Starting /dee2/code/volunteer_pipeline.sh SRR7172633 current disk space = 3058857848832 free memory = 1536243056 SRR7172633 SRAfilesize c85d6cfa1aec4e85018c1b631a774b56 SRR7172633.sra SRR7172633.sra file validated SRR7172633 is paired end SRR7172633 is conventional basespace SRR7172633 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.737 32.0 25.0 33.0 18.0 34.0 2 31.244 33.0 32.0 33.0 27.0 34.0 3 31.59475 33.0 31.0 33.0 28.0 34.0 4 32.05725 33.0 32.0 33.0 31.0 34.0 5 32.824 33.0 33.0 34.0 32.0 34.0 6 37.1525 38.0 38.0 38.0 36.0 38.0 7 37.53475 38.0 38.0 38.0 37.0 38.0 8 37.55925 38.0 38.0 38.0 38.0 38.0 9 37.6205 38.0 38.0 38.0 38.0 38.0 10-14 37.6831 38.0 38.0 38.0 38.0 38.0 15-19 37.61665 38.0 38.0 38.0 38.0 38.0 20-24 37.5689 38.0 38.0 38.0 38.0 38.0 25-29 37.61005 38.0 38.0 38.0 38.0 38.0 30-34 37.630849999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.58254999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.578050000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.53375 38.0 38.0 38.0 38.0 38.0 50-54 37.43384999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.3669 38.0 38.0 38.0 37.4 38.0 60-64 37.2979 38.0 38.0 38.0 37.0 38.0 65-69 37.251999999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.2138 38.0 38.0 38.0 36.8 38.0 75-79 37.128949999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.0321 38.0 38.0 38.0 36.0 38.0 85-89 36.96085000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.97225000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.92245 38.0 38.0 38.0 36.0 38.0 100-104 36.82555 38.0 38.0 38.0 35.2 38.0 105-109 36.536699999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.448750000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.21815 38.0 38.0 38.0 33.8 38.0 120-124 36.3162 38.0 38.0 38.0 34.0 38.0 125-129 36.0617 38.0 37.6 38.0 33.0 38.0 130-134 35.55219999999999 38.0 36.2 38.0 31.0 38.0 135-139 35.2264 38.0 36.0 38.0 29.2 38.0 140-144 35.05955 38.0 36.0 38.0 28.6 38.0 145-149 34.5786 38.0 35.2 38.0 27.6 38.0 150-151 30.560000000000002 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 0.0 21 5.0 22 6.0 23 4.0 24 6.0 25 11.0 26 11.0 27 13.0 28 18.0 29 32.0 30 36.0 31 41.0 32 62.0 33 95.0 34 125.0 35 219.0 36 603.0 37 2707.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.825192802056556 12.544987146529563 12.030848329048844 43.598971722365036 2 17.946110828673106 18.86120996441281 37.417386883579056 25.77529232333503 3 18.0 22.3 25.650000000000002 34.050000000000004 4 22.375 30.3 22.225 25.1 5 22.825 33.375 24.075 19.725 6 17.625 34.949999999999996 26.400000000000002 21.025 7 14.575 20.849999999999998 44.725 19.85 8 18.425 21.875 31.3 28.4 9 17.625 23.75 34.575 24.05 10-14 18.985 28.939999999999998 28.26 23.815 15-19 19.475 27.189999999999998 28.549999999999997 24.785 20-24 19.54 28.74 27.955000000000002 23.765 25-29 19.285 28.355000000000004 28.444999999999997 23.915 30-34 19.32 28.299999999999997 28.315 24.065 35-39 19.685 28.050000000000004 28.355000000000004 23.91 40-44 19.715 28.46 27.88 23.945 45-49 20.095 27.97 27.66 24.275 50-54 20.27 27.765 27.839999999999996 24.125 55-59 19.555 28.43 28.435 23.580000000000002 60-64 20.19 27.91 27.725 24.175 65-69 20.04 27.950000000000003 27.675 24.335 70-74 20.02 28.275 27.855 23.849999999999998 75-79 20.244999999999997 27.375 28.605000000000004 23.775 80-84 20.225 27.944999999999997 27.71 24.12 85-89 19.895 28.360000000000003 27.66 24.085 90-94 20.72 27.400000000000002 28.21 23.669999999999998 95-99 19.515 27.794999999999998 28.42 24.27 100-104 19.845 28.060000000000002 28.249999999999996 23.845 105-109 20.035 28.15 28.12 23.695 110-114 20.415207603801903 27.768884442221108 28.204102051025515 23.611805902951478 115-119 20.841894262089703 28.038085692808817 27.216236532197446 23.903783512904035 120-124 20.71 28.655 26.905 23.73 125-129 20.505000000000003 28.139999999999997 27.355 24.0 130-134 20.555 27.875 27.755000000000003 23.815 135-139 20.825 28.494999999999997 27.58 23.1 140-144 20.835 27.894999999999996 27.685 23.585 145-149 21.245 28.12 26.97 23.665 150-151 20.974999999999998 28.6125 26.4625 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 6.0 28 10.0 29 14.5 30 17.5 31 20.5 32 29.0 33 36.5 34 47.5 35 63.5 36 86.0 37 110.5 38 138.5 39 169.0 40 187.0 41 229.0 42 258.0 43 262.0 44 266.0 45 275.0 46 286.5 47 267.5 48 227.5 49 198.0 50 174.5 51 148.5 52 111.5 53 85.0 54 77.0 55 48.5 56 37.0 57 32.5 58 19.0 59 14.0 60 12.5 61 9.0 62 5.0 63 3.0 64 2.0 65 1.5 66 2.0 67 1.5 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 1.6500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.22499999999999998 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9500000000000002 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.2375 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076970365 18.107813 45-49 >>END_MODULE SRR7172633 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12175 34.0 33.0 34.0 33.0 34.0 2 33.234 34.0 33.0 34.0 33.0 34.0 3 33.115 34.0 33.0 34.0 33.0 34.0 4 33.1715 34.0 33.0 34.0 33.0 34.0 5 33.20675 34.0 33.0 34.0 33.0 34.0 6 37.339 38.0 38.0 38.0 38.0 38.0 7 37.3445 38.0 38.0 38.0 38.0 38.0 8 37.279 38.0 38.0 38.0 38.0 38.0 9 37.3185 38.0 38.0 38.0 38.0 38.0 10-14 37.2427 38.0 38.0 38.0 38.0 38.0 15-19 37.27455 38.0 38.0 38.0 38.0 38.0 20-24 37.2432 38.0 38.0 38.0 37.8 38.0 25-29 36.93175 38.0 38.0 38.0 37.0 38.0 30-34 36.273250000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.5378 38.0 38.0 38.0 36.2 38.0 40-44 37.13655 38.0 38.0 38.0 37.2 38.0 45-49 37.1571 38.0 38.0 38.0 37.2 38.0 50-54 37.0871 38.0 38.0 38.0 37.0 38.0 55-59 37.071 38.0 38.0 38.0 37.0 38.0 60-64 36.95989999999999 38.0 38.0 38.0 36.8 38.0 65-69 36.8629 38.0 38.0 38.0 36.0 38.0 70-74 36.822199999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.8621 38.0 38.0 38.0 36.0 38.0 80-84 36.736450000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.6736 38.0 38.0 38.0 35.4 38.0 90-94 36.60275 38.0 38.0 38.0 35.2 38.0 95-99 36.5255 38.0 38.0 38.0 35.0 38.0 100-104 36.3507 38.0 38.0 38.0 34.2 38.0 105-109 36.290949999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.108799999999995 38.0 38.0 38.0 33.8 38.0 115-119 35.991200000000006 38.0 38.0 38.0 33.6 38.0 120-124 35.771550000000005 38.0 37.4 38.0 32.2 38.0 125-129 35.58305 38.0 37.2 38.0 31.4 38.0 130-134 35.257999999999996 38.0 36.2 38.0 29.8 38.0 135-139 34.97225 38.0 36.0 38.0 28.2 38.0 140-144 34.59335 38.0 35.4 38.0 27.4 38.0 145-149 33.662949999999995 38.0 33.8 38.0 21.4 38.0 150-151 29.52775 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 2.0 5 2.0 6 2.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 2.0 14 4.0 15 2.0 16 1.0 17 6.0 18 4.0 19 5.0 20 6.0 21 7.0 22 5.0 23 7.0 24 15.0 25 12.0 26 14.0 27 15.0 28 26.0 29 28.0 30 37.0 31 51.0 32 60.0 33 88.0 34 153.0 35 262.0 36 465.0 37 2699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 15.55 18.8 31.95 2 23.375 23.25 36.199999999999996 17.175 3 19.925 26.650000000000002 32.125 21.3 4 23.724999999999998 34.35 22.575 19.35 5 26.174999999999997 34.675 21.925 17.224999999999998 6 17.95 38.625 23.5 19.925 7 17.175 18.025 43.1 21.7 8 22.3 21.825 28.875 27.0 9 21.85 25.224999999999998 28.299999999999997 24.625 10-14 23.189999999999998 28.804999999999996 26.474999999999998 21.529999999999998 15-19 22.96 28.015 28.16 20.865000000000002 20-24 22.919999999999998 28.470000000000002 27.22 21.39 25-29 23.165010341522475 28.33072693336024 27.851485647984664 20.652777077132622 30-34 22.59141331142153 28.127567789646672 28.07621199671323 21.20480690221857 35-39 23.014101653647153 28.69027087349092 27.122856852997867 21.172770619864057 40-44 23.294999999999998 28.17 27.755000000000003 20.78 45-49 22.655 28.310000000000002 27.700000000000003 21.335 50-54 22.86 28.27 28.125 20.745 55-59 23.150000000000002 28.27 27.63 20.95 60-64 23.115 27.61 28.565 20.71 65-69 23.655 27.400000000000002 27.735 21.21 70-74 23.849999999999998 28.355000000000004 27.355 20.44 75-79 23.86 27.785 27.815 20.54 80-84 24.04 28.615000000000002 27.24 20.105 85-89 24.349999999999998 27.575 27.625 20.45 90-94 23.395 28.549999999999997 27.560000000000002 20.495 95-99 23.655 28.689999999999998 27.16 20.495 100-104 24.01 28.4 27.66 19.93 105-109 23.715 28.060000000000002 27.965 20.26 110-114 24.11 28.32 27.555000000000003 20.015 115-119 24.67 28.444999999999997 26.755000000000003 20.13 120-124 24.515 28.865000000000002 26.900000000000002 19.72 125-129 25.095 27.87 27.1 19.935 130-134 24.665 27.944999999999997 27.584999999999997 19.805 135-139 24.81 28.794999999999998 26.619999999999997 19.775000000000002 140-144 25.124999999999996 28.13 27.134999999999998 19.61 145-149 25.330000000000002 28.21 27.22 19.24 150-151 24.925 28.525 26.5625 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 3.0 28 3.5 29 7.0 30 9.5 31 15.5 32 25.5 33 30.0 34 47.5 35 71.0 36 90.0 37 107.0 38 136.0 39 174.0 40 210.0 41 237.5 42 249.5 43 282.5 44 310.0 45 283.0 46 268.0 47 254.5 48 229.0 49 195.0 50 151.0 51 126.5 52 106.5 53 91.0 54 68.5 55 49.5 56 40.0 57 28.0 58 20.5 59 17.5 60 9.5 61 7.5 62 8.0 63 7.0 64 5.5 65 4.0 66 2.5 67 1.5 68 2.0 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.885 30-34 2.64 35-39 1.43 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646848 spots for SRR7172633.sra Written 646848 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra Read 646841 spots for SRR7172633.sra Written 646841 spots for SRR7172633.sra SRR ids: ['SRR7172633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wm3d4gip SRR7172633.sra spots: 12936827 blocks: [[1, 646841], [646842, 1293682], [1293683, 1940523], [1940524, 2587364], [2587365, 3234205], [3234206, 3881046], [3881047, 4527887], [4527888, 5174728], [5174729, 5821569], [5821570, 6468410], [6468411, 7115251], [7115252, 7762092], [7762093, 8408933], [8408934, 9055774], [9055775, 9702615], [9702616, 10349456], [10349457, 10996297], [10996298, 11643138], [11643139, 12289979], [12289980, 12936827]] SRR7172633 file size 4362165 SRR7172633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172633 SRR7172633_1.fastq SRR7172633_2.fastq Input file: SRR7172633_1.fastq Paired file: SRR7172633_2.fastq trimmed: SRR7172633-trimmed-pair1.fastq, SRR7172633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:16:21 2025 >> started Mon Feb 10 11:16:35 2025 >> done (13.374s) 12936827 read pairs processed; of these: 15237 ( 0.12%) short read pairs filtered out after trimming by size control 16546 ( 0.13%) empty read pairs filtered out after trimming by size control 12905044 (99.75%) read pairs available; of these: 5402554 (41.86%) trimmed read pairs available after processing 7502490 (58.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 7 0.00% 33 3 0.00% 34 3 0.00% 35 2 0.00% 36 3 0.00% 37 1 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 3 0.00% 42 4 0.00% 43 7 0.00% 44 9 0.00% 45 5 0.00% 46 10 0.00% 47 11 0.00% 48 12 0.00% 49 16 0.00% 50 13 0.00% 51 11 0.00% 52 18 0.00% 53 22 0.00% 54 21 0.00% 55 33 0.00% 56 34 0.00% 57 42 0.00% 58 55 0.00% 59 56 0.00% 60 62 0.00% 61 68 0.00% 62 89 0.00% 63 84 0.00% 64 130 0.00% 65 118 0.00% 66 143 0.00% 67 177 0.00% 68 206 0.00% 69 228 0.00% 70 302 0.00% 71 320 0.00% 72 355 0.00% 73 406 0.00% 74 485 0.00% 75 571 0.00% 76 699 0.01% 77 791 0.01% 78 843 0.01% 79 914 0.01% 80 1087 0.01% 81 1211 0.01% 82 1436 0.01% 83 1755 0.01% 84 2503 0.02% 85 3080 0.02% 86 3346 0.03% 87 3607 0.03% 88 3956 0.03% 89 4241 0.03% 90 4526 0.04% 91 4787 0.04% 92 5326 0.04% 93 5703 0.04% 94 6238 0.05% 95 6837 0.05% 96 7202 0.06% 97 7772 0.06% 98 8381 0.06% 99 9119 0.07% 100 9594 0.07% 101 10462 0.08% 102 11071 0.09% 103 11952 0.09% 104 12690 0.10% 105 13714 0.11% 106 14676 0.11% 107 15204 0.12% 108 15823 0.12% 109 16744 0.13% 110 17727 0.14% 111 18604 0.14% 112 19843 0.15% 113 20535 0.16% 114 22281 0.17% 115 23204 0.18% 116 24246 0.19% 117 25133 0.19% 118 25906 0.20% 119 26749 0.21% 120 27719 0.21% 121 29042 0.23% 122 30037 0.23% 123 31614 0.24% 124 32901 0.25% 125 34410 0.27% 126 35345 0.27% 127 36806 0.29% 128 38086 0.30% 129 39423 0.31% 130 41039 0.32% 131 42284 0.33% 132 44089 0.34% 133 45876 0.36% 134 47687 0.37% 135 49603 0.38% 136 51627 0.40% 137 54275 0.42% 138 57249 0.44% 139 59679 0.46% 140 62805 0.49% 141 66955 0.52% 142 72838 0.56% 143 78769 0.61% 144 88589 0.69% 145 101331 0.79% 146 121552 0.94% 147 157049 1.22% 148 232135 1.80% 149 446302 3.46% 150 2689749 20.84% 151 7502490 58.14% 12905044 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=22 prefix-density=0.21 prefix-fanout=3.6 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=465.44 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=35.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=132.43 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.9 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGT SRR7172633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:17:21 Started mapping on | Feb 10 11:17:21 Finished on | Feb 10 11:18:40 Mapping speed, Million of reads per hour | 588.08 Number of input reads | 12905044 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12227262 Uniquely mapped reads % | 94.75% Average mapped length | 294.30 Number of splices: Total | 12220851 Number of splices: Annotated (sjdb) | 11961301 Number of splices: GT/AG | 12016608 Number of splices: GC/AG | 159404 Number of splices: AT/AC | 10329 Number of splices: Non-canonical | 34510 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330698 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 58453 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 358893 358893 358893 N_multimapping 330698 330698 330698 N_noFeature 353472 12114832 408667 N_ambiguous 120533 1236 62441 UnstrandedReadsAssigned:11753257 PositiveStrandReadsAssigned:111194 NegativeStrandReadsAssigned:11756154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172633-trimmed-pair1.fastq SRR7172633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,905,044 reads, 11,724,391 reads pseudoaligned [quant] estimated average fragment length: 233.211 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7172633.ke.tsv 34699 SRR7172633.se.tsv 87100 total ==> SRR7172633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.79 1021 49.222 Potri.005G024800.1.v4.1 1035 802.789 350 37.5345 Potri.004G059700.1.v4.1 961 728.799 61 7.20585 Potri.007G009000.2.v4.1 1416 1183.79 0 0 Potri.003G141000.2.v4.1 2943 2710.79 408.553 12.9753 Potri.016G087400.1.v4.1 270 83.4124 774.477 799.358 Potri.015G069301.1.v4.1 564 335.719 0 0 Potri.010G195200.1.v4.1 1773 1540.79 146.76 8.20029 Potri.012G127500.1.v4.1 977 744.794 10456 1208.63 ==> SRR7172633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 108 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 373 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 300 SRR7172633 completed mapping pipeline successfully