Starting /dee2/code/volunteer_pipeline.sh SRR7172635 current disk space = 3058804408320 free memory = 1327674644 SRR7172635 SRAfilesize cbca356151f08a45862f56d91ed81e11 SRR7172635.sra SRR7172635.sra file validated SRR7172635 is paired end SRR7172635 is conventional basespace SRR7172635 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.43 31.0 18.0 33.0 18.0 33.0 2 27.72775 31.0 25.0 33.0 18.0 33.0 3 28.894 31.0 27.0 33.0 18.0 33.0 4 32.03525 33.0 32.0 33.0 31.0 33.0 5 32.5015 33.0 33.0 33.0 32.0 34.0 6 36.3655 38.0 36.0 38.0 34.0 38.0 7 37.06325 38.0 37.0 38.0 35.0 38.0 8 37.123 38.0 38.0 38.0 35.0 38.0 9 37.4085 38.0 38.0 38.0 36.0 38.0 10-14 37.58805 38.0 38.0 38.0 37.2 38.0 15-19 37.621249999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6469 38.0 38.0 38.0 38.0 38.0 25-29 37.67445 38.0 38.0 38.0 38.0 38.0 30-34 37.609449999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.6163 38.0 38.0 38.0 38.0 38.0 40-44 37.5789 38.0 38.0 38.0 38.0 38.0 45-49 37.55245 38.0 38.0 38.0 37.6 38.0 50-54 37.515 38.0 38.0 38.0 37.4 38.0 55-59 37.4899 38.0 38.0 38.0 37.0 38.0 60-64 37.4778 38.0 38.0 38.0 37.2 38.0 65-69 37.419000000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.41844999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.33885 38.0 38.0 38.0 36.8 38.0 80-84 37.25965 38.0 38.0 38.0 36.6 38.0 85-89 37.20125 38.0 38.0 38.0 36.0 38.0 90-94 37.096599999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.96695 38.0 38.0 38.0 36.0 38.0 100-104 36.90005 38.0 38.0 38.0 35.6 38.0 105-109 36.778749999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.5911 38.0 38.0 38.0 34.4 38.0 115-119 36.587 38.0 38.0 38.0 34.2 38.0 120-124 36.489050000000006 38.0 38.0 38.0 34.2 38.0 125-129 36.270799999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.0203 38.0 37.2 38.0 33.2 38.0 135-139 35.7064 38.0 36.2 38.0 32.0 38.0 140-144 35.423950000000005 38.0 36.0 38.0 31.0 38.0 145-149 34.96255 38.0 36.0 38.0 30.4 38.0 150-151 31.9535 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 3.0 21 4.0 22 2.0 23 6.0 24 7.0 25 7.0 26 8.0 27 6.0 28 12.0 29 20.0 30 23.0 31 29.0 32 44.0 33 60.0 34 121.0 35 237.0 36 704.0 37 2699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.70998116760829 15.146623621199891 11.756793112725317 39.386602098466504 2 19.05 21.075 38.0 21.875 3 19.6 26.35 25.775 28.275 4 22.725 35.199999999999996 22.275 19.8 5 20.25 38.4 23.625 17.724999999999998 6 17.75 36.95 25.7 19.6 7 13.675 21.675 44.375 20.275000000000002 8 18.125 21.825 29.775000000000002 30.275000000000002 9 17.775 22.825 33.225 26.174999999999997 10-14 19.445 29.28 27.384999999999998 23.89 15-19 19.605 28.035 28.505000000000003 23.855 20-24 19.509999999999998 28.74 27.49 24.26 25-29 19.865 28.96 27.115000000000002 24.060000000000002 30-34 19.82 28.67 27.66 23.849999999999998 35-39 19.415 28.64 27.57 24.375 40-44 19.675 28.935 27.455000000000002 23.935000000000002 45-49 20.200000000000003 28.375 27.48 23.945 50-54 20.115 28.365000000000002 27.900000000000002 23.62 55-59 19.939999999999998 28.015 27.63 24.415 60-64 19.82 28.565 27.12 24.495 65-69 20.135 28.175 27.845 23.845 70-74 19.935 28.13 28.04 23.895 75-79 19.545 28.64 27.310000000000002 24.505 80-84 20.22 27.965 28.185 23.630000000000003 85-89 20.535 28.155 27.900000000000002 23.41 90-94 20.06 28.34 27.779999999999998 23.82 95-99 20.52 27.485 28.02 23.974999999999998 100-104 20.02 28.13 28.27 23.580000000000002 105-109 20.23 28.1 28.265 23.405 110-114 20.025000000000002 28.17 27.834999999999997 23.97 115-119 20.205000000000002 28.65 27.495000000000005 23.65 120-124 20.505000000000003 28.595 27.165 23.735 125-129 20.34 28.38 27.650000000000002 23.630000000000003 130-134 20.8 28.050000000000004 27.525 23.625 135-139 20.855 27.91 27.794999999999998 23.44 140-144 20.560000000000002 28.050000000000004 27.450000000000003 23.94 145-149 20.94 28.084999999999997 27.235 23.74 150-151 21.3125 27.875 27.625 23.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 2.5 26 4.5 27 7.0 28 10.0 29 12.5 30 18.5 31 24.5 32 32.5 33 42.5 34 49.5 35 66.0 36 84.5 37 115.5 38 138.0 39 159.5 40 206.5 41 232.0 42 240.5 43 262.0 44 295.5 45 290.5 46 262.5 47 253.5 48 230.5 49 207.0 50 177.0 51 135.5 52 110.5 53 79.0 54 53.0 55 42.0 56 36.0 57 28.5 58 18.0 59 14.5 60 9.5 61 9.0 62 9.5 63 7.0 64 6.0 65 4.5 66 2.0 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGCAT 10 0.0068396386 144.9375 9 AAAAAAA 35 0.0035454615 20.705357 60-64 >>END_MODULE SRR7172635 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18775 33.0 33.0 34.0 33.0 34.0 2 33.27825 34.0 33.0 34.0 33.0 34.0 3 33.3415 34.0 33.0 34.0 33.0 34.0 4 33.3355 34.0 33.0 34.0 33.0 34.0 5 33.26775 34.0 33.0 34.0 33.0 34.0 6 37.511 38.0 38.0 38.0 38.0 38.0 7 37.492 38.0 38.0 38.0 38.0 38.0 8 37.52775 38.0 38.0 38.0 38.0 38.0 9 37.4435 38.0 38.0 38.0 38.0 38.0 10-14 37.443349999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.43325 38.0 38.0 38.0 38.0 38.0 20-24 37.47695 38.0 38.0 38.0 38.0 38.0 25-29 37.456 38.0 38.0 38.0 38.0 38.0 30-34 37.4162 38.0 38.0 38.0 37.8 38.0 35-39 37.403999999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.3538 38.0 38.0 38.0 37.6 38.0 45-49 37.3254 38.0 38.0 38.0 37.0 38.0 50-54 37.29255 38.0 38.0 38.0 37.0 38.0 55-59 37.25115 38.0 38.0 38.0 37.0 38.0 60-64 37.19725 38.0 38.0 38.0 37.0 38.0 65-69 37.184549999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.1081 38.0 38.0 38.0 36.4 38.0 75-79 37.0658 38.0 38.0 38.0 36.0 38.0 80-84 37.01265 38.0 38.0 38.0 36.0 38.0 85-89 36.94259999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.8427 38.0 38.0 38.0 35.8 38.0 95-99 36.7336 38.0 38.0 38.0 35.0 38.0 100-104 36.696 38.0 38.0 38.0 35.0 38.0 105-109 36.4551 38.0 38.0 38.0 34.0 38.0 110-114 36.3788 38.0 38.0 38.0 34.0 38.0 115-119 36.255250000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.058299999999996 38.0 37.6 38.0 33.8 38.0 125-129 35.8074 38.0 37.2 38.0 32.8 38.0 130-134 35.635749999999994 38.0 36.6 38.0 31.8 38.0 135-139 35.122550000000004 38.0 36.0 38.0 29.0 38.0 140-144 34.69109999999999 38.0 35.6 38.0 27.0 38.0 145-149 34.1896 38.0 35.0 38.0 25.6 38.0 150-151 30.799500000000002 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 2.0 18 2.0 19 0.0 20 2.0 21 4.0 22 5.0 23 9.0 24 11.0 25 12.0 26 15.0 27 10.0 28 18.0 29 20.0 30 33.0 31 35.0 32 39.0 33 86.0 34 118.0 35 221.0 36 578.0 37 2759.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.4 15.475 16.975 30.15 2 23.825 22.2 36.7 17.275 3 20.575 26.974999999999998 31.4 21.05 4 24.075 34.725 22.0 19.2 5 24.275 36.525 22.125 17.075000000000003 6 17.925 37.9 24.65 19.525000000000002 7 17.75 17.724999999999998 42.85 21.675 8 20.45 22.525000000000002 28.050000000000004 28.975 9 22.575 24.55 28.325 24.55 10-14 22.835 28.59 26.295 22.28 15-19 23.105 28.095 28.15 20.65 20-24 22.6 28.470000000000002 27.51 21.42 25-29 22.63 28.21 28.4 20.76 30-34 22.634999999999998 28.415000000000003 27.85 21.099999999999998 35-39 22.900000000000002 28.43 27.76 20.91 40-44 22.79 28.365000000000002 27.655 21.19 45-49 23.605 28.405 27.54 20.45 50-54 23.05 28.585 27.405 20.96 55-59 23.115 27.855 27.965 21.065 60-64 23.555 27.750000000000004 27.91 20.785 65-69 23.28 28.46 27.35 20.91 70-74 23.45 27.66 28.144999999999996 20.745 75-79 23.32 28.27 27.744999999999997 20.665 80-84 23.805 28.175 27.43 20.59 85-89 23.515 27.750000000000004 27.779999999999998 20.955 90-94 23.599999999999998 28.07 27.77 20.560000000000002 95-99 23.14 28.07 27.644999999999996 21.145 100-104 23.655 28.144999999999996 27.694999999999997 20.505000000000003 105-109 23.91 28.435 27.46 20.195 110-114 23.75 28.065 27.375 20.810000000000002 115-119 24.145 27.694999999999997 27.82 20.34 120-124 24.19 27.665 28.21 19.935 125-129 23.775 28.544999999999998 27.229999999999997 20.45 130-134 24.05 27.805000000000003 27.810000000000002 20.335 135-139 24.6 27.750000000000004 27.765 19.885 140-144 24.305 28.37 27.52 19.805 145-149 24.52 28.294999999999998 27.229999999999997 19.955000000000002 150-151 25.2875 27.750000000000004 27.1375 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.5 25 2.0 26 2.0 27 4.0 28 7.0 29 8.0 30 9.5 31 13.5 32 18.5 33 28.5 34 46.0 35 67.0 36 89.5 37 102.5 38 120.0 39 154.0 40 186.5 41 234.0 42 271.5 43 275.5 44 276.5 45 312.0 46 313.5 47 262.5 48 228.0 49 205.5 50 173.0 51 138.0 52 119.5 53 93.0 54 64.5 55 49.5 56 34.0 57 24.0 58 20.0 59 10.5 60 4.0 61 5.0 62 8.0 63 5.5 64 3.0 65 3.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.4124999999999996 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 2.975 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCAT 10 0.006830828 145.0 4 AATCATT 10 0.006830828 145.0 5 GGCGTGT 10 0.006830828 145.0 3 TCATTCA 10 0.006830828 145.0 7 >>END_MODULE Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780449 spots for SRR7172635.sra Written 780449 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra Read 780437 spots for SRR7172635.sra Written 780437 spots for SRR7172635.sra SRR ids: ['SRR7172635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1uc6el5 SRR7172635.sra spots: 15608752 blocks: [[1, 780437], [780438, 1560874], [1560875, 2341311], [2341312, 3121748], [3121749, 3902185], [3902186, 4682622], [4682623, 5463059], [5463060, 6243496], [6243497, 7023933], [7023934, 7804370], [7804371, 8584807], [8584808, 9365244], [9365245, 10145681], [10145682, 10926118], [10926119, 11706555], [11706556, 12486992], [12486993, 13267429], [13267430, 14047866], [14047867, 14828303], [14828304, 15608752]] SRR7172635 file size 5267593 SRR7172635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172635 SRR7172635_1.fastq SRR7172635_2.fastq Input file: SRR7172635_1.fastq Paired file: SRR7172635_2.fastq trimmed: SRR7172635-trimmed-pair1.fastq, SRR7172635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:02:28 2025 >> started Mon Feb 10 11:02:46 2025 >> done (18.190s) 15608752 read pairs processed; of these: 11371 ( 0.07%) short read pairs filtered out after trimming by size control 9656 ( 0.06%) empty read pairs filtered out after trimming by size control 15587725 (99.87%) read pairs available; of these: 6695278 (42.95%) trimmed read pairs available after processing 8892447 (57.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 4 0.00% 33 5 0.00% 34 3 0.00% 35 2 0.00% 36 5 0.00% 37 1 0.00% 38 1 0.00% 39 6 0.00% 40 4 0.00% 41 6 0.00% 42 5 0.00% 43 7 0.00% 44 5 0.00% 45 6 0.00% 46 3 0.00% 47 7 0.00% 48 7 0.00% 49 10 0.00% 50 18 0.00% 51 7 0.00% 52 14 0.00% 53 12 0.00% 54 23 0.00% 55 24 0.00% 56 16 0.00% 57 18 0.00% 58 24 0.00% 59 26 0.00% 60 43 0.00% 61 41 0.00% 62 58 0.00% 63 62 0.00% 64 67 0.00% 65 74 0.00% 66 64 0.00% 67 73 0.00% 68 112 0.00% 69 117 0.00% 70 137 0.00% 71 164 0.00% 72 202 0.00% 73 203 0.00% 74 233 0.00% 75 300 0.00% 76 474 0.00% 77 427 0.00% 78 445 0.00% 79 465 0.00% 80 497 0.00% 81 606 0.00% 82 751 0.00% 83 938 0.01% 84 1348 0.01% 85 1831 0.01% 86 1798 0.01% 87 2140 0.01% 88 2302 0.01% 89 2335 0.01% 90 2622 0.02% 91 2722 0.02% 92 2969 0.02% 93 3228 0.02% 94 3553 0.02% 95 3752 0.02% 96 3982 0.03% 97 4350 0.03% 98 4523 0.03% 99 5077 0.03% 100 5448 0.03% 101 5666 0.04% 102 6363 0.04% 103 6684 0.04% 104 7310 0.05% 105 7742 0.05% 106 8371 0.05% 107 8956 0.06% 108 9485 0.06% 109 9880 0.06% 110 10455 0.07% 111 11435 0.07% 112 12116 0.08% 113 12936 0.08% 114 13720 0.09% 115 14927 0.10% 116 15450 0.10% 117 16220 0.10% 118 17031 0.11% 119 17935 0.12% 120 18834 0.12% 121 20040 0.13% 122 20880 0.13% 123 22481 0.14% 124 23438 0.15% 125 24893 0.16% 126 26285 0.17% 127 27383 0.18% 128 28844 0.19% 129 30429 0.20% 130 32159 0.21% 131 34212 0.22% 132 36111 0.23% 133 39007 0.25% 134 41329 0.27% 135 43686 0.28% 136 46600 0.30% 137 50600 0.32% 138 53844 0.35% 139 58397 0.37% 140 63095 0.40% 141 69864 0.45% 142 77462 0.50% 143 87314 0.56% 144 101776 0.65% 145 122871 0.79% 146 155656 1.00% 147 214884 1.38% 148 343460 2.20% 149 718230 4.61% 150 3787707 24.30% 151 8892447 57.05% 15587725 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=517.65 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=36.1 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=3.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=404.73 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR7172635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:03:31 Started mapping on | Feb 10 11:03:31 Finished on | Feb 10 11:05:34 Mapping speed, Million of reads per hour | 456.23 Number of input reads | 15587725 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14486525 Uniquely mapped reads % | 92.94% Average mapped length | 296.73 Number of splices: Total | 14608539 Number of splices: Annotated (sjdb) | 14349653 Number of splices: GT/AG | 14375166 Number of splices: GC/AG | 184277 Number of splices: AT/AC | 10628 Number of splices: Non-canonical | 38468 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368790 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 86080 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742887 742887 742887 N_multimapping 368790 368790 368790 N_noFeature 358980 14361884 408580 N_ambiguous 152328 759 76766 UnstrandedReadsAssigned:13975217 PositiveStrandReadsAssigned:123882 NegativeStrandReadsAssigned:14001179 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172635-trimmed-pair1.fastq SRR7172635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,587,725 reads, 13,920,112 reads pseudoaligned [quant] estimated average fragment length: 256.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR7172635.ke.tsv 34699 SRR7172635.se.tsv 87100 total ==> SRR7172635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.55 1161 47.7927 Potri.005G024800.1.v4.1 1035 779.551 495 46.0714 Potri.004G059700.1.v4.1 961 705.604 12 1.23393 Potri.007G009000.2.v4.1 1416 1160.55 0 0 Potri.003G141000.2.v4.1 2943 2687.55 565.524 15.2674 Potri.016G087400.1.v4.1 270 73.3826 886 876.015 Potri.015G069301.1.v4.1 564 315.11 0 0 Potri.010G195200.1.v4.1 1773 1517.55 306 14.6302 Potri.012G127500.1.v4.1 977 721.556 3493 351.236 ==> SRR7172635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 72 SRR7172635 completed mapping pipeline successfully