Starting /dee2/code/volunteer_pipeline.sh SRR7172517 current disk space = 3059128397824 free memory = 1204343608 SRR7172517 SRAfilesize a625e35980df3367b21e6d101494a8eb SRR7172517.sra SRR7172517.sra file validated SRR7172517 is paired end SRR7172517 is conventional basespace SRR7172517 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94225 34.0 33.0 34.0 33.0 34.0 2 33.429 34.0 34.0 34.0 33.0 34.0 3 33.4605 34.0 34.0 34.0 33.0 34.0 4 33.474 34.0 34.0 34.0 33.0 34.0 5 33.45575 34.0 34.0 34.0 33.0 34.0 6 37.14225 38.0 38.0 38.0 36.0 38.0 7 37.446 38.0 38.0 38.0 37.0 38.0 8 37.509 38.0 38.0 38.0 37.0 38.0 9 37.47875 38.0 38.0 38.0 38.0 38.0 10-14 37.497800000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.50575 38.0 38.0 38.0 38.0 38.0 20-24 37.56965 38.0 38.0 38.0 38.0 38.0 25-29 37.50735 38.0 38.0 38.0 38.0 38.0 30-34 37.44995 38.0 38.0 38.0 37.6 38.0 35-39 37.3531 38.0 38.0 38.0 37.2 38.0 40-44 37.14195 38.0 38.0 38.0 36.4 38.0 45-49 37.07585 38.0 38.0 38.0 36.0 38.0 50-54 36.9593 38.0 38.0 38.0 35.8 38.0 55-59 36.93599999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.973850000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.8788 38.0 38.0 38.0 35.6 38.0 70-74 36.696799999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.61005 38.0 38.0 38.0 34.4 38.0 80-84 36.49550000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.394099999999995 38.0 37.8 38.0 34.0 38.0 90-94 36.29585 38.0 37.6 38.0 33.8 38.0 95-99 36.06335 38.0 37.0 38.0 32.6 38.0 100-104 35.95375 38.0 37.0 38.0 32.2 38.0 105-109 35.8008 38.0 37.0 38.0 31.0 38.0 110-114 35.41565 38.0 36.4 38.0 29.8 38.0 115-119 35.27235 38.0 36.0 38.0 28.8 38.0 120-124 35.057 38.0 35.8 38.0 28.2 38.0 125-129 34.82765 38.0 35.0 38.0 27.8 38.0 130-134 34.3815 38.0 34.8 38.0 25.2 38.0 135-139 33.8584 38.0 33.8 38.0 22.6 38.0 140-144 32.96804999999999 38.0 33.2 38.0 17.4 38.0 145-149 32.0343 38.0 31.8 38.0 10.8 38.0 150-151 27.28425 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 2.0 17 2.0 18 5.0 19 4.0 20 8.0 21 10.0 22 10.0 23 11.0 24 14.0 25 19.0 26 22.0 27 25.0 28 37.0 29 56.0 30 42.0 31 66.0 32 76.0 33 109.0 34 190.0 35 336.0 36 858.0 37 2092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.47522236340534 15.781448538754764 9.707750952986023 36.03557814485387 2 21.85 18.9 35.925000000000004 23.325000000000003 3 18.175 25.35 27.700000000000003 28.775000000000002 4 21.375 32.95 24.125 21.55 5 21.425 35.65 23.724999999999998 19.2 6 17.325 36.7 26.450000000000003 19.525000000000002 7 14.799999999999999 22.7 43.1 19.400000000000002 8 18.45 23.025000000000002 30.7 27.825 9 16.900000000000002 23.825 33.4 25.874999999999996 10-14 19.855 29.68 26.36 24.104999999999997 15-19 19.665 28.895 27.26 24.18 20-24 19.830000000000002 28.860000000000003 27.884999999999998 23.425 25-29 19.705000000000002 29.020000000000003 27.725 23.549999999999997 30-34 19.79 28.810000000000002 27.54 23.86 35-39 20.28 29.335 26.8 23.585 40-44 20.115 28.485 28.075 23.325000000000003 45-49 19.835 28.595 27.485 24.085 50-54 20.169999999999998 27.98 27.584999999999997 24.265 55-59 19.994999999999997 28.7 27.72 23.585 60-64 19.635981799089954 28.926446322316117 27.726386319315964 23.711185559277965 65-69 19.830000000000002 29.53 26.995 23.645 70-74 19.494873718429606 28.787196799199798 27.66191547886972 24.056014003500874 75-79 20.014002800560114 29.210842168433686 27.395479095819162 23.379675935187038 80-84 20.538080712106815 28.339250887633145 27.744161624243635 23.3785067760164 85-89 19.6 28.48 28.075 23.845 90-94 20.262026202620262 28.06780678067807 28.07780778077808 23.592359235923592 95-99 20.325 28.925 27.315 23.435 100-104 20.170127595696773 28.651488616462345 27.820865649236925 23.357518138603954 105-109 20.300150075037518 28.534267133566782 27.838919459729865 23.326663331665834 110-114 20.298492512645865 28.632243201282115 27.966144137827413 23.103120148244606 115-119 20.947331566048117 28.630020507177512 27.099484819686893 23.32316310708748 120-124 20.59 28.765 27.065 23.580000000000002 125-129 20.165 28.615000000000002 27.474999999999998 23.745 130-134 20.705000000000002 28.754999999999995 27.089999999999996 23.45 135-139 20.735 28.315 27.500000000000004 23.45 140-144 20.43 28.705000000000002 27.24 23.625 145-149 21.099999999999998 28.494999999999997 26.584999999999997 23.82 150-151 20.8625 28.275 27.650000000000002 23.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 1.0 21 1.0 22 1.0 23 0.5 24 2.5 25 8.0 26 8.5 27 7.0 28 12.5 29 21.5 30 24.0 31 28.0 32 36.5 33 50.0 34 65.5 35 85.5 36 100.5 37 105.5 38 120.0 39 162.5 40 200.0 41 213.0 42 237.0 43 257.5 44 263.5 45 274.5 46 268.0 47 241.0 48 216.5 49 189.0 50 167.0 51 139.0 52 100.5 53 73.0 54 65.0 55 57.5 56 50.0 57 38.0 58 24.5 59 19.5 60 15.0 61 12.0 62 12.5 63 7.5 64 1.5 65 2.0 66 2.0 67 1.0 68 0.5 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.025 75-79 0.02 80-84 0.015 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.075 105-109 0.05 110-114 0.165 115-119 0.034999999999999996 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.2874999999999996 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.975 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172517 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172517_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40525 33.0 33.0 34.0 32.0 34.0 2 32.56275 33.0 33.0 34.0 32.0 34.0 3 32.624 34.0 33.0 34.0 32.0 34.0 4 32.47225 34.0 33.0 34.0 32.0 34.0 5 32.43725 34.0 33.0 34.0 32.0 34.0 6 36.63525 38.0 38.0 38.0 36.0 38.0 7 36.703 38.0 38.0 38.0 36.0 38.0 8 36.626 38.0 38.0 38.0 36.0 38.0 9 36.669 38.0 38.0 38.0 36.0 38.0 10-14 36.76375 38.0 38.0 38.0 36.0 38.0 15-19 36.76205 38.0 38.0 38.0 36.0 38.0 20-24 36.7726 38.0 38.0 38.0 36.0 38.0 25-29 36.722500000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.6952 38.0 38.0 38.0 36.0 38.0 35-39 36.53995 38.0 38.0 38.0 35.8 38.0 40-44 36.613749999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.5563 38.0 38.0 38.0 35.8 38.0 50-54 36.55335 38.0 38.0 38.0 35.8 38.0 55-59 36.54344999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.432249999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.314499999999995 38.0 38.0 38.0 34.8 38.0 70-74 36.27955 38.0 38.0 38.0 34.4 38.0 75-79 36.174299999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.04595 38.0 38.0 38.0 34.0 38.0 85-89 35.96855 38.0 38.0 38.0 33.6 38.0 90-94 35.8527 38.0 38.0 38.0 33.4 38.0 95-99 35.62045 38.0 37.8 38.0 31.8 38.0 100-104 35.4884 38.0 37.4 38.0 31.0 38.0 105-109 35.30825 38.0 37.2 38.0 29.8 38.0 110-114 35.0553 38.0 37.0 38.0 28.0 38.0 115-119 34.87075 38.0 36.8 38.0 27.6 38.0 120-124 34.50665 38.0 36.0 38.0 25.6 38.0 125-129 34.2693 38.0 36.0 38.0 23.4 38.0 130-134 33.874700000000004 38.0 35.2 38.0 22.2 38.0 135-139 33.2863 38.0 33.8 38.0 15.8 38.0 140-144 32.46085000000001 38.0 33.0 38.0 13.0 38.0 145-149 31.65965 38.0 32.0 38.0 8.6 38.0 150-151 27.11025 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 4.0 4 4.0 5 3.0 6 3.0 7 3.0 8 2.0 9 1.0 10 6.0 11 2.0 12 6.0 13 3.0 14 8.0 15 1.0 16 9.0 17 5.0 18 11.0 19 11.0 20 15.0 21 13.0 22 21.0 23 17.0 24 26.0 25 25.0 26 30.0 27 23.0 28 36.0 29 44.0 30 49.0 31 52.0 32 67.0 33 102.0 34 120.0 35 239.0 36 623.0 37 2391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75358310284134 20.241387980890117 13.653507669097309 26.351521247171235 2 25.220015086748802 26.276087503143074 34.29720895147096 14.206688458637165 3 21.71069182389937 27.119496855345908 31.849056603773583 19.32075471698113 4 22.666666666666664 35.42138364779874 23.371069182389938 18.540880503144656 5 23.672955974842765 38.314465408805034 22.11320754716981 15.899371069182388 6 18.00150640220939 38.11197589756465 25.30755711775044 18.57896058247552 7 18.538055764883197 18.462697814619442 42.225571464456166 20.773674956041198 8 20.0652938221999 24.63586137619287 29.15620291310899 26.14264188849824 9 21.54696132596685 24.510296333500754 29.532898041185334 24.40984429934706 10-14 23.01742755260911 28.23564863643212 26.954949525387978 21.791974285570788 15-19 22.750100441944557 28.20912012856569 28.21414222579349 20.826637203696265 20-24 23.09430551370895 27.884905091895153 28.452345083860603 20.568444310535302 25-29 22.485563645493347 28.48606577956314 28.42580969118755 20.602560883755963 30-34 22.700341434022896 28.298855191805583 28.19341233179353 20.807391042377986 35-39 22.87722821993472 27.978910369068544 28.375596284207884 20.76826512678885 40-44 22.596685082872927 28.809643395278755 28.362631843294828 20.231039678553493 45-49 23.104747550866616 27.786988193921125 28.51544837980407 20.59281587540819 50-54 22.451645315247426 28.018085908063302 28.495352926400404 21.034915850288872 55-59 23.851368315340196 27.96384634697464 27.55711775043937 20.627667587245796 60-64 22.777945164206088 27.844732349101136 28.36697800542332 21.010344481269456 65-69 23.347730012053034 28.47026918441141 27.390518280433906 20.79148252310165 70-74 23.439304906835417 27.63798905127819 28.381296770629298 20.541409271257095 75-79 23.57135683438787 27.759365270663857 28.02048809882495 20.648789796123328 80-84 23.627229339361968 27.79703592062296 27.646320020095455 20.929414719919617 85-89 23.228366229722262 27.98955351313344 27.713324293104314 21.06875596403998 90-94 23.388433904436518 28.46304577199417 27.247148671054617 20.901371652514698 95-99 23.226487138263664 27.934083601286176 27.95418006430868 20.88524919614148 100-104 23.303360626915158 27.382327824383385 28.51258351333702 20.801728035364444 105-109 23.84970865983524 28.174603174603174 28.229857343781394 19.74583082178019 110-114 23.763122206037472 28.102868049625794 27.525239841277816 20.608769903058917 115-119 23.604762143969456 27.889687044758126 28.266438941076004 20.239111870196414 120-124 23.89513860988349 27.78224186420249 27.978103656086784 20.34451586982724 125-129 24.18884982420894 27.910597689603218 28.186840783525867 19.71371170266198 130-134 24.396123135640035 28.14241952493346 27.509667051674786 19.95179028775172 135-139 24.735124278182276 27.798142103941753 27.66758724579463 19.799146372081346 140-144 24.005624748895137 27.86259541984733 27.360385697067098 20.771394134190437 145-149 24.72621320204963 28.478850597809707 26.961720084396664 19.833216115743994 150-151 24.91523295240487 28.431495667462016 27.138013311565995 19.515258068567125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 17.0 1 8.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 1.5 19 1.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 2.5 26 3.0 27 8.5 28 12.5 29 16.5 30 19.0 31 23.5 32 32.0 33 42.0 34 64.0 35 78.5 36 94.5 37 111.5 38 131.0 39 176.5 40 200.0 41 216.0 42 252.5 43 275.5 44 267.5 45 247.0 46 238.5 47 231.0 48 224.5 49 204.0 50 163.5 51 130.0 52 108.0 53 90.5 54 72.5 55 57.0 56 49.0 57 36.0 58 25.5 59 23.5 60 14.5 61 6.5 62 5.5 63 4.0 64 4.0 65 3.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.575 3 0.625 4 0.625 5 0.625 6 0.42500000000000004 7 0.475 8 0.44999999999999996 9 0.44999999999999996 10-14 0.445 15-19 0.44 20-24 0.43 25-29 0.42500000000000004 30-34 0.42 35-39 0.42500000000000004 40-44 0.44999999999999996 45-49 0.475 50-54 0.475 55-59 0.42500000000000004 60-64 0.43 65-69 0.44 70-74 0.445 75-79 0.43 80-84 0.475 85-89 0.445 90-94 0.485 95-99 0.48 100-104 0.46499999999999997 105-109 0.45999999999999996 110-114 0.455 115-119 0.46499999999999997 120-124 0.44 125-129 0.44999999999999996 130-134 0.43499999999999994 135-139 0.42500000000000004 140-144 0.44 145-149 0.47000000000000003 150-151 0.46249999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46835443037975 98.225 2 0.3291139240506329 0.65 3 0.05063291139240507 0.15 4 0.10126582278481014 0.4 5 0.0 0.0 6 0.0 0.0 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723697 spots for SRR7172517.sra Written 723697 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra Read 723695 spots for SRR7172517.sra Written 723695 spots for SRR7172517.sra SRR ids: ['SRR7172517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__x2lg3st SRR7172517.sra spots: 14473902 blocks: [[1, 723695], [723696, 1447390], [1447391, 2171085], [2171086, 2894780], [2894781, 3618475], [3618476, 4342170], [4342171, 5065865], [5065866, 5789560], [5789561, 6513255], [6513256, 7236950], [7236951, 7960645], [7960646, 8684340], [8684341, 9408035], [9408036, 10131730], [10131731, 10855425], [10855426, 11579120], [11579121, 12302815], [12302816, 13026510], [13026511, 13750205], [13750206, 14473902]] SRR7172517 file size 4883030 SRR7172517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172517 SRR7172517_1.fastq SRR7172517_2.fastq Input file: SRR7172517_1.fastq Paired file: SRR7172517_2.fastq trimmed: SRR7172517-trimmed-pair1.fastq, SRR7172517-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:01:56 2025 >> started Mon Feb 10 15:02:12 2025 >> done (16.197s) 14473902 read pairs processed; of these: 22653 ( 0.16%) short read pairs filtered out after trimming by size control 98423 ( 0.68%) empty read pairs filtered out after trimming by size control 14352826 (99.16%) read pairs available; of these: 7621908 (53.10%) trimmed read pairs available after processing 6730918 (46.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 8 0.00% 22 6 0.00% 23 10 0.00% 24 9 0.00% 25 8 0.00% 26 5 0.00% 27 11 0.00% 28 5 0.00% 29 10 0.00% 30 12 0.00% 31 9 0.00% 32 9 0.00% 33 10 0.00% 34 12 0.00% 35 16 0.00% 36 14 0.00% 37 15 0.00% 38 19 0.00% 39 18 0.00% 40 19 0.00% 41 28 0.00% 42 32 0.00% 43 26 0.00% 44 27 0.00% 45 45 0.00% 46 49 0.00% 47 50 0.00% 48 44 0.00% 49 55 0.00% 50 62 0.00% 51 68 0.00% 52 94 0.00% 53 98 0.00% 54 102 0.00% 55 117 0.00% 56 139 0.00% 57 157 0.00% 58 163 0.00% 59 183 0.00% 60 230 0.00% 61 263 0.00% 62 276 0.00% 63 300 0.00% 64 359 0.00% 65 375 0.00% 66 426 0.00% 67 483 0.00% 68 538 0.00% 69 679 0.00% 70 819 0.01% 71 885 0.01% 72 950 0.01% 73 1000 0.01% 74 1151 0.01% 75 1246 0.01% 76 1314 0.01% 77 1558 0.01% 78 1672 0.01% 79 1863 0.01% 80 2207 0.02% 81 2351 0.02% 82 2752 0.02% 83 3181 0.02% 84 4229 0.03% 85 4957 0.03% 86 5167 0.04% 87 5557 0.04% 88 5853 0.04% 89 6112 0.04% 90 6581 0.05% 91 7251 0.05% 92 7738 0.05% 93 9011 0.06% 94 9476 0.07% 95 9500 0.07% 96 9879 0.07% 97 10591 0.07% 98 10746 0.07% 99 11401 0.08% 100 12260 0.09% 101 12969 0.09% 102 13884 0.10% 103 14550 0.10% 104 15512 0.11% 105 16298 0.11% 106 17397 0.12% 107 17907 0.12% 108 18687 0.13% 109 19652 0.14% 110 20195 0.14% 111 21288 0.15% 112 22498 0.16% 113 23572 0.16% 114 24924 0.17% 115 26208 0.18% 116 27209 0.19% 117 27740 0.19% 118 29119 0.20% 119 30251 0.21% 120 31211 0.22% 121 32563 0.23% 122 33616 0.23% 123 35959 0.25% 124 37351 0.26% 125 38976 0.27% 126 40915 0.29% 127 42556 0.30% 128 43789 0.31% 129 46062 0.32% 130 48352 0.34% 131 50454 0.35% 132 53239 0.37% 133 56673 0.39% 134 59672 0.42% 135 63280 0.44% 136 67621 0.47% 137 72605 0.51% 138 76775 0.53% 139 82926 0.58% 140 89475 0.62% 141 98123 0.68% 142 109304 0.76% 143 124019 0.86% 144 146281 1.02% 145 172869 1.20% 146 217070 1.51% 147 291650 2.03% 148 436020 3.04% 149 838167 5.84% 150 3519507 24.52% 151 6730918 46.90% 14352826 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=294.71 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=11 prefix-density=0.54 prefix-fanout=2.7 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=33.14 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172517 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:02:59 Started mapping on | Feb 10 15:02:59 Finished on | Feb 10 15:04:51 Mapping speed, Million of reads per hour | 461.34 Number of input reads | 14352826 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13252627 Uniquely mapped reads % | 92.33% Average mapped length | 292.89 Number of splices: Total | 12260627 Number of splices: Annotated (sjdb) | 11965584 Number of splices: GT/AG | 12032210 Number of splices: GC/AG | 177690 Number of splices: AT/AC | 7327 Number of splices: Non-canonical | 43400 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427273 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 83521 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.93% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692268 692268 692268 N_multimapping 427273 427273 427273 N_noFeature 578960 13001823 679997 N_ambiguous 253221 874 102896 UnstrandedReadsAssigned:12420446 PositiveStrandReadsAssigned:249930 NegativeStrandReadsAssigned:12469734 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172517 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172517-trimmed-pair1.fastq SRR7172517-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,352,826 reads, 12,505,678 reads pseudoaligned [quant] estimated average fragment length: 253.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7172517.ke.tsv 34699 SRR7172517.se.tsv 87100 total ==> SRR7172517.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.83 1156 45.7926 Potri.005G024800.1.v4.1 1035 782.83 313 27.9681 Potri.004G059700.1.v4.1 961 708.98 3 0.295988 Potri.007G009000.2.v4.1 1416 1163.83 0 0 Potri.003G141000.2.v4.1 2943 2690.83 708.776 18.4251 Potri.016G087400.1.v4.1 270 80.9176 686 593.018 Potri.015G069301.1.v4.1 564 320.717 0 0 Potri.010G195200.1.v4.1 1773 1520.83 244 11.2227 Potri.012G127500.1.v4.1 977 724.939 115 11.0964 ==> SRR7172517.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 661 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 74 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7172517 completed mapping pipeline successfully