Starting /dee2/code/volunteer_pipeline.sh SRR7172634 current disk space = 3058863714304 free memory = 1438282848 SRR7172634 SRAfilesize 1fa789a5ea2389a98c7487efbecfff81 SRR7172634.sra SRR7172634.sra file validated SRR7172634 is paired end SRR7172634 is conventional basespace SRR7172634 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.03125 28.0 18.0 33.0 18.0 33.0 2 28.55925 30.0 27.0 33.0 18.0 33.0 3 30.75125 31.0 29.0 33.0 27.0 33.0 4 32.416 33.0 32.0 33.0 32.0 33.0 5 32.80625 33.0 33.0 33.0 32.0 34.0 6 36.1385 38.0 36.0 38.0 33.0 38.0 7 37.17975 38.0 38.0 38.0 36.0 38.0 8 37.3355 38.0 38.0 38.0 36.0 38.0 9 37.49925 38.0 38.0 38.0 37.0 38.0 10-14 37.604800000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.633750000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.612100000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.616949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.560900000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.573449999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.497249999999994 38.0 38.0 38.0 37.6 38.0 45-49 37.467150000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.4829 38.0 38.0 38.0 37.4 38.0 55-59 37.40259999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.39725 38.0 38.0 38.0 37.0 38.0 65-69 37.31045 38.0 38.0 38.0 37.0 38.0 70-74 37.32000000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.271950000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.1662 38.0 38.0 38.0 36.2 38.0 85-89 37.116499999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.024699999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.9358 38.0 38.0 38.0 35.6 38.0 100-104 36.84165 38.0 38.0 38.0 35.4 38.0 105-109 36.72025 38.0 38.0 38.0 34.8 38.0 110-114 36.58435 38.0 38.0 38.0 34.2 38.0 115-119 36.45354999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.3491 38.0 38.0 38.0 34.0 38.0 125-129 36.23 38.0 38.0 38.0 33.8 38.0 130-134 35.9462 38.0 37.2 38.0 33.4 38.0 135-139 35.6155 38.0 36.6 38.0 31.8 38.0 140-144 35.30495 38.0 36.0 38.0 31.0 38.0 145-149 34.80345 38.0 35.8 38.0 28.6 38.0 150-151 31.70075 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 5.0 21 2.0 22 3.0 23 6.0 24 8.0 25 10.0 26 11.0 27 16.0 28 22.0 29 12.0 30 24.0 31 46.0 32 47.0 33 60.0 34 132.0 35 212.0 36 667.0 37 2710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.234234234234236 12.012012012012011 13.431613431613432 40.32214032214032 2 19.809904952476238 18.509254627313656 40.59529764882441 21.085542771385693 3 20.150000000000002 24.099999999999998 25.874999999999996 29.875 4 23.799999999999997 31.674999999999997 21.75 22.775000000000002 5 22.2 34.625 25.0 18.175 6 18.6 35.15 26.05 20.200000000000003 7 15.15 21.425 43.55 19.875 8 19.35 22.375 30.65 27.625 9 17.925 21.975 34.025 26.075 10-14 19.585 29.195 27.029999999999998 24.19 15-19 20.064999999999998 27.405 28.470000000000002 24.060000000000002 20-24 20.52 27.889999999999997 27.98 23.61 25-29 20.169999999999998 28.349999999999998 27.560000000000002 23.919999999999998 30-34 19.725 28.055000000000003 28.025 24.195 35-39 20.095 28.1 27.815 23.990000000000002 40-44 20.095 28.02 27.55 24.335 45-49 20.345 28.110000000000003 27.72 23.825 50-54 20.115 28.08 27.365000000000002 24.44 55-59 20.07 28.125 27.625 24.18 60-64 20.59 28.444999999999997 27.205000000000002 23.76 65-69 20.635 27.860000000000003 27.644999999999996 23.86 70-74 20.66 27.675 27.715 23.95 75-79 20.560000000000002 27.800000000000004 27.57 24.07 80-84 20.28 28.665000000000003 27.32 23.735 85-89 20.59 27.800000000000004 27.860000000000003 23.75 90-94 21.165 28.055000000000003 27.275 23.505000000000003 95-99 20.755000000000003 27.63 27.894999999999996 23.72 100-104 20.685000000000002 28.24 27.389999999999997 23.685000000000002 105-109 20.544999999999998 28.16 27.560000000000002 23.735 110-114 21.055 27.415 27.639999999999997 23.89 115-119 20.385 28.110000000000003 27.77 23.735 120-124 21.52 28.18 26.69 23.61 125-129 21.3 27.284999999999997 27.650000000000002 23.765 130-134 21.01 28.16 26.83 24.0 135-139 20.945 28.49 26.435 24.13 140-144 20.865000000000002 28.12 26.325 24.69 145-149 21.54 27.905 26.655 23.9 150-151 20.925 27.925 26.05 25.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 5.5 26 6.5 27 8.5 28 9.0 29 11.0 30 21.0 31 31.0 32 31.0 33 33.0 34 50.5 35 65.5 36 72.5 37 106.0 38 149.0 39 159.5 40 172.0 41 199.0 42 229.0 43 255.5 44 265.5 45 267.0 46 282.0 47 257.0 48 218.5 49 200.5 50 168.0 51 136.0 52 115.5 53 107.5 54 85.5 55 62.5 56 47.0 57 38.5 58 31.0 59 21.5 60 15.5 61 13.5 62 12.5 63 10.0 64 7.5 65 4.5 66 3.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.425 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.387499999999999 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGTGG 10 0.0068449317 144.90001 4 >>END_MODULE SRR7172634 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1335 33.0 33.0 34.0 33.0 34.0 2 33.194 34.0 33.0 34.0 33.0 34.0 3 33.29425 34.0 33.0 34.0 33.0 34.0 4 33.23125 34.0 33.0 34.0 33.0 34.0 5 33.183 34.0 33.0 34.0 33.0 34.0 6 37.336 38.0 38.0 38.0 38.0 38.0 7 37.3825 38.0 38.0 38.0 38.0 38.0 8 37.36925 38.0 38.0 38.0 38.0 38.0 9 37.33075 38.0 38.0 38.0 37.0 38.0 10-14 37.3288 38.0 38.0 38.0 38.0 38.0 15-19 37.33285 38.0 38.0 38.0 37.8 38.0 20-24 37.334500000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.297050000000006 38.0 38.0 38.0 37.8 38.0 30-34 37.2356 38.0 38.0 38.0 37.0 38.0 35-39 37.23745 38.0 38.0 38.0 37.0 38.0 40-44 37.206649999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.143299999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.11945 38.0 38.0 38.0 37.0 38.0 55-59 37.0575 38.0 38.0 38.0 37.0 38.0 60-64 36.99805 38.0 38.0 38.0 36.4 38.0 65-69 36.95235 38.0 38.0 38.0 36.2 38.0 70-74 36.91515 38.0 38.0 38.0 36.0 38.0 75-79 36.873850000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.81785 38.0 38.0 38.0 36.0 38.0 85-89 36.7531 38.0 38.0 38.0 35.8 38.0 90-94 36.5795 38.0 38.0 38.0 35.0 38.0 95-99 36.4893 38.0 38.0 38.0 34.8 38.0 100-104 36.38805000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.17835 38.0 38.0 38.0 34.0 38.0 110-114 36.04495 38.0 38.0 38.0 33.6 38.0 115-119 35.982150000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.7193 38.0 37.2 38.0 32.4 38.0 125-129 35.471349999999994 38.0 36.6 38.0 31.4 38.0 130-134 35.22455 38.0 36.2 38.0 29.6 38.0 135-139 34.6943 38.0 35.6 38.0 27.8 38.0 140-144 34.2044 38.0 35.0 38.0 23.6 38.0 145-149 33.553900000000006 38.0 35.0 38.0 18.8 38.0 150-151 29.9025 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 3.0 5 1.0 6 1.0 7 1.0 8 4.0 9 3.0 10 0.0 11 2.0 12 0.0 13 3.0 14 0.0 15 2.0 16 1.0 17 3.0 18 4.0 19 4.0 20 6.0 21 5.0 22 8.0 23 8.0 24 12.0 25 12.0 26 15.0 27 18.0 28 33.0 29 31.0 30 29.0 31 38.0 32 58.0 33 85.0 34 122.0 35 183.0 36 556.0 37 2735.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.225 14.149999999999999 19.325 30.3 2 23.45 22.325 36.625 17.599999999999998 3 22.825 25.474999999999998 30.75 20.95 4 25.85 34.699999999999996 21.349999999999998 18.099999999999998 5 24.224999999999998 35.875 22.975 16.925 6 19.15 37.325 24.25 19.275000000000002 7 19.5 15.825 43.05 21.625 8 20.775 22.225 27.650000000000002 29.349999999999998 9 23.05 23.65 27.800000000000004 25.5 10-14 22.85 28.775000000000002 26.325 22.05 15-19 22.505 28.115000000000002 28.115000000000002 21.265 20-24 23.21 28.439999999999998 27.250000000000004 21.099999999999998 25-29 23.34 27.985 26.915 21.759999999999998 30-34 23.455000000000002 28.050000000000004 27.325 21.17 35-39 23.330000000000002 28.294999999999998 27.12 21.255 40-44 23.865 28.18 27.325 20.630000000000003 45-49 23.65 27.950000000000003 27.57 20.830000000000002 50-54 23.064999999999998 27.755000000000003 27.750000000000004 21.43 55-59 24.005000000000003 27.92 27.18 20.895 60-64 23.5 28.244999999999997 27.35 20.905 65-69 22.79 28.599999999999998 27.43 21.18 70-74 24.015 27.565 27.735 20.685000000000002 75-79 23.665 28.32 27.045 20.97 80-84 23.875 28.110000000000003 26.97 21.044999999999998 85-89 23.94 27.750000000000004 27.150000000000002 21.16 90-94 24.27 27.500000000000004 27.375 20.855 95-99 24.0 27.595 27.744999999999997 20.66 100-104 24.29 28.444999999999997 26.884999999999998 20.380000000000003 105-109 24.345 27.77 26.965 20.919999999999998 110-114 23.56 28.134999999999998 27.834999999999997 20.47 115-119 24.68 28.46 27.02 19.84 120-124 24.075 27.900000000000002 27.474999999999998 20.549999999999997 125-129 24.715 28.185 26.75 20.349999999999998 130-134 25.074999999999996 28.21 26.46 20.255000000000003 135-139 25.130000000000003 27.55 27.51 19.81 140-144 25.285000000000004 27.83 26.669999999999998 20.215 145-149 25.419999999999998 28.27 26.505000000000003 19.805 150-151 26.224999999999998 28.599999999999998 25.362499999999997 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.5 18 1.5 19 1.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.5 25 1.5 26 3.5 27 6.0 28 4.0 29 4.0 30 8.5 31 13.0 32 17.5 33 24.5 34 29.0 35 38.5 36 64.5 37 106.0 38 139.5 39 150.0 40 189.5 41 227.5 42 232.0 43 257.0 44 285.5 45 299.0 46 280.0 47 241.5 48 239.0 49 218.5 50 189.0 51 163.5 52 125.5 53 103.5 54 75.5 55 55.5 56 49.0 57 40.0 58 27.5 59 17.5 60 15.5 61 13.5 62 6.5 63 4.5 64 4.5 65 1.5 66 2.0 67 3.0 68 3.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5287009063444109 1.05 3 0.050352467270896276 0.15 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.375 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra Read 993231 spots for SRR7172634.sra Written 993231 spots for SRR7172634.sra Read 993222 spots for SRR7172634.sra Written 993222 spots for SRR7172634.sra SRR ids: ['SRR7172634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fwm_kgoa SRR7172634.sra spots: 19864449 blocks: [[1, 993222], [993223, 1986444], [1986445, 2979666], [2979667, 3972888], [3972889, 4966110], [4966111, 5959332], [5959333, 6952554], [6952555, 7945776], [7945777, 8938998], [8938999, 9932220], [9932221, 10925442], [10925443, 11918664], [11918665, 12911886], [12911887, 13905108], [13905109, 14898330], [14898331, 15891552], [15891553, 16884774], [16884775, 17877996], [17877997, 18871218], [18871219, 19864449]] SRR7172634 file size 6709709 SRR7172634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172634 SRR7172634_1.fastq SRR7172634_2.fastq Input file: SRR7172634_1.fastq Paired file: SRR7172634_2.fastq trimmed: SRR7172634-trimmed-pair1.fastq, SRR7172634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:21:16 2025 >> started Mon Feb 10 11:21:43 2025 >> done (27.233s) 19864449 read pairs processed; of these: 26768 ( 0.13%) short read pairs filtered out after trimming by size control 32200 ( 0.16%) empty read pairs filtered out after trimming by size control 19805481 (99.70%) read pairs available; of these: 9446374 (47.70%) trimmed read pairs available after processing 10359107 (52.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 8 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 8 0.00% 27 4 0.00% 28 6 0.00% 29 15 0.00% 30 3 0.00% 31 3 0.00% 32 4 0.00% 33 6 0.00% 34 4 0.00% 35 11 0.00% 36 4 0.00% 37 13 0.00% 38 8 0.00% 39 1 0.00% 40 7 0.00% 41 17 0.00% 42 11 0.00% 43 11 0.00% 44 12 0.00% 45 16 0.00% 46 19 0.00% 47 13 0.00% 48 27 0.00% 49 57 0.00% 50 19 0.00% 51 34 0.00% 52 33 0.00% 53 45 0.00% 54 44 0.00% 55 45 0.00% 56 68 0.00% 57 80 0.00% 58 82 0.00% 59 105 0.00% 60 100 0.00% 61 110 0.00% 62 124 0.00% 63 155 0.00% 64 208 0.00% 65 177 0.00% 66 238 0.00% 67 232 0.00% 68 301 0.00% 69 320 0.00% 70 362 0.00% 71 449 0.00% 72 513 0.00% 73 604 0.00% 74 703 0.00% 75 761 0.00% 76 1054 0.01% 77 1121 0.01% 78 1192 0.01% 79 1344 0.01% 80 1516 0.01% 81 1719 0.01% 82 1999 0.01% 83 2339 0.01% 84 3702 0.02% 85 4685 0.02% 86 5074 0.03% 87 5727 0.03% 88 5977 0.03% 89 6321 0.03% 90 6540 0.03% 91 7119 0.04% 92 7632 0.04% 93 8154 0.04% 94 9170 0.05% 95 9721 0.05% 96 10592 0.05% 97 11199 0.06% 98 12107 0.06% 99 13168 0.07% 100 14181 0.07% 101 15498 0.08% 102 16612 0.08% 103 17936 0.09% 104 19030 0.10% 105 20497 0.10% 106 22309 0.11% 107 23302 0.12% 108 24583 0.12% 109 26533 0.13% 110 27966 0.14% 111 29690 0.15% 112 31724 0.16% 113 33295 0.17% 114 35702 0.18% 115 38275 0.19% 116 39659 0.20% 117 41023 0.21% 118 42801 0.22% 119 44824 0.23% 120 46961 0.24% 121 49049 0.25% 122 50538 0.26% 123 52717 0.27% 124 55627 0.28% 125 57363 0.29% 126 60344 0.30% 127 62510 0.32% 128 64403 0.33% 129 66696 0.34% 130 70073 0.35% 131 72443 0.37% 132 75585 0.38% 133 78661 0.40% 134 82196 0.42% 135 86714 0.44% 136 90404 0.46% 137 95169 0.48% 138 99769 0.50% 139 105703 0.53% 140 112205 0.57% 141 119863 0.61% 142 129920 0.66% 143 141300 0.71% 144 159177 0.80% 145 185842 0.94% 146 224804 1.14% 147 298311 1.51% 148 458293 2.31% 149 914255 4.62% 150 4568655 23.07% 151 10359107 52.30% 19805481 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=28 prefix-density=1.17 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=17.99 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=2.0 sequence=ACTTGCAGCCAGAGCCACACCCACAGTTTCCTCCACAGCAAGACAT criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=25 prefix-density=1.03 prefix-fanout=2.8 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=52.83 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=14.6 sequence=TTGGTGCTGAGA SRR7172634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:22:32 Started mapping on | Feb 10 11:22:33 Finished on | Feb 10 11:26:06 Mapping speed, Million of reads per hour | 334.74 Number of input reads | 19805481 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17723486 Uniquely mapped reads % | 89.49% Average mapped length | 293.78 Number of splices: Total | 17512386 Number of splices: Annotated (sjdb) | 17171773 Number of splices: GT/AG | 17230484 Number of splices: GC/AG | 216877 Number of splices: AT/AC | 13313 Number of splices: Non-canonical | 51712 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453352 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 111595 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.56% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1648728 1648728 1648728 N_multimapping 453352 453352 453352 N_noFeature 453267 17561648 513481 N_ambiguous 184196 943 82003 UnstrandedReadsAssigned:17086023 PositiveStrandReadsAssigned:160895 NegativeStrandReadsAssigned:17128002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172634-trimmed-pair1.fastq SRR7172634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,805,481 reads, 17,053,207 reads pseudoaligned [quant] estimated average fragment length: 227.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7172634.ke.tsv 34699 SRR7172634.se.tsv 87100 total ==> SRR7172634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.68 1885 52.6114 Potri.005G024800.1.v4.1 1035 808.682 1104 68.2686 Potri.004G059700.1.v4.1 961 734.687 7 0.476459 Potri.007G009000.2.v4.1 1416 1189.68 0 0 Potri.003G141000.2.v4.1 2943 2716.68 1134.32 20.8798 Potri.016G087400.1.v4.1 270 84.2533 1378.19 817.996 Potri.015G069301.1.v4.1 564 340.379 0 0 Potri.010G195200.1.v4.1 1773 1546.68 658 21.2743 Potri.012G127500.1.v4.1 977 750.687 6360 423.67 ==> SRR7172634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 610 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 650 SRR7172634 completed mapping pipeline successfully