Starting /dee2/code/volunteer_pipeline.sh SRR7172630 current disk space = 3058887815168 free memory = 1440762308 SRR7172630 SRAfilesize d316ba31f3b628cfa13d94f5c351689f SRR7172630.sra SRR7172630.sra file validated SRR7172630 is paired end SRR7172630 is conventional basespace SRR7172630 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172630_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.689 32.0 18.0 33.0 18.0 33.0 2 30.57925 31.0 29.0 33.0 27.0 33.0 3 31.611 33.0 32.0 33.0 27.0 33.0 4 32.33325 33.0 33.0 33.0 32.0 34.0 5 32.75325 33.0 33.0 34.0 32.0 34.0 6 36.88275 38.0 37.0 38.0 35.0 38.0 7 37.41 38.0 38.0 38.0 37.0 38.0 8 37.48 38.0 38.0 38.0 37.0 38.0 9 37.64225 38.0 38.0 38.0 38.0 38.0 10-14 37.6456 38.0 38.0 38.0 38.0 38.0 15-19 37.63895 38.0 38.0 38.0 38.0 38.0 20-24 37.612 38.0 38.0 38.0 38.0 38.0 25-29 37.63545 38.0 38.0 38.0 38.0 38.0 30-34 37.59635 38.0 38.0 38.0 38.0 38.0 35-39 37.570350000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.51735 38.0 38.0 38.0 38.0 38.0 45-49 37.49405 38.0 38.0 38.0 38.0 38.0 50-54 37.46395 38.0 38.0 38.0 37.4 38.0 55-59 37.3583 38.0 38.0 38.0 37.0 38.0 60-64 37.33665 38.0 38.0 38.0 37.0 38.0 65-69 37.24255000000001 38.0 38.0 38.0 36.8 38.0 70-74 37.228899999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.07574999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.04605 38.0 38.0 38.0 36.0 38.0 85-89 36.88725000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.9786 38.0 38.0 38.0 36.0 38.0 95-99 37.01755 38.0 38.0 38.0 36.0 38.0 100-104 36.82065 38.0 38.0 38.0 35.4 38.0 105-109 36.59405 38.0 38.0 38.0 34.2 38.0 110-114 36.5189 38.0 38.0 38.0 34.0 38.0 115-119 36.48665 38.0 38.0 38.0 34.0 38.0 120-124 36.401250000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.06945 38.0 37.4 38.0 33.4 38.0 130-134 35.57885 38.0 36.6 38.0 31.0 38.0 135-139 35.27005 38.0 36.0 38.0 29.8 38.0 140-144 35.2525 38.0 36.0 38.0 30.6 38.0 145-149 35.09439999999999 38.0 36.0 38.0 31.0 38.0 150-151 32.09125 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 0.0 19 4.0 20 4.0 21 2.0 22 5.0 23 8.0 24 7.0 25 8.0 26 9.0 27 10.0 28 13.0 29 32.0 30 27.0 31 44.0 32 49.0 33 77.0 34 124.0 35 237.0 36 586.0 37 2748.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.98423995932893 11.4133197763091 11.362480935434673 34.2399593289273 2 22.451029633350075 17.177297840281266 36.8407835258664 23.53088900050226 3 19.175 24.725 28.000000000000004 28.1 4 22.5 31.95 22.375 23.175 5 21.0 33.675 24.85 20.474999999999998 6 17.65 35.699999999999996 26.174999999999997 20.474999999999998 7 14.6 21.6 44.0 19.8 8 18.475 21.7 30.85 28.975 9 17.875 22.55 32.675 26.900000000000002 10-14 20.544999999999998 28.849999999999998 27.534999999999997 23.07 15-19 20.169999999999998 28.599999999999998 27.525 23.705000000000002 20-24 20.07 28.835 28.144999999999996 22.95 25-29 20.09 28.794999999999998 27.83 23.285 30-34 20.095 28.08 28.065 23.76 35-39 20.8 27.615000000000002 27.91 23.674999999999997 40-44 20.04 28.305000000000003 28.08 23.575 45-49 20.215 27.98 27.750000000000004 24.055 50-54 20.674999999999997 27.944999999999997 27.595 23.785 55-59 20.34 27.965 27.935 23.76 60-64 20.51 27.655 27.92 23.915 65-69 20.3 28.78 27.38 23.54 70-74 20.474999999999998 28.02 27.93 23.575 75-79 20.52 27.605 28.110000000000003 23.765 80-84 20.775 27.735 27.6 23.89 85-89 19.99 27.500000000000004 28.225 24.285 90-94 20.49 28.189999999999998 27.534999999999997 23.785 95-99 20.805 27.834999999999997 28.09 23.27 100-104 20.73 28.1 27.845 23.325000000000003 105-109 20.31 27.915 27.939999999999998 23.835 110-114 20.82 27.93 27.560000000000002 23.69 115-119 20.62 28.095 27.700000000000003 23.585 120-124 20.979999999999997 27.27 27.939999999999998 23.810000000000002 125-129 20.715 27.565 28.375 23.345 130-134 21.185000000000002 27.815 27.339999999999996 23.66 135-139 20.794999999999998 27.715 27.595 23.895 140-144 21.145 27.445000000000004 27.134999999999998 24.275 145-149 20.755000000000003 28.050000000000004 27.73 23.465 150-151 20.65 28.075 26.637499999999996 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 2.5 25 6.5 26 5.5 27 2.5 28 3.5 29 7.0 30 13.5 31 17.5 32 27.5 33 34.5 34 46.5 35 62.0 36 77.0 37 99.0 38 120.0 39 154.5 40 193.5 41 228.0 42 255.5 43 261.0 44 279.5 45 299.5 46 295.5 47 273.5 48 244.5 49 204.5 50 162.5 51 138.5 52 112.0 53 87.0 54 76.0 55 58.0 56 40.0 57 30.5 58 18.0 59 16.0 60 13.0 61 10.0 62 6.0 63 2.0 64 1.0 65 2.5 66 4.5 67 2.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.7999999999999998 0.0 0.0 0.0 0.0 124-125 1.9875 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAT 10 0.006577216 146.82278 1 TTCTCAC 10 0.006832588 144.9875 8 TTCTTAA 10 0.006832588 144.9875 6 >>END_MODULE SRR7172630 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172630_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.165 34.0 33.0 34.0 33.0 34.0 2 33.239 34.0 33.0 34.0 33.0 34.0 3 33.2135 34.0 33.0 34.0 33.0 34.0 4 33.20675 34.0 33.0 34.0 33.0 34.0 5 33.24425 34.0 33.0 34.0 33.0 34.0 6 37.337 38.0 38.0 38.0 38.0 38.0 7 37.3135 38.0 38.0 38.0 38.0 38.0 8 37.3605 38.0 38.0 38.0 38.0 38.0 9 37.3665 38.0 38.0 38.0 38.0 38.0 10-14 37.29494999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.334649999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.29715 38.0 38.0 38.0 38.0 38.0 25-29 37.09005 38.0 38.0 38.0 37.2 38.0 30-34 36.6195 38.0 38.0 38.0 36.6 38.0 35-39 36.8251 38.0 38.0 38.0 36.8 38.0 40-44 37.14685 38.0 38.0 38.0 37.0 38.0 45-49 37.200149999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.14555 38.0 38.0 38.0 37.0 38.0 55-59 37.0657 38.0 38.0 38.0 37.0 38.0 60-64 36.932 38.0 38.0 38.0 36.0 38.0 65-69 36.8374 38.0 38.0 38.0 36.0 38.0 70-74 36.8622 38.0 38.0 38.0 36.0 38.0 75-79 36.821400000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.832499999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.72405 38.0 38.0 38.0 35.8 38.0 90-94 36.6156 38.0 38.0 38.0 35.4 38.0 95-99 36.52635 38.0 38.0 38.0 34.8 38.0 100-104 36.40990000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.33725 38.0 38.0 38.0 34.2 38.0 110-114 36.2138 38.0 38.0 38.0 33.8 38.0 115-119 35.99555 38.0 38.0 38.0 33.0 38.0 120-124 35.74515 38.0 37.4 38.0 32.2 38.0 125-129 35.53345 38.0 36.8 38.0 31.0 38.0 130-134 35.33945 38.0 36.0 38.0 30.4 38.0 135-139 34.99985 38.0 36.0 38.0 28.6 38.0 140-144 34.5272 38.0 35.6 38.0 27.2 38.0 145-149 33.8913 38.0 34.6 38.0 23.2 38.0 150-151 29.1295 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 3.0 5 0.0 6 1.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 3.0 13 1.0 14 5.0 15 0.0 16 0.0 17 5.0 18 6.0 19 7.0 20 4.0 21 4.0 22 7.0 23 4.0 24 9.0 25 10.0 26 15.0 27 22.0 28 24.0 29 38.0 30 31.0 31 42.0 32 59.0 33 90.0 34 141.0 35 258.0 36 494.0 37 2698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.4 18.075 16.775000000000002 27.750000000000004 2 24.775 24.5 33.175 17.549999999999997 3 21.625 27.900000000000002 30.475 20.0 4 25.3 34.325 22.1 18.275 5 23.925 36.35 20.549999999999997 19.175 6 19.525000000000002 38.25 23.575 18.65 7 19.925 17.849999999999998 41.375 20.849999999999998 8 20.974999999999998 23.9 26.8 28.325 9 22.6 25.2 27.800000000000004 24.4 10-14 22.770000000000003 28.675 26.155 22.400000000000002 15-19 22.59 27.845 28.194999999999997 21.37 20-24 22.535 28.395 27.334999999999997 21.735 25-29 23.01396002812092 28.643165612132172 26.895651300592547 21.447223059154364 30-34 23.13132855034855 28.13819773062637 27.603928153462576 21.12654556556251 35-39 22.76414571471759 28.487932685040562 27.419761172973246 21.328160427268607 40-44 22.84 28.48 27.41 21.27 45-49 23.419999999999998 28.244999999999997 27.644999999999996 20.69 50-54 22.905 28.854999999999997 27.33 20.91 55-59 23.155 28.075 27.825 20.945 60-64 22.875 28.105000000000004 27.805000000000003 21.215 65-69 23.275000000000002 28.16 27.83 20.735 70-74 23.315 27.83 27.834999999999997 21.02 75-79 23.935000000000002 28.04 27.544999999999998 20.48 80-84 23.794999999999998 27.62 27.91 20.674999999999997 85-89 23.380000000000003 27.694999999999997 27.810000000000002 21.115000000000002 90-94 23.665 28.494999999999997 27.08 20.76 95-99 23.72 28.74 26.700000000000003 20.84 100-104 24.14 28.055000000000003 27.185 20.62 105-109 24.15 27.55 27.589999999999996 20.71 110-114 23.810000000000002 28.13 27.279999999999998 20.78 115-119 24.154999999999998 28.62 26.884999999999998 20.34 120-124 23.849999999999998 28.095 27.365000000000002 20.69 125-129 24.36 28.405 26.77 20.465 130-134 24.745 27.915 27.089999999999996 20.25 135-139 23.485 28.075 27.865000000000002 20.575 140-144 24.075 28.12 27.255000000000003 20.549999999999997 145-149 24.385 28.084999999999997 27.145000000000003 20.385 150-151 25.362499999999997 27.825 26.474999999999998 20.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 2.0 26 3.5 27 3.0 28 2.5 29 3.5 30 6.0 31 12.5 32 19.0 33 22.0 34 32.0 35 55.5 36 77.0 37 89.0 38 112.5 39 161.0 40 214.5 41 245.5 42 273.5 43 311.5 44 309.0 45 285.0 46 286.5 47 262.5 48 234.5 49 209.0 50 184.0 51 157.5 52 103.0 53 72.0 54 61.0 55 51.5 56 35.0 57 24.0 58 19.5 59 14.5 60 11.0 61 6.5 62 5.0 63 5.5 64 4.0 65 2.0 66 2.5 67 2.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.43 30-34 1.735 35-39 0.765 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.6624999999999996 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652524 spots for SRR7172630.sra Written 652524 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra Read 652507 spots for SRR7172630.sra Written 652507 spots for SRR7172630.sra SRR ids: ['SRR7172630.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4ojf65t5 SRR7172630.sra spots: 13050157 blocks: [[1, 652507], [652508, 1305014], [1305015, 1957521], [1957522, 2610028], [2610029, 3262535], [3262536, 3915042], [3915043, 4567549], [4567550, 5220056], [5220057, 5872563], [5872564, 6525070], [6525071, 7177577], [7177578, 7830084], [7830085, 8482591], [8482592, 9135098], [9135099, 9787605], [9787606, 10440112], [10440113, 11092619], [11092620, 11745126], [11745127, 12397633], [12397634, 13050157]] SRR7172630 file size 4400569 SRR7172630 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172630 SRR7172630_1.fastq SRR7172630_2.fastq Input file: SRR7172630_1.fastq Paired file: SRR7172630_2.fastq trimmed: SRR7172630-trimmed-pair1.fastq, SRR7172630-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:25:55 2025 >> started Mon Feb 10 11:26:15 2025 >> done (20.089s) 13050157 read pairs processed; of these: 16260 ( 0.12%) short read pairs filtered out after trimming by size control 10627 ( 0.08%) empty read pairs filtered out after trimming by size control 13023270 (99.79%) read pairs available; of these: 5303426 (40.72%) trimmed read pairs available after processing 7719844 (59.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 3 0.00% 36 4 0.00% 37 3 0.00% 38 3 0.00% 39 3 0.00% 40 2 0.00% 41 3 0.00% 42 3 0.00% 43 2 0.00% 44 4 0.00% 45 5 0.00% 46 7 0.00% 47 4 0.00% 48 8 0.00% 49 14 0.00% 50 15 0.00% 51 8 0.00% 52 10 0.00% 53 15 0.00% 54 18 0.00% 55 16 0.00% 56 21 0.00% 57 32 0.00% 58 31 0.00% 59 30 0.00% 60 31 0.00% 61 52 0.00% 62 40 0.00% 63 57 0.00% 64 54 0.00% 65 80 0.00% 66 66 0.00% 67 81 0.00% 68 119 0.00% 69 107 0.00% 70 132 0.00% 71 150 0.00% 72 170 0.00% 73 216 0.00% 74 232 0.00% 75 277 0.00% 76 295 0.00% 77 363 0.00% 78 444 0.00% 79 459 0.00% 80 543 0.00% 81 635 0.00% 82 736 0.01% 83 917 0.01% 84 1798 0.01% 85 2384 0.02% 86 2433 0.02% 87 2652 0.02% 88 2835 0.02% 89 2874 0.02% 90 2935 0.02% 91 3111 0.02% 92 3295 0.03% 93 3366 0.03% 94 3670 0.03% 95 3938 0.03% 96 4270 0.03% 97 4607 0.04% 98 4646 0.04% 99 5279 0.04% 100 5399 0.04% 101 5931 0.05% 102 6413 0.05% 103 6924 0.05% 104 7352 0.06% 105 8214 0.06% 106 8685 0.07% 107 9019 0.07% 108 9738 0.07% 109 10084 0.08% 110 10711 0.08% 111 11371 0.09% 112 11914 0.09% 113 12808 0.10% 114 13813 0.11% 115 14808 0.11% 116 15723 0.12% 117 15985 0.12% 118 16854 0.13% 119 17765 0.14% 120 18588 0.14% 121 19272 0.15% 122 20320 0.16% 123 21232 0.16% 124 22669 0.17% 125 23755 0.18% 126 24886 0.19% 127 25802 0.20% 128 26966 0.21% 129 28081 0.22% 130 29599 0.23% 131 30935 0.24% 132 33118 0.25% 133 35042 0.27% 134 36844 0.28% 135 38505 0.30% 136 41236 0.32% 137 43150 0.33% 138 45852 0.35% 139 48538 0.37% 140 51650 0.40% 141 56553 0.43% 142 61971 0.48% 143 68319 0.52% 144 78082 0.60% 145 92001 0.71% 146 114625 0.88% 147 150966 1.16% 148 229328 1.76% 149 557435 4.28% 150 2947952 22.64% 151 7719844 59.28% 13023270 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=8.62 fanout-score-rank=11 prefix-density=0.27 prefix-fanout=4.5 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=63.34 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=17.3 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=48.82 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=13.5 sequence=TTGAGAAGAAGG SRR7172630 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:27:35 Started mapping on | Feb 10 11:27:35 Finished on | Feb 10 11:29:25 Mapping speed, Million of reads per hour | 426.22 Number of input reads | 13023270 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12123732 Uniquely mapped reads % | 93.09% Average mapped length | 296.18 Number of splices: Total | 12925546 Number of splices: Annotated (sjdb) | 12712833 Number of splices: GT/AG | 12726103 Number of splices: GC/AG | 159631 Number of splices: AT/AC | 9698 Number of splices: Non-canonical | 30114 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402050 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 42222 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513282 513282 513282 N_multimapping 402050 402050 402050 N_noFeature 224934 12017128 268218 N_ambiguous 123371 767 59591 UnstrandedReadsAssigned:11775427 PositiveStrandReadsAssigned:105837 NegativeStrandReadsAssigned:11795923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172630 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172630-trimmed-pair1.fastq SRR7172630-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,023,270 reads, 11,766,159 reads pseudoaligned [quant] estimated average fragment length: 243.888 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR7172630.ke.tsv 34699 SRR7172630.se.tsv 87100 total ==> SRR7172630.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.11 960.59 43.0783 Potri.005G024800.1.v4.1 1035 792.112 426 42.8124 Potri.004G059700.1.v4.1 961 718.123 98 10.8636 Potri.007G009000.2.v4.1 1416 1173.11 0 0 Potri.003G141000.2.v4.1 2943 2700.11 261 7.69494 Potri.016G087400.1.v4.1 270 75.3555 929 981.402 Potri.015G069301.1.v4.1 564 324.868 0 0 Potri.010G195200.1.v4.1 1773 1530.11 174 9.05258 Potri.012G127500.1.v4.1 977 734.118 2240 242.901 ==> SRR7172630.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 174 SRR7172630 completed mapping pipeline successfully