Starting /dee2/code/volunteer_pipeline.sh SRR7172631 current disk space = 3059067719680 free memory = 1418512144 SRR7172631 SRAfilesize b4ba07eea660856c7bc03e08ed8a9cfb SRR7172631.sra SRR7172631.sra file validated SRR7172631 is paired end SRR7172631 is conventional basespace SRR7172631 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172631_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.754 32.0 27.0 33.0 18.0 34.0 2 31.5165 33.0 32.0 33.0 27.0 34.0 3 31.7645 33.0 31.0 33.0 28.0 34.0 4 32.2175 33.0 33.0 33.0 31.0 34.0 5 32.8095 33.0 33.0 34.0 32.0 34.0 6 37.073 38.0 37.0 38.0 36.0 38.0 7 37.51525 38.0 38.0 38.0 37.0 38.0 8 37.669 38.0 38.0 38.0 38.0 38.0 9 37.667 38.0 38.0 38.0 38.0 38.0 10-14 37.695949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.621249999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6351 38.0 38.0 38.0 38.0 38.0 25-29 37.636900000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.6261 38.0 38.0 38.0 38.0 38.0 35-39 37.64155 38.0 38.0 38.0 38.0 38.0 40-44 37.5455 38.0 38.0 38.0 38.0 38.0 45-49 37.511100000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.496050000000004 38.0 38.0 38.0 37.8 38.0 55-59 37.40805 38.0 38.0 38.0 37.2 38.0 60-64 37.32815 38.0 38.0 38.0 37.0 38.0 65-69 37.267250000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.218450000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.166399999999996 38.0 38.0 38.0 36.4 38.0 80-84 37.03625 38.0 38.0 38.0 36.0 38.0 85-89 36.93415 38.0 38.0 38.0 35.8 38.0 90-94 37.00985 38.0 38.0 38.0 36.0 38.0 95-99 36.949299999999994 38.0 38.0 38.0 35.8 38.0 100-104 36.8689 38.0 38.0 38.0 35.2 38.0 105-109 36.61265 38.0 38.0 38.0 34.4 38.0 110-114 36.455850000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.2109 38.0 38.0 38.0 34.0 38.0 120-124 36.3204 38.0 38.0 38.0 34.0 38.0 125-129 36.047200000000004 38.0 37.4 38.0 33.2 38.0 130-134 35.5533 38.0 36.2 38.0 31.2 38.0 135-139 35.29755 38.0 36.0 38.0 30.6 38.0 140-144 35.11409999999999 38.0 36.0 38.0 28.6 38.0 145-149 34.705999999999996 38.0 35.4 38.0 28.2 38.0 150-151 30.93275 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 0.0 19 3.0 20 3.0 21 3.0 22 2.0 23 9.0 24 6.0 25 7.0 26 9.0 27 9.0 28 27.0 29 22.0 30 26.0 31 51.0 32 60.0 33 83.0 34 108.0 35 241.0 36 616.0 37 2710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.40638681431882 15.117177440123616 11.92377028071079 38.55266546484677 2 19.837439674879352 20.701041402082804 36.271272542545084 23.19024638049276 3 19.725 28.249999999999996 25.75 26.275 4 22.275 34.825 20.75 22.15 5 21.2 36.199999999999996 23.525 19.075 6 17.925 35.099999999999994 25.924999999999997 21.05 7 14.099999999999998 22.475 43.35 20.075000000000003 8 18.15 22.025 30.25 29.575000000000003 9 17.775 22.575 32.800000000000004 26.85 10-14 19.38 29.57 27.045 24.005000000000003 15-19 19.415 29.080000000000002 27.88 23.625 20-24 19.98 28.945 27.675 23.400000000000002 25-29 19.88 29.695 27.495000000000005 22.93 30-34 19.75 28.29 28.410000000000004 23.549999999999997 35-39 20.16 28.615000000000002 27.534999999999997 23.69 40-44 20.645 28.595 27.435 23.325000000000003 45-49 19.915 28.634999999999998 28.09 23.36 50-54 19.575 28.235 28.21 23.98 55-59 20.39 28.48 27.495000000000005 23.635 60-64 19.825 28.415000000000003 27.345000000000002 24.415 65-69 19.744999999999997 28.12 28.165000000000003 23.97 70-74 20.064999999999998 28.665000000000003 27.315 23.955000000000002 75-79 20.325 28.095 27.125 24.455 80-84 20.755000000000003 28.29 27.395000000000003 23.56 85-89 20.53 28.18 27.855 23.435 90-94 20.075000000000003 28.665000000000003 27.474999999999998 23.785 95-99 20.605 27.950000000000003 27.625 23.82 100-104 20.145 28.785 27.544999999999998 23.525 105-109 20.775 27.500000000000004 27.46 24.265 110-114 20.798718846962267 28.185366830147135 27.800020018016212 23.21589430487439 115-119 20.658171967492724 27.98735828233169 27.475669710043142 23.878800040132436 120-124 20.51 27.284999999999997 27.915 24.29 125-129 20.565 28.095 27.665 23.674999999999997 130-134 21.21 27.975 27.235 23.580000000000002 135-139 20.935000000000002 27.694999999999997 27.55 23.82 140-144 21.085 28.21 26.985 23.72 145-149 21.3 28.38 26.325 23.995 150-151 20.7625 27.6 27.6375 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 1.0 23 1.0 24 1.0 25 1.5 26 4.5 27 6.5 28 10.5 29 14.5 30 16.5 31 28.0 32 38.5 33 36.0 34 48.0 35 70.0 36 95.5 37 118.0 38 137.5 39 151.5 40 190.5 41 245.5 42 267.5 43 262.5 44 259.5 45 271.5 46 272.0 47 253.0 48 232.5 49 205.5 50 155.5 51 117.5 52 105.5 53 94.0 54 72.5 55 51.5 56 40.5 57 31.5 58 20.5 59 16.0 60 11.0 61 7.5 62 8.0 63 7.0 64 4.5 65 3.5 66 2.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 1.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.33 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.9 0.0 0.0 0.0 0.0 134-135 6.5375 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACCT 10 0.0058719916 152.42105 1 ACACATT 10 0.0068590776 144.79999 3 GCAAAAT 10 0.0068590776 144.79999 7 >>END_MODULE SRR7172631 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172631_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25075 34.0 33.0 34.0 33.0 34.0 2 33.3085 34.0 33.0 34.0 33.0 34.0 3 33.1875 34.0 33.0 34.0 33.0 34.0 4 33.28775 34.0 33.0 34.0 33.0 34.0 5 33.294 34.0 33.0 34.0 33.0 34.0 6 37.4285 38.0 38.0 38.0 38.0 38.0 7 37.37725 38.0 38.0 38.0 38.0 38.0 8 37.438 38.0 38.0 38.0 38.0 38.0 9 37.37675 38.0 38.0 38.0 38.0 38.0 10-14 37.382799999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.360350000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.372550000000004 38.0 38.0 38.0 38.0 38.0 25-29 36.97805 38.0 38.0 38.0 37.8 38.0 30-34 36.34855 38.0 38.0 38.0 37.0 38.0 35-39 36.60825 38.0 38.0 38.0 36.4 38.0 40-44 37.2063 38.0 38.0 38.0 37.4 38.0 45-49 37.274249999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.25335 38.0 38.0 38.0 38.0 38.0 55-59 37.203050000000005 38.0 38.0 38.0 37.2 38.0 60-64 37.04105 38.0 38.0 38.0 36.8 38.0 65-69 37.00345 38.0 38.0 38.0 37.0 38.0 70-74 36.96465 38.0 38.0 38.0 36.6 38.0 75-79 36.9883 38.0 38.0 38.0 36.6 38.0 80-84 36.8468 38.0 38.0 38.0 36.0 38.0 85-89 36.83545 38.0 38.0 38.0 36.0 38.0 90-94 36.752449999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.6671 38.0 38.0 38.0 35.0 38.0 100-104 36.54975 38.0 38.0 38.0 34.8 38.0 105-109 36.4569 38.0 38.0 38.0 34.4 38.0 110-114 36.33385 38.0 38.0 38.0 34.2 38.0 115-119 36.15474999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.000299999999996 38.0 38.0 38.0 33.4 38.0 125-129 35.77925 38.0 37.4 38.0 32.4 38.0 130-134 35.48225 38.0 36.4 38.0 31.4 38.0 135-139 35.2085 38.0 36.0 38.0 30.0 38.0 140-144 34.9423 38.0 36.0 38.0 30.0 38.0 145-149 33.8913 38.0 34.2 38.0 22.8 38.0 150-151 29.85775 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 2.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 2.0 12 4.0 13 3.0 14 2.0 15 2.0 16 0.0 17 3.0 18 4.0 19 2.0 20 7.0 21 4.0 22 5.0 23 8.0 24 7.0 25 11.0 26 18.0 27 20.0 28 19.0 29 26.0 30 25.0 31 47.0 32 64.0 33 71.0 34 155.0 35 229.0 36 493.0 37 2751.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.25 14.549999999999999 17.0 30.2 2 26.85 22.325 32.95 17.875 3 23.150000000000002 26.25 30.2 20.4 4 25.4 33.825 20.625 20.150000000000002 5 24.474999999999998 37.325 20.599999999999998 17.599999999999998 6 18.45 39.300000000000004 22.900000000000002 19.35 7 19.3 17.875 40.35 22.475 8 22.275 23.9 26.75 27.075 9 21.45 25.4 28.199999999999996 24.95 10-14 23.07 29.48 26.035000000000004 21.415 15-19 23.0 28.610000000000003 27.305 21.085 20-24 22.61 28.4 27.794999999999998 21.195 25-29 23.32137624412671 27.934118122568584 27.36826150659324 21.376244126711462 30-34 23.121595230753417 27.84458834412581 28.101552060849006 20.932264364271767 35-39 23.190906322947324 28.05236983659799 27.412970668831825 21.343753171622858 40-44 22.7 27.955000000000002 27.55 21.795 45-49 23.35 27.58 27.83 21.240000000000002 50-54 23.09 27.655 27.950000000000003 21.305 55-59 23.655 28.26 27.169999999999998 20.915 60-64 23.075000000000003 27.875 27.87 21.18 65-69 24.03 27.860000000000003 27.750000000000004 20.36 70-74 24.05 28.105000000000004 27.51 20.335 75-79 23.336166808340415 27.461373068653433 28.23141157057853 20.97104855242762 80-84 23.580000000000002 28.485 27.375 20.560000000000002 85-89 23.544999999999998 28.555000000000003 27.455000000000002 20.445 90-94 23.625 27.85 27.889999999999997 20.635 95-99 23.815 27.994999999999997 27.505000000000003 20.685000000000002 100-104 24.445 28.055000000000003 27.150000000000002 20.349999999999998 105-109 24.11 27.805000000000003 27.474999999999998 20.61 110-114 24.375 27.794999999999998 27.650000000000002 20.18 115-119 23.695 28.24 27.62 20.445 120-124 24.005000000000003 28.34 27.605 20.05 125-129 24.615000000000002 28.144999999999996 27.3 19.939999999999998 130-134 24.099999999999998 27.810000000000002 28.015 20.075000000000003 135-139 25.31 28.825 26.590000000000003 19.275000000000002 140-144 25.085 28.185 26.715 20.015 145-149 25.480000000000004 27.810000000000002 26.889999999999997 19.82 150-151 25.587500000000002 27.875 27.0875 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 4.0 27 4.5 28 3.0 29 5.5 30 10.5 31 17.0 32 22.5 33 27.5 34 41.5 35 54.0 36 72.5 37 103.5 38 124.0 39 150.5 40 188.5 41 222.5 42 272.5 43 294.0 44 286.5 45 286.5 46 283.0 47 266.0 48 241.5 49 214.5 50 172.0 51 134.5 52 110.0 53 96.0 54 75.0 55 53.0 56 38.5 57 25.0 58 17.5 59 14.5 60 12.5 61 10.0 62 9.0 63 8.0 64 6.0 65 3.5 66 3.0 67 2.0 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 1.035 30-34 2.71 35-39 1.47 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATG 10 0.0068857023 144.61249 9 >>END_MODULE Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689694 spots for SRR7172631.sra Written 689694 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra Read 689686 spots for SRR7172631.sra Written 689686 spots for SRR7172631.sra SRR ids: ['SRR7172631.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0g7rk1w0 SRR7172631.sra spots: 13793728 blocks: [[1, 689686], [689687, 1379372], [1379373, 2069058], [2069059, 2758744], [2758745, 3448430], [3448431, 4138116], [4138117, 4827802], [4827803, 5517488], [5517489, 6207174], [6207175, 6896860], [6896861, 7586546], [7586547, 8276232], [8276233, 8965918], [8965919, 9655604], [9655605, 10345290], [10345291, 11034976], [11034977, 11724662], [11724663, 12414348], [12414349, 13104034], [13104035, 13793728]] SRR7172631 file size 4652541 SRR7172631 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172631 SRR7172631_1.fastq SRR7172631_2.fastq Input file: SRR7172631_1.fastq Paired file: SRR7172631_2.fastq trimmed: SRR7172631-trimmed-pair1.fastq, SRR7172631-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:39:01 2025 >> started Mon Feb 10 11:39:17 2025 >> done (16.464s) 13793728 read pairs processed; of these: 10922 ( 0.08%) short read pairs filtered out after trimming by size control 6797 ( 0.05%) empty read pairs filtered out after trimming by size control 13776009 (99.87%) read pairs available; of these: 5641488 (40.95%) trimmed read pairs available after processing 8134521 (59.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 4 0.00% 37 1 0.00% 38 7 0.00% 39 6 0.00% 40 2 0.00% 41 4 0.00% 42 4 0.00% 43 5 0.00% 44 8 0.00% 45 5 0.00% 46 9 0.00% 47 5 0.00% 48 3 0.00% 49 11 0.00% 50 14 0.00% 51 15 0.00% 52 17 0.00% 53 19 0.00% 54 16 0.00% 55 28 0.00% 56 33 0.00% 57 43 0.00% 58 46 0.00% 59 48 0.00% 60 69 0.00% 61 71 0.00% 62 89 0.00% 63 105 0.00% 64 133 0.00% 65 156 0.00% 66 180 0.00% 67 158 0.00% 68 226 0.00% 69 255 0.00% 70 319 0.00% 71 353 0.00% 72 388 0.00% 73 475 0.00% 74 566 0.00% 75 636 0.00% 76 753 0.01% 77 840 0.01% 78 949 0.01% 79 1148 0.01% 80 1229 0.01% 81 1438 0.01% 82 1674 0.01% 83 1895 0.01% 84 2800 0.02% 85 3378 0.02% 86 3776 0.03% 87 4147 0.03% 88 4362 0.03% 89 4484 0.03% 90 4805 0.03% 91 5254 0.04% 92 5702 0.04% 93 6134 0.04% 94 6842 0.05% 95 7372 0.05% 96 7771 0.06% 97 8132 0.06% 98 8756 0.06% 99 9547 0.07% 100 10116 0.07% 101 10996 0.08% 102 11779 0.09% 103 12659 0.09% 104 13624 0.10% 105 14486 0.11% 106 15120 0.11% 107 15965 0.12% 108 16654 0.12% 109 17562 0.13% 110 18697 0.14% 111 19602 0.14% 112 20334 0.15% 113 21653 0.16% 114 23005 0.17% 115 24073 0.17% 116 25483 0.18% 117 26265 0.19% 118 27171 0.20% 119 27993 0.20% 120 29252 0.21% 121 30691 0.22% 122 31777 0.23% 123 32835 0.24% 124 34707 0.25% 125 35636 0.26% 126 37422 0.27% 127 38871 0.28% 128 39844 0.29% 129 41595 0.30% 130 42865 0.31% 131 44231 0.32% 132 46609 0.34% 133 48265 0.35% 134 50586 0.37% 135 52485 0.38% 136 54121 0.39% 137 56909 0.41% 138 59527 0.43% 139 62831 0.46% 140 66900 0.49% 141 70564 0.51% 142 75704 0.55% 143 82145 0.60% 144 92030 0.67% 145 104897 0.76% 146 124108 0.90% 147 160419 1.16% 148 234456 1.70% 149 451921 3.28% 150 2826286 20.52% 151 8134521 59.05% 13776009 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.56 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.4 sequence=AAGGATCTCTCTCCTTTAACGACACCATCATTGTAAAGGAACAACTGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=48.84 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.8 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=28 prefix-density=0.22 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=384.67 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=31.2 sequence=AAGAAGAAGAAA SRR7172631 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:40:01 Started mapping on | Feb 10 11:40:02 Finished on | Feb 10 11:41:28 Mapping speed, Million of reads per hour | 576.67 Number of input reads | 13776009 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12832250 Uniquely mapped reads % | 93.15% Average mapped length | 294.14 Number of splices: Total | 12770961 Number of splices: Annotated (sjdb) | 12551746 Number of splices: GT/AG | 12570370 Number of splices: GC/AG | 161455 Number of splices: AT/AC | 9367 Number of splices: Non-canonical | 29769 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328737 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 58013 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 627252 627252 627252 N_multimapping 328737 328737 328737 N_noFeature 308444 12710890 361302 N_ambiguous 127488 1099 58301 UnstrandedReadsAssigned:12396318 PositiveStrandReadsAssigned:120261 NegativeStrandReadsAssigned:12412647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172631 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172631-trimmed-pair1.fastq SRR7172631-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,776,009 reads, 12,393,841 reads pseudoaligned [quant] estimated average fragment length: 224.525 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7172631.ke.tsv 34699 SRR7172631.se.tsv 87100 total ==> SRR7172631.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.48 765 34.3873 Potri.005G024800.1.v4.1 1035 811.475 176 17.4949 Potri.004G059700.1.v4.1 961 737.475 13 1.4219 Potri.007G009000.2.v4.1 1416 1192.48 0 0 Potri.003G141000.2.v4.1 2943 2719.48 439.295 13.03 Potri.016G087400.1.v4.1 270 83.6798 825 795.257 Potri.015G069301.1.v4.1 564 342.788 0 0 Potri.010G195200.1.v4.1 1773 1549.48 108 5.62229 Potri.012G127500.1.v4.1 977 753.475 1779 190.45 ==> SRR7172631.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 205 SRR7172631 completed mapping pipeline successfully