Starting /dee2/code/volunteer_pipeline.sh SRR7172632 current disk space = 3059043299328 free memory = 1414543112 SRR7172632 SRAfilesize 49efb26c1e3e093f46ffd9462a4d615e SRR7172632.sra SRR7172632.sra file validated SRR7172632 is paired end SRR7172632 is conventional basespace SRR7172632 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2065 33.0 33.0 34.0 32.0 34.0 2 32.677 33.0 33.0 34.0 32.0 34.0 3 32.8755 33.0 33.0 34.0 32.0 34.0 4 32.58825 33.0 33.0 34.0 31.0 34.0 5 32.9835 33.0 33.0 34.0 32.0 34.0 6 36.93725 38.0 37.0 38.0 35.0 38.0 7 37.427 38.0 38.0 38.0 37.0 38.0 8 37.56275 38.0 38.0 38.0 38.0 38.0 9 37.58375 38.0 38.0 38.0 38.0 38.0 10-14 37.62845 38.0 38.0 38.0 38.0 38.0 15-19 37.6431 38.0 38.0 38.0 38.0 38.0 20-24 37.551750000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.6123 38.0 38.0 38.0 38.0 38.0 30-34 37.598850000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.5717 38.0 38.0 38.0 38.0 38.0 40-44 37.49755 38.0 38.0 38.0 38.0 38.0 45-49 37.495 38.0 38.0 38.0 38.0 38.0 50-54 37.405950000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.290549999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.26809999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.22235 38.0 38.0 38.0 36.8 38.0 70-74 37.11355 38.0 38.0 38.0 36.4 38.0 75-79 37.015 38.0 38.0 38.0 36.0 38.0 80-84 36.981550000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.7358 38.0 38.0 38.0 34.6 38.0 90-94 36.878699999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.8558 38.0 38.0 38.0 35.4 38.0 100-104 36.673500000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.278800000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.0837 38.0 37.6 38.0 33.0 38.0 115-119 36.04005 38.0 37.0 38.0 32.4 38.0 120-124 36.223349999999996 38.0 38.0 38.0 33.6 38.0 125-129 36.03375 38.0 37.2 38.0 32.8 38.0 130-134 35.62 38.0 36.2 38.0 31.0 38.0 135-139 35.2771 38.0 36.0 38.0 29.2 38.0 140-144 35.2544 38.0 36.0 38.0 30.0 38.0 145-149 35.093450000000004 38.0 35.8 38.0 30.4 38.0 150-151 31.58925 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 0.0 20 1.0 21 3.0 22 5.0 23 4.0 24 6.0 25 9.0 26 8.0 27 17.0 28 22.0 29 33.0 30 32.0 31 52.0 32 60.0 33 87.0 34 138.0 35 219.0 36 601.0 37 2694.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.66488140780413 13.2109155827595 13.287426676868147 39.83677633256823 2 20.98517215380749 20.532797185222417 38.5272681578286 19.95476250314149 3 18.45 26.724999999999998 26.474999999999998 28.349999999999998 4 22.650000000000002 33.75 21.7 21.9 5 21.099999999999998 35.925000000000004 25.0 17.974999999999998 6 16.0 36.95 26.450000000000003 20.599999999999998 7 13.225000000000001 21.55 45.525 19.7 8 17.8 23.200000000000003 30.775000000000002 28.225 9 18.7 21.375 32.925 27.0 10-14 19.765 28.96 27.24 24.035 15-19 19.84 28.110000000000003 28.28 23.77 20-24 19.835 28.349999999999998 27.76 24.055 25-29 20.044999999999998 27.935 28.365000000000002 23.655 30-34 20.155 28.249999999999996 27.894999999999996 23.7 35-39 19.845 28.720000000000002 27.950000000000003 23.485 40-44 20.3 28.904999999999998 27.67 23.125 45-49 20.560000000000002 28.845 27.22 23.375 50-54 20.625 28.77 27.284999999999997 23.32 55-59 20.48 28.825 27.295 23.400000000000002 60-64 19.869999999999997 28.52 27.875 23.735 65-69 20.22 28.27 28.044999999999998 23.465 70-74 20.51 28.389999999999997 27.66 23.44 75-79 19.785 28.24 28.015 23.96 80-84 20.580000000000002 27.775 27.97 23.674999999999997 85-89 20.315 27.950000000000003 28.16 23.575 90-94 20.225 28.720000000000002 27.83 23.225 95-99 20.435 28.044999999999998 28.515 23.005 100-104 20.765 28.475 27.77 22.99 105-109 20.495 27.800000000000004 28.12 23.585 110-114 20.67050287715787 28.641481110833123 27.430572929697274 23.257443082311735 115-119 20.255000000000003 28.249999999999996 27.625 23.87 120-124 20.549999999999997 28.255000000000003 27.465 23.73 125-129 21.07 28.59 27.095000000000002 23.244999999999997 130-134 21.154999999999998 27.950000000000003 27.26 23.635 135-139 21.04 28.165000000000003 27.465 23.330000000000002 140-144 21.044999999999998 28.1 27.450000000000003 23.405 145-149 21.05 28.425 27.365000000000002 23.16 150-151 20.825 28.15 26.7125 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 2.5 26 2.0 27 2.5 28 7.5 29 11.0 30 13.5 31 22.0 32 25.5 33 38.0 34 59.5 35 73.5 36 84.5 37 99.5 38 142.0 39 184.5 40 228.5 41 251.0 42 249.5 43 278.5 44 286.0 45 283.5 46 277.0 47 241.0 48 221.0 49 196.5 50 150.0 51 125.5 52 103.5 53 77.0 54 65.0 55 50.5 56 36.5 57 26.0 58 17.5 59 14.5 60 12.5 61 11.0 62 7.0 63 4.5 64 3.5 65 3.0 66 3.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7625000000000002 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.225 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCCTT 10 0.006577216 146.82278 1 GAAGAAC 10 0.006832588 144.9875 2 >>END_MODULE SRR7172632 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1765 34.0 33.0 34.0 33.0 34.0 2 33.239 34.0 33.0 34.0 33.0 34.0 3 33.279 34.0 33.0 34.0 33.0 34.0 4 33.338 34.0 33.0 34.0 33.0 34.0 5 33.2595 34.0 33.0 34.0 33.0 34.0 6 37.394 38.0 38.0 38.0 38.0 38.0 7 37.45825 38.0 38.0 38.0 38.0 38.0 8 37.4395 38.0 38.0 38.0 38.0 38.0 9 37.33625 38.0 38.0 38.0 38.0 38.0 10-14 37.32295 38.0 38.0 38.0 38.0 38.0 15-19 37.35379999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.3279 38.0 38.0 38.0 38.0 38.0 25-29 37.054950000000005 38.0 38.0 38.0 37.4 38.0 30-34 36.3633 38.0 38.0 38.0 36.6 38.0 35-39 36.668400000000005 38.0 38.0 38.0 36.2 38.0 40-44 37.174600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.243 38.0 38.0 38.0 37.4 38.0 50-54 37.194649999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.04225 38.0 38.0 38.0 36.8 38.0 60-64 36.932900000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.864250000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.865449999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.797799999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.85025 38.0 38.0 38.0 36.0 38.0 85-89 36.730650000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.62135 38.0 38.0 38.0 35.2 38.0 95-99 36.54755 38.0 38.0 38.0 35.0 38.0 100-104 36.52235 38.0 38.0 38.0 34.8 38.0 105-109 36.4861 38.0 38.0 38.0 34.4 38.0 110-114 36.2937 38.0 38.0 38.0 34.0 38.0 115-119 35.990899999999996 38.0 37.8 38.0 32.8 38.0 120-124 35.7501 38.0 37.2 38.0 32.2 38.0 125-129 35.55575 38.0 37.0 38.0 31.4 38.0 130-134 35.363099999999996 38.0 36.2 38.0 31.0 38.0 135-139 35.05035 38.0 36.0 38.0 28.8 38.0 140-144 34.53025 38.0 35.6 38.0 27.2 38.0 145-149 33.5745 38.0 33.2 38.0 20.8 38.0 150-151 29.11975 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 0.0 6 0.0 7 2.0 8 2.0 9 0.0 10 2.0 11 4.0 12 2.0 13 0.0 14 2.0 15 3.0 16 2.0 17 2.0 18 1.0 19 3.0 20 3.0 21 6.0 22 6.0 23 11.0 24 10.0 25 12.0 26 12.0 27 25.0 28 27.0 29 28.0 30 51.0 31 49.0 32 65.0 33 90.0 34 144.0 35 255.0 36 531.0 37 2639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.175000000000004 15.1 17.05 31.674999999999997 2 22.45 24.0 36.35 17.2 3 20.65 26.424999999999997 31.874999999999996 21.05 4 24.95 34.425 21.825 18.8 5 22.325 36.55 22.8 18.325 6 17.974999999999998 37.6 24.65 19.775000000000002 7 18.05 17.175 42.875 21.9 8 21.099999999999998 23.25 26.875 28.775000000000002 9 22.825 24.175 29.299999999999997 23.7 10-14 22.845 29.060000000000002 26.384999999999998 21.709999999999997 15-19 22.765 28.21 27.63 21.395 20-24 22.345000000000002 28.73 27.785 21.14 25-29 22.677609385227328 28.266451840290014 28.004632193746538 21.051306580736114 30-34 22.475135855634164 28.82702758125705 27.565877166000206 21.13195939710858 35-39 22.568408274745842 28.21303929998483 27.707247989479537 21.511304435789793 40-44 22.725 27.825 28.08 21.37 45-49 22.545 28.355000000000004 27.96 21.14 50-54 23.175 27.634999999999998 28.73 20.46 55-59 22.994999999999997 27.91 28.155 20.94 60-64 23.46 27.91 28.155 20.474999999999998 65-69 23.235 27.715 28.050000000000004 21.0 70-74 23.45 27.765 27.994999999999997 20.79 75-79 23.169999999999998 27.785 28.465 20.580000000000002 80-84 23.235 27.655 27.334999999999997 21.775 85-89 23.45 28.465 27.98 20.105 90-94 23.080000000000002 28.175 27.96 20.785 95-99 23.625 27.79 27.589999999999996 20.995 100-104 23.41 28.625 27.465 20.5 105-109 23.93 27.939999999999998 28.144999999999996 19.985 110-114 23.86 28.63 27.779999999999998 19.73 115-119 23.175 27.675 28.83 20.32 120-124 23.46 28.310000000000002 27.46 20.77 125-129 23.255 27.85 28.165000000000003 20.73 130-134 23.974999999999998 27.83 27.815 20.380000000000003 135-139 23.815 27.834999999999997 27.83 20.52 140-144 24.16 27.689999999999998 27.66 20.49 145-149 24.13 27.88 27.860000000000003 20.13 150-151 24.125 27.9375 27.6625 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 1.5 23 1.0 24 3.0 25 2.5 26 1.5 27 5.5 28 5.0 29 7.0 30 10.0 31 9.0 32 17.0 33 29.0 34 45.0 35 70.5 36 88.5 37 114.5 38 156.0 39 182.0 40 210.0 41 257.0 42 279.0 43 292.5 44 294.5 45 266.5 46 252.0 47 243.5 48 221.5 49 190.5 50 148.5 51 119.5 52 104.5 53 78.0 54 63.0 55 61.0 56 47.5 57 31.5 58 26.0 59 18.0 60 9.5 61 9.0 62 8.0 63 3.5 64 4.0 65 4.5 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.695 30-34 2.4699999999999998 35-39 1.145 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.3375 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649091 spots for SRR7172632.sra Written 649091 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra Read 649087 spots for SRR7172632.sra Written 649087 spots for SRR7172632.sra SRR ids: ['SRR7172632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vzsgtkvk SRR7172632.sra spots: 12981744 blocks: [[1, 649087], [649088, 1298174], [1298175, 1947261], [1947262, 2596348], [2596349, 3245435], [3245436, 3894522], [3894523, 4543609], [4543610, 5192696], [5192697, 5841783], [5841784, 6490870], [6490871, 7139957], [7139958, 7789044], [7789045, 8438131], [8438132, 9087218], [9087219, 9736305], [9736306, 10385392], [10385393, 11034479], [11034480, 11683566], [11683567, 12332653], [12332654, 12981744]] SRR7172632 file size 4377386 SRR7172632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172632 SRR7172632_1.fastq SRR7172632_2.fastq Input file: SRR7172632_1.fastq Paired file: SRR7172632_2.fastq trimmed: SRR7172632-trimmed-pair1.fastq, SRR7172632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:40:41 2025 >> started Mon Feb 10 11:41:01 2025 >> done (20.512s) 12981744 read pairs processed; of these: 9049 ( 0.07%) short read pairs filtered out after trimming by size control 6070 ( 0.05%) empty read pairs filtered out after trimming by size control 12966625 (99.88%) read pairs available; of these: 6303692 (48.61%) trimmed read pairs available after processing 6662933 (51.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 3 0.00% 34 6 0.00% 35 1 0.00% 36 3 0.00% 37 6 0.00% 38 1 0.00% 39 4 0.00% 40 5 0.00% 41 4 0.00% 42 2 0.00% 43 3 0.00% 44 5 0.00% 45 7 0.00% 46 4 0.00% 47 6 0.00% 48 6 0.00% 49 8 0.00% 50 9 0.00% 51 14 0.00% 52 14 0.00% 53 12 0.00% 54 16 0.00% 55 16 0.00% 56 17 0.00% 57 20 0.00% 58 30 0.00% 59 27 0.00% 60 26 0.00% 61 43 0.00% 62 40 0.00% 63 52 0.00% 64 48 0.00% 65 64 0.00% 66 63 0.00% 67 74 0.00% 68 77 0.00% 69 85 0.00% 70 112 0.00% 71 158 0.00% 72 169 0.00% 73 181 0.00% 74 209 0.00% 75 277 0.00% 76 306 0.00% 77 349 0.00% 78 358 0.00% 79 444 0.00% 80 502 0.00% 81 602 0.00% 82 694 0.01% 83 788 0.01% 84 1369 0.01% 85 1768 0.01% 86 1837 0.01% 87 1976 0.02% 88 2142 0.02% 89 2207 0.02% 90 2316 0.02% 91 2463 0.02% 92 2750 0.02% 93 2878 0.02% 94 3048 0.02% 95 3235 0.02% 96 3508 0.03% 97 3838 0.03% 98 4074 0.03% 99 4308 0.03% 100 4653 0.04% 101 4997 0.04% 102 5449 0.04% 103 5929 0.05% 104 6336 0.05% 105 6935 0.05% 106 7157 0.06% 107 7697 0.06% 108 8199 0.06% 109 8873 0.07% 110 9208 0.07% 111 9907 0.08% 112 10614 0.08% 113 11408 0.09% 114 11877 0.09% 115 12753 0.10% 116 13329 0.10% 117 14027 0.11% 118 15082 0.12% 119 15556 0.12% 120 16149 0.12% 121 17071 0.13% 122 17673 0.14% 123 19021 0.15% 124 20205 0.16% 125 21549 0.17% 126 22310 0.17% 127 23719 0.18% 128 24411 0.19% 129 25589 0.20% 130 27355 0.21% 131 28992 0.22% 132 30729 0.24% 133 32595 0.25% 134 34766 0.27% 135 36937 0.28% 136 39637 0.31% 137 42348 0.33% 138 45430 0.35% 139 49492 0.38% 140 53694 0.41% 141 58593 0.45% 142 66154 0.51% 143 74737 0.58% 144 86413 0.67% 145 104630 0.81% 146 133008 1.03% 147 180533 1.39% 148 290019 2.24% 149 686619 5.30% 150 3753629 28.95% 151 6662933 51.39% 12966625 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.74 fanout-score-rank=15 prefix-density=0.25 prefix-fanout=4.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=74.43 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.4 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=41 prefix-density=0.13 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=117.82 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=21.7 sequence=GAAGAAGAGAGG SRR7172632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:41:50 Started mapping on | Feb 10 11:41:50 Finished on | Feb 10 11:43:56 Mapping speed, Million of reads per hour | 370.48 Number of input reads | 12966625 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12026885 Uniquely mapped reads % | 92.75% Average mapped length | 296.53 Number of splices: Total | 12321522 Number of splices: Annotated (sjdb) | 12111620 Number of splices: GT/AG | 12121839 Number of splices: GC/AG | 160130 Number of splices: AT/AC | 9880 Number of splices: Non-canonical | 29673 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297612 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 27789 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651323 651323 651323 N_multimapping 297612 297612 297612 N_noFeature 314279 11924622 364295 N_ambiguous 113512 747 60745 UnstrandedReadsAssigned:11599094 PositiveStrandReadsAssigned:101516 NegativeStrandReadsAssigned:11601845 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172632-trimmed-pair1.fastq SRR7172632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,966,625 reads, 11,500,967 reads pseudoaligned [quant] estimated average fragment length: 251.83 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7172632.ke.tsv 34699 SRR7172632.se.tsv 87100 total ==> SRR7172632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.17 854 43.2948 Potri.005G024800.1.v4.1 1035 784.17 268 30.6183 Potri.004G059700.1.v4.1 961 710.192 34 4.28903 Potri.007G009000.2.v4.1 1416 1165.17 0 0 Potri.003G141000.2.v4.1 2943 2692.17 450 14.975 Potri.016G087400.1.v4.1 270 73.3456 736.421 899.515 Potri.015G069301.1.v4.1 564 317.86 0 0 Potri.010G195200.1.v4.1 1773 1522.17 286 16.8329 Potri.012G127500.1.v4.1 977 726.181 9135 1126.99 ==> SRR7172632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 303 SRR7172632 completed mapping pipeline successfully