83 4237 0.03% 84 5176 0.03% 85 5954 0.04% 86 6458 0.04% 87 6805 0.05% 88 7385 0.05% 89 7836 0.05% 90 8584 0.06% 91 9338 0.06% 92 10442 0.07% 93 11120 0.07% 94 11480 0.08% 95 12360 0.08% 96 12692 0.09% 97 13425 0.09% 98 14089 0.09% 99 14319 0.10% 100 15455 0.10% 101 16196 0.11% 102 17686 0.12% 103 18532 0.12% 104 19173 0.13% 105 20164 0.14% 106 21040 0.14% 107 22167 0.15% 108 23115 0.16% 109 23831 0.16% 110 24845 0.17% 111 25837 0.17% 112 26975 0.18% 113 28285 0.19% 114 29679 0.20% 115 31392 0.21% 116 32369 0.22% 117 33261 0.22% 118 34787 0.23% 119 35335 0.24% 120 37161 0.25% 121 38025 0.26% 122 39317 0.26% 123 41344 0.28% 124 42841 0.29% 125 44707 0.30% 126 46376 0.31% 127 48401 0.33% 128 49604 0.33% 129 51824 0.35% 130 54005 0.36% 131 55358 0.37% 132 57623 0.39% 133 60414 0.41% 134 63404 0.43% 135 66417 0.45% 136 70393 0.47% 137 74693 0.50% 138 78845 0.53% 139 84066 0.57% 140 88477 0.60% 141 95638 0.64% 142 103595 0.70% 143 114004 0.77% 144 130443 0.88% 145 153024 1.03% 146 188537 1.27% 147 245724 1.65% 148 358600 2.41% 149 694852 4.68% 150 3439686 23.14% 151 7448341 50.12% 14862268 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=11 prefix-density=0.70 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=302.94 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=0.49 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=26.93 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7172516 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:33:15 Started mapping on | Feb 10 14:33:16 Finished on | Feb 10 14:35:18 Mapping speed, Million of reads per hour | 438.56 Number of input reads | 14862268 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13727400 Uniquely mapped reads % | 92.36% Average mapped length | 292.46 Number of splices: Total | 12737244 Number of splices: Annotated (sjdb) | 12461796 Number of splices: GT/AG | 12485494 Number of splices: GC/AG | 204834 Number of splices: AT/AC | 8069 Number of splices: Non-canonical | 38847 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391180 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 78938 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.32% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 757991 757991 757991 N_multimapping 391180 391180 391180 N_noFeature 527472 13464457 644143 N_ambiguous 253356 1322 106133 UnstrandedReadsAssigned:12946572 PositiveStrandReadsAssigned:261621 NegativeStrandReadsAssigned:12977124 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172516 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172516-trimmed-pair1.fastq SRR7172516-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,862,268 reads, 13,018,742 reads pseudoaligned [quant] estimated average fragment length: 234.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7172516.ke.tsv 34699 SRR7172516.se.tsv 87100 total ==> SRR7172516.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.01 730 27.5389 Potri.005G024800.1.v4.1 1035 801.008 261 21.9293 Potri.004G059700.1.v4.1 961 727.054 10 0.925665 Potri.007G009000.2.v4.1 1416 1182.01 0 0 Potri.003G141000.2.v4.1 2943 2709.01 490 12.1732 Potri.016G087400.1.v4.1 270 85.0911 554 438.173 Potri.015G069301.1.v4.1 564 335.512 0 0 Potri.010G195200.1.v4.1 1773 1539.01 24 1.04952 Potri.012G127500.1.v4.1 977 743.029 198 17.9341 ==> SRR7172516.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 835 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 55 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR7172516 completed mapping pipeline successfully