Starting /dee2/code/volunteer_pipeline.sh SRR7172636 current disk space = 3058807967744 free memory = 1449468728 SRR7172636 SRAfilesize d653d5d459a49dacb831252dc8bdf927 SRR7172636.sra SRR7172636.sra file validated SRR7172636 is paired end SRR7172636 is conventional basespace SRR7172636 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.6805 18.0 18.0 33.0 18.0 33.0 2 30.225 31.0 29.0 33.0 27.0 33.0 3 30.5645 31.0 29.0 33.0 27.0 33.0 4 32.43425 33.0 33.0 33.0 32.0 33.0 5 32.8235 33.0 33.0 33.0 32.0 34.0 6 36.787 38.0 37.0 38.0 35.0 38.0 7 37.3265 38.0 38.0 38.0 36.0 38.0 8 37.57225 38.0 38.0 38.0 37.0 38.0 9 37.644 38.0 38.0 38.0 38.0 38.0 10-14 37.65075 38.0 38.0 38.0 38.0 38.0 15-19 37.64205 38.0 38.0 38.0 38.0 38.0 20-24 37.649800000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.628049999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.601800000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5947 38.0 38.0 38.0 38.0 38.0 40-44 37.55375 38.0 38.0 38.0 38.0 38.0 45-49 37.53285 38.0 38.0 38.0 38.0 38.0 50-54 37.49285 38.0 38.0 38.0 37.4 38.0 55-59 37.41295 38.0 38.0 38.0 37.0 38.0 60-64 37.4217 38.0 38.0 38.0 37.0 38.0 65-69 37.37435000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.3257 38.0 38.0 38.0 37.0 38.0 75-79 37.27720000000001 38.0 38.0 38.0 36.8 38.0 80-84 37.24235 38.0 38.0 38.0 36.0 38.0 85-89 37.137 38.0 38.0 38.0 36.0 38.0 90-94 37.064299999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.999 38.0 38.0 38.0 36.0 38.0 100-104 36.9129 38.0 38.0 38.0 35.6 38.0 105-109 36.8516 38.0 38.0 38.0 35.0 38.0 110-114 36.69395 38.0 38.0 38.0 34.6 38.0 115-119 36.55575 38.0 38.0 38.0 34.0 38.0 120-124 36.4203 38.0 37.8 38.0 34.0 38.0 125-129 36.28605 38.0 37.6 38.0 33.6 38.0 130-134 35.9903 38.0 37.0 38.0 32.8 38.0 135-139 35.739200000000004 38.0 36.4 38.0 32.2 38.0 140-144 35.3904 38.0 36.0 38.0 31.0 38.0 145-149 34.8274 38.0 35.6 38.0 29.2 38.0 150-151 31.655 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 1.0 22 3.0 23 4.0 24 5.0 25 8.0 26 5.0 27 18.0 28 12.0 29 25.0 30 30.0 31 40.0 32 48.0 33 75.0 34 109.0 35 226.0 36 640.0 37 2745.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.09818569903949 13.180362860192101 13.820704375667022 38.900747065101385 2 21.15 21.05 37.075 20.724999999999998 3 19.0 27.224999999999998 25.424999999999997 28.349999999999998 4 22.5 36.75 20.75 20.0 5 20.825 35.975 24.7 18.5 6 16.85 36.775000000000006 26.775 19.6 7 12.525 20.974999999999998 46.625 19.875 8 19.525000000000002 21.6 28.625 30.25 9 17.75 22.875 33.75 25.624999999999996 10-14 19.994999999999997 28.78 27.41 23.815 15-19 19.794999999999998 28.255000000000003 28.189999999999998 23.76 20-24 19.515 28.249999999999996 27.96 24.275 25-29 19.814999999999998 27.955000000000002 28.610000000000003 23.62 30-34 20.495 28.105000000000004 27.750000000000004 23.65 35-39 20.095 28.134999999999998 27.584999999999997 24.185000000000002 40-44 19.73 28.835 28.02 23.415 45-49 19.73 28.060000000000002 27.715 24.495 50-54 19.72 28.17 27.939999999999998 24.169999999999998 55-59 19.435 28.33 28.084999999999997 24.15 60-64 20.19 28.494999999999997 28.015 23.3 65-69 19.96 28.27 27.92 23.849999999999998 70-74 19.935 28.59 27.505000000000003 23.97 75-79 19.400000000000002 28.455000000000002 27.925 24.22 80-84 20.225 27.839999999999996 27.634999999999998 24.3 85-89 20.27 28.975 27.115000000000002 23.64 90-94 19.96 28.235 27.665 24.14 95-99 20.335 27.650000000000002 28.025 23.990000000000002 100-104 20.495 28.32 28.110000000000003 23.075000000000003 105-109 20.375 27.72 27.99 23.915 110-114 20.22 27.66 27.935 24.185000000000002 115-119 21.01 27.815 27.96 23.215 120-124 20.79 27.76 28.025 23.425 125-129 21.25 28.125 27.325 23.3 130-134 20.48 28.735 27.1 23.685000000000002 135-139 20.64 28.310000000000002 27.450000000000003 23.599999999999998 140-144 21.01 28.1 27.42 23.47 145-149 21.135 28.24 26.97 23.655 150-151 20.525 27.9125 27.275 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 2.0 24 3.0 25 3.5 26 5.5 27 5.0 28 7.5 29 12.5 30 14.0 31 17.0 32 25.5 33 34.0 34 45.5 35 66.0 36 98.5 37 124.5 38 141.5 39 167.5 40 196.5 41 235.5 42 256.0 43 256.0 44 273.0 45 295.0 46 285.0 47 243.0 48 222.0 49 210.5 50 178.0 51 138.0 52 116.5 53 91.5 54 59.5 55 44.5 56 33.0 57 23.5 58 17.5 59 13.0 60 8.5 61 7.5 62 4.5 63 4.5 64 3.5 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATATT 10 0.0068378756 144.95 145 >>END_MODULE SRR7172636 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19825 33.0 33.0 34.0 33.0 34.0 2 33.30175 34.0 33.0 34.0 33.0 34.0 3 33.335 34.0 33.0 34.0 33.0 34.0 4 33.32175 34.0 33.0 34.0 33.0 34.0 5 33.3625 34.0 33.0 34.0 33.0 34.0 6 37.53 38.0 38.0 38.0 38.0 38.0 7 37.577 38.0 38.0 38.0 38.0 38.0 8 37.583 38.0 38.0 38.0 38.0 38.0 9 37.535 38.0 38.0 38.0 38.0 38.0 10-14 37.52910000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.5188 38.0 38.0 38.0 38.0 38.0 20-24 37.5225 38.0 38.0 38.0 38.0 38.0 25-29 37.50099999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.4561 38.0 38.0 38.0 38.0 38.0 35-39 37.42555 38.0 38.0 38.0 37.8 38.0 40-44 37.4058 38.0 38.0 38.0 37.8 38.0 45-49 37.41330000000001 38.0 38.0 38.0 37.6 38.0 50-54 37.39355 38.0 38.0 38.0 37.0 38.0 55-59 37.31965 38.0 38.0 38.0 37.0 38.0 60-64 37.22815 38.0 38.0 38.0 37.0 38.0 65-69 37.20185 38.0 38.0 38.0 37.0 38.0 70-74 37.205 38.0 38.0 38.0 37.0 38.0 75-79 37.150850000000005 38.0 38.0 38.0 36.6 38.0 80-84 37.06735 38.0 38.0 38.0 36.2 38.0 85-89 36.96205 38.0 38.0 38.0 36.0 38.0 90-94 36.88965 38.0 38.0 38.0 36.0 38.0 95-99 36.8141 38.0 38.0 38.0 35.6 38.0 100-104 36.784499999999994 38.0 38.0 38.0 35.6 38.0 105-109 36.56855 38.0 38.0 38.0 34.6 38.0 110-114 36.489700000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.307249999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.112899999999996 38.0 38.0 38.0 33.6 38.0 125-129 35.913 38.0 37.6 38.0 33.0 38.0 130-134 35.70625 38.0 37.4 38.0 32.2 38.0 135-139 35.26805 38.0 36.0 38.0 30.2 38.0 140-144 34.963499999999996 38.0 36.0 38.0 29.8 38.0 145-149 34.278999999999996 38.0 35.0 38.0 26.6 38.0 150-151 31.0065 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 4.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 2.0 18 1.0 19 3.0 20 4.0 21 3.0 22 3.0 23 10.0 24 9.0 25 13.0 26 19.0 27 13.0 28 17.0 29 28.0 30 23.0 31 41.0 32 47.0 33 57.0 34 119.0 35 199.0 36 512.0 37 2862.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.9 15.45 17.75 31.900000000000002 2 23.724999999999998 24.025 35.725 16.525000000000002 3 20.200000000000003 27.750000000000004 30.375000000000004 21.675 4 24.224999999999998 35.675000000000004 21.025 19.075 5 23.225 37.574999999999996 22.275 16.925 6 18.425 39.175 24.125 18.275 7 17.4 15.55 44.9 22.15 8 20.325 23.05 28.199999999999996 28.425 9 22.45 23.05 28.65 25.85 10-14 22.925 28.79 26.724999999999998 21.560000000000002 15-19 22.89 27.134999999999998 28.455000000000002 21.52 20-24 22.665 28.365000000000002 27.565 21.404999999999998 25-29 22.814999999999998 28.59 27.589999999999996 21.005 30-34 22.555 29.115000000000002 27.735 20.595 35-39 23.31 28.13 27.455000000000002 21.105 40-44 23.22 27.889999999999997 28.044999999999998 20.845 45-49 23.07 28.449999999999996 27.485 20.995 50-54 23.015 28.405 27.62 20.96 55-59 23.53 27.77 27.82 20.880000000000003 60-64 23.255 27.884999999999998 28.175 20.685000000000002 65-69 23.169999999999998 28.305000000000003 28.155 20.369999999999997 70-74 23.275000000000002 28.415000000000003 27.794999999999998 20.515 75-79 23.965 27.825 27.744999999999997 20.465 80-84 23.125 28.360000000000003 27.185 21.33 85-89 23.794999999999998 28.215 27.66 20.330000000000002 90-94 23.015 28.01 28.265 20.71 95-99 23.825 27.805000000000003 27.845 20.525 100-104 24.21 28.189999999999998 27.395000000000003 20.205000000000002 105-109 23.78 27.229999999999997 28.439999999999998 20.549999999999997 110-114 23.84 28.09 27.32 20.75 115-119 23.69 28.050000000000004 27.744999999999997 20.515 120-124 23.375 28.165000000000003 28.01 20.45 125-129 23.810000000000002 28.299999999999997 27.47 20.419999999999998 130-134 24.255 28.439999999999998 27.29 20.015 135-139 24.279999999999998 27.894999999999996 27.67 20.155 140-144 24.505 27.87 27.68 19.945 145-149 24.5 28.050000000000004 27.47 19.98 150-151 24.349999999999998 27.725 28.1125 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 4.0 25 5.0 26 4.0 27 5.5 28 4.5 29 7.0 30 9.5 31 12.0 32 20.0 33 30.0 34 50.0 35 66.5 36 70.5 37 103.0 38 144.5 39 171.5 40 201.0 41 221.5 42 241.5 43 276.0 44 308.0 45 295.5 46 270.5 47 264.0 48 240.5 49 213.5 50 171.5 51 135.5 52 119.0 53 91.5 54 66.5 55 47.5 56 34.5 57 22.5 58 16.0 59 14.5 60 10.5 61 7.0 62 6.5 63 4.0 64 4.0 65 4.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 2.975 0.0 0.0 0.0 0.0 138-139 3.3375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCATG 10 0.006830828 145.0 7 >>END_MODULE Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671688 spots for SRR7172636.sra Written 671688 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra Read 671671 spots for SRR7172636.sra Written 671671 spots for SRR7172636.sra SRR ids: ['SRR7172636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v7dail9x SRR7172636.sra spots: 13433437 blocks: [[1, 671671], [671672, 1343342], [1343343, 2015013], [2015014, 2686684], [2686685, 3358355], [3358356, 4030026], [4030027, 4701697], [4701698, 5373368], [5373369, 6045039], [6045040, 6716710], [6716711, 7388381], [7388382, 8060052], [8060053, 8731723], [8731724, 9403394], [9403395, 10075065], [10075066, 10746736], [10746737, 11418407], [11418408, 12090078], [12090079, 12761749], [12761750, 13433437]] SRR7172636 file size 4530450 SRR7172636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172636 SRR7172636_1.fastq SRR7172636_2.fastq Input file: SRR7172636_1.fastq Paired file: SRR7172636_2.fastq trimmed: SRR7172636-trimmed-pair1.fastq, SRR7172636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:01:10 2025 >> started Mon Feb 10 11:01:24 2025 >> done (13.909s) 13433437 read pairs processed; of these: 6124 ( 0.05%) short read pairs filtered out after trimming by size control 4812 ( 0.04%) empty read pairs filtered out after trimming by size control 13422501 (99.92%) read pairs available; of these: 5798818 (43.20%) trimmed read pairs available after processing 7623683 (56.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 1 0.00% 24 7 0.00% 25 1 0.00% 26 8 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 4 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 4 0.00% 36 3 0.00% 37 2 0.00% 38 3 0.00% 39 1 0.00% 40 3 0.00% 41 9 0.00% 42 3 0.00% 43 7 0.00% 44 7 0.00% 45 5 0.00% 46 2 0.00% 47 8 0.00% 48 13 0.00% 49 12 0.00% 50 12 0.00% 51 17 0.00% 52 11 0.00% 53 17 0.00% 54 18 0.00% 55 17 0.00% 56 22 0.00% 57 23 0.00% 58 22 0.00% 59 26 0.00% 60 49 0.00% 61 45 0.00% 62 40 0.00% 63 45 0.00% 64 75 0.00% 65 74 0.00% 66 76 0.00% 67 64 0.00% 68 97 0.00% 69 92 0.00% 70 149 0.00% 71 156 0.00% 72 162 0.00% 73 191 0.00% 74 233 0.00% 75 298 0.00% 76 426 0.00% 77 402 0.00% 78 425 0.00% 79 461 0.00% 80 499 0.00% 81 557 0.00% 82 716 0.01% 83 811 0.01% 84 1167 0.01% 85 1464 0.01% 86 1600 0.01% 87 1730 0.01% 88 1939 0.01% 89 1990 0.01% 90 2228 0.02% 91 2455 0.02% 92 2579 0.02% 93 2802 0.02% 94 3110 0.02% 95 3327 0.02% 96 3685 0.03% 97 3900 0.03% 98 4141 0.03% 99 4372 0.03% 100 4870 0.04% 101 5084 0.04% 102 5529 0.04% 103 5971 0.04% 104 6238 0.05% 105 6899 0.05% 106 7331 0.05% 107 7573 0.06% 108 8315 0.06% 109 8788 0.07% 110 9261 0.07% 111 9697 0.07% 112 10490 0.08% 113 11084 0.08% 114 11862 0.09% 115 12734 0.09% 116 13424 0.10% 117 14327 0.11% 118 14949 0.11% 119 15536 0.12% 120 16117 0.12% 121 17143 0.13% 122 17952 0.13% 123 19165 0.14% 124 20096 0.15% 125 21282 0.16% 126 22233 0.17% 127 23527 0.18% 128 24810 0.18% 129 25881 0.19% 130 27478 0.20% 131 28613 0.21% 132 30664 0.23% 133 32751 0.24% 134 34740 0.26% 135 36776 0.27% 136 39927 0.30% 137 42818 0.32% 138 46230 0.34% 139 49981 0.37% 140 54399 0.41% 141 60315 0.45% 142 66953 0.50% 143 74881 0.56% 144 88142 0.66% 145 106693 0.79% 146 136204 1.01% 147 188762 1.41% 148 301650 2.25% 149 631433 4.70% 150 3272299 24.38% 151 7623683 56.80% 13422501 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.59 fanout-score-rank=18 prefix-density=0.30 prefix-fanout=3.9 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=129.66 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.2 sequence=GAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=61.56 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.2 sequence=TGGTGATGCAGTGCCTTGGTGCCATATGCGGTGCTGGTGTGGTGAAAGGATTTTACGGGAAAACAAACTACGAGTTGCATAATGGTGGTGCCAATATGGTCGCTCATGGTTACACCAAAGGTGATGGCCTTGGTGCTGAGATTGT SRR7172636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:02:21 Started mapping on | Feb 10 11:02:21 Finished on | Feb 10 11:03:48 Mapping speed, Million of reads per hour | 555.41 Number of input reads | 13422501 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12803054 Uniquely mapped reads % | 95.39% Average mapped length | 296.75 Number of splices: Total | 13129822 Number of splices: Annotated (sjdb) | 12909544 Number of splices: GT/AG | 12929385 Number of splices: GC/AG | 160225 Number of splices: AT/AC | 9416 Number of splices: Non-canonical | 30796 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303439 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 36284 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322322 322322 322322 N_multimapping 303439 303439 303439 N_noFeature 295713 12695856 339169 N_ambiguous 125710 881 61396 UnstrandedReadsAssigned:12381631 PositiveStrandReadsAssigned:106317 NegativeStrandReadsAssigned:12402489 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172636-trimmed-pair1.fastq SRR7172636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,422,501 reads, 12,278,226 reads pseudoaligned [quant] estimated average fragment length: 254.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7172636.ke.tsv 34699 SRR7172636.se.tsv 87100 total ==> SRR7172636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.44 1326 62.6364 Potri.005G024800.1.v4.1 1035 781.441 557 59.4086 Potri.004G059700.1.v4.1 961 707.485 11 1.29588 Potri.007G009000.2.v4.1 1416 1162.44 0 0 Potri.003G141000.2.v4.1 2943 2689.44 562 17.4166 Potri.016G087400.1.v4.1 270 73.3154 760 863.99 Potri.015G069301.1.v4.1 564 316.626 0 0 Potri.010G195200.1.v4.1 1773 1519.44 356 19.5279 Potri.012G127500.1.v4.1 977 723.452 2209 254.493 ==> SRR7172636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 119 SRR7172636 completed mapping pipeline successfully