Starting /dee2/code/volunteer_pipeline.sh SRR7172637 current disk space = 3059103367168 free memory = 1406210464 SRR7172637 SRAfilesize 4ab4e671ce353aee6c6cb93d5529dc0f SRR7172637.sra SRR7172637.sra file validated SRR7172637 is paired end SRR7172637 is conventional basespace SRR7172637 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.166 25.0 18.0 32.0 18.0 33.0 2 30.5305 31.0 29.0 33.0 27.0 33.0 3 31.2105 33.0 32.0 33.0 27.0 33.0 4 32.1305 33.0 32.0 33.0 31.0 33.0 5 31.8825 33.0 32.0 33.0 30.0 33.0 6 37.0625 38.0 37.0 38.0 36.0 38.0 7 37.391 38.0 38.0 38.0 37.0 38.0 8 37.6315 38.0 38.0 38.0 38.0 38.0 9 37.559 38.0 38.0 38.0 38.0 38.0 10-14 37.65745 38.0 38.0 38.0 38.0 38.0 15-19 37.66735 38.0 38.0 38.0 38.0 38.0 20-24 37.623400000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6536 38.0 38.0 38.0 38.0 38.0 30-34 37.619150000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.61985 38.0 38.0 38.0 38.0 38.0 40-44 37.5758 38.0 38.0 38.0 38.0 38.0 45-49 37.500800000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.45305 38.0 38.0 38.0 37.6 38.0 55-59 37.41385 38.0 38.0 38.0 37.0 38.0 60-64 37.38965 38.0 38.0 38.0 37.0 38.0 65-69 37.31585 38.0 38.0 38.0 37.0 38.0 70-74 37.260149999999996 38.0 38.0 38.0 36.8 38.0 75-79 37.16175 38.0 38.0 38.0 36.4 38.0 80-84 37.005900000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.9765 38.0 38.0 38.0 36.0 38.0 90-94 37.0192 38.0 38.0 38.0 36.0 38.0 95-99 36.993399999999994 38.0 38.0 38.0 36.0 38.0 100-104 36.859 38.0 38.0 38.0 35.0 38.0 105-109 36.5887 38.0 38.0 38.0 34.4 38.0 110-114 36.39315 38.0 38.0 38.0 34.0 38.0 115-119 36.38605 38.0 38.0 38.0 34.0 38.0 120-124 36.26535 38.0 38.0 38.0 34.0 38.0 125-129 35.900999999999996 38.0 37.0 38.0 32.6 38.0 130-134 35.41455 38.0 36.2 38.0 29.2 38.0 135-139 35.16609999999999 38.0 35.8 38.0 29.2 38.0 140-144 35.0576 38.0 35.6 38.0 29.0 38.0 145-149 34.75095 38.0 35.0 38.0 28.6 38.0 150-151 31.172125 36.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.0 18 1.0 19 0.0 20 1.0 21 4.0 22 2.0 23 5.0 24 4.0 25 5.0 26 9.0 27 14.0 28 13.0 29 21.0 30 24.0 31 45.0 32 79.0 33 92.0 34 136.0 35 238.0 36 724.0 37 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4011822153688 13.9295810845541 13.852480082241069 42.816756617836035 2 18.325394835798445 20.155427425419905 38.530960140386064 22.98821759839559 3 18.775 24.95 25.5 30.775000000000002 4 23.575 33.2 20.075000000000003 23.150000000000002 5 23.025000000000002 33.625 24.224999999999998 19.125 6 16.875 36.95 25.6 20.575 7 13.15 23.400000000000002 44.875 18.575 8 18.375 22.425 30.675 28.525 9 18.55 21.45 32.95 27.05 10-14 19.46 29.62 27.084999999999997 23.835 15-19 19.994999999999997 28.4 28.015 23.59 20-24 19.75 28.87 27.96 23.419999999999998 25-29 19.97 28.28 28.235 23.515 30-34 19.765 28.62 27.765 23.849999999999998 35-39 19.650000000000002 28.33 28.084999999999997 23.935000000000002 40-44 19.97 28.625 27.715 23.69 45-49 19.64 28.694999999999997 27.955000000000002 23.71 50-54 19.365 28.384999999999998 27.875 24.375 55-59 19.975 29.035 27.295 23.695 60-64 19.93 28.12 27.935 24.015 65-69 19.86 28.285 27.96 23.895 70-74 20.07 28.43 27.605 23.895 75-79 20.075000000000003 28.744999999999997 27.82 23.36 80-84 20.335 28.105000000000004 27.66 23.9 85-89 19.805 28.720000000000002 27.815 23.66 90-94 20.369999999999997 27.900000000000002 28.345 23.385 95-99 20.11 28.060000000000002 27.834999999999997 23.995 100-104 20.595 28.044999999999998 27.83 23.53 105-109 20.26 27.73 27.884999999999998 24.125 110-114 20.41 27.389999999999997 28.365000000000002 23.835 115-119 20.69 28.685 27.395000000000003 23.23 120-124 20.51 28.64 27.185 23.665 125-129 20.755000000000003 27.775 27.74 23.73 130-134 21.275 28.515 27.195000000000004 23.015 135-139 20.830000000000002 28.275 27.865000000000002 23.03 140-144 21.47 28.625 26.705000000000002 23.200000000000003 145-149 20.7 28.425 26.93 23.945 150-151 20.275000000000002 28.7 26.5125 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 4.5 26 2.5 27 3.5 28 7.0 29 12.0 30 24.0 31 31.0 32 29.5 33 34.5 34 42.0 35 67.5 36 103.5 37 119.5 38 138.0 39 167.5 40 196.5 41 230.0 42 254.5 43 271.0 44 288.5 45 289.5 46 269.5 47 262.5 48 230.0 49 187.5 50 167.0 51 141.5 52 108.5 53 75.0 54 59.5 55 45.5 56 28.5 57 23.0 58 20.5 59 14.0 60 13.5 61 10.5 62 5.5 63 4.5 64 5.0 65 2.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.15 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.975 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTATGT 10 0.006843168 144.91249 3 TGTGTTG 10 0.006843168 144.91249 3 >>END_MODULE SRR7172637 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.154 34.0 33.0 34.0 33.0 34.0 2 33.245 34.0 33.0 34.0 33.0 34.0 3 33.2805 34.0 33.0 34.0 33.0 34.0 4 33.21825 34.0 33.0 34.0 33.0 34.0 5 33.1445 34.0 33.0 34.0 33.0 34.0 6 37.29125 38.0 38.0 38.0 37.0 38.0 7 37.26475 38.0 38.0 38.0 38.0 38.0 8 37.35775 38.0 38.0 38.0 38.0 38.0 9 37.34175 38.0 38.0 38.0 38.0 38.0 10-14 37.3236 38.0 38.0 38.0 37.8 38.0 15-19 37.3324 38.0 38.0 38.0 38.0 38.0 20-24 37.28705 38.0 38.0 38.0 37.6 38.0 25-29 37.174850000000006 38.0 38.0 38.0 37.6 38.0 30-34 36.5647 38.0 38.0 38.0 36.8 38.0 35-39 36.8264 38.0 38.0 38.0 36.4 38.0 40-44 37.2027 38.0 38.0 38.0 37.0 38.0 45-49 37.195299999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.1656 38.0 38.0 38.0 37.0 38.0 55-59 37.095749999999995 38.0 38.0 38.0 37.0 38.0 60-64 36.93295 38.0 38.0 38.0 36.0 38.0 65-69 36.6799 38.0 38.0 38.0 35.2 38.0 70-74 36.795750000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.7515 38.0 38.0 38.0 35.4 38.0 80-84 36.870400000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.72275 38.0 38.0 38.0 35.2 38.0 90-94 36.643150000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.57535 38.0 38.0 38.0 35.0 38.0 100-104 36.422549999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.2902 38.0 38.0 38.0 34.0 38.0 110-114 36.0869 38.0 38.0 38.0 34.0 38.0 115-119 35.9705 38.0 37.4 38.0 33.4 38.0 120-124 35.71645 38.0 37.0 38.0 32.0 38.0 125-129 35.40735 38.0 36.4 38.0 30.6 38.0 130-134 35.068949999999994 38.0 36.0 38.0 28.8 38.0 135-139 34.655649999999994 38.0 35.8 38.0 27.6 38.0 140-144 34.43845 38.0 35.6 38.0 27.6 38.0 145-149 33.5031 38.0 33.4 38.0 20.0 38.0 150-151 29.135875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 3.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 4.0 17 2.0 18 7.0 19 4.0 20 9.0 21 4.0 22 7.0 23 8.0 24 8.0 25 14.0 26 12.0 27 15.0 28 21.0 29 31.0 30 41.0 31 61.0 32 48.0 33 91.0 34 165.0 35 289.0 36 546.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.125 13.925 19.775000000000002 33.175 2 24.5 20.724999999999998 38.15 16.625 3 21.349999999999998 26.150000000000002 30.55 21.95 4 25.45 33.175 22.775000000000002 18.6 5 25.074999999999996 36.75 21.4 16.775000000000002 6 17.8 38.975 23.95 19.275000000000002 7 17.75 16.525000000000002 44.05 21.675 8 20.575 22.725 28.925 27.775 9 22.8 24.099999999999998 28.000000000000004 25.1 10-14 23.11 29.104999999999997 26.015 21.77 15-19 22.425 28.549999999999997 28.315 20.71 20-24 23.035 27.765 27.334999999999997 21.865000000000002 25-29 22.969651366942564 28.54778028592927 27.153248056182594 21.32932029094557 30-34 22.493114352749156 28.649393042946038 27.7517086606141 21.105783943690707 35-39 23.86615601693207 28.37633541624672 26.894779278371296 20.86272928844991 40-44 23.175 28.22 27.425 21.18 45-49 23.445 27.700000000000003 27.955000000000002 20.9 50-54 23.400000000000002 28.425 27.41 20.765 55-59 23.395 27.88 27.435 21.29 60-64 23.325000000000003 28.349999999999998 27.794999999999998 20.53 65-69 23.72 27.474999999999998 27.815 20.990000000000002 70-74 23.87 28.199999999999996 27.24 20.69 75-79 23.215 28.105000000000004 28.349999999999998 20.330000000000002 80-84 23.665 27.935 27.994999999999997 20.405 85-89 24.39 28.294999999999998 27.18 20.135 90-94 23.685000000000002 28.139999999999997 27.855 20.32 95-99 23.605 28.24 27.955000000000002 20.200000000000003 100-104 23.78 28.134999999999998 27.395000000000003 20.69 105-109 23.380000000000003 28.315 28.335 19.97 110-114 23.635 28.044999999999998 27.694999999999997 20.625 115-119 23.86 27.810000000000002 27.794999999999998 20.535 120-124 23.885 28.055000000000003 27.435 20.625 125-129 23.865 28.215 27.584999999999997 20.335 130-134 24.01 28.189999999999998 27.42 20.380000000000003 135-139 24.044999999999998 28.025 27.455000000000002 20.474999999999998 140-144 24.535 27.83 28.075 19.56 145-149 24.58 28.12 27.534999999999997 19.765 150-151 25.474999999999998 28.9125 26.25 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.5 26 3.5 27 4.0 28 4.5 29 5.5 30 9.0 31 11.0 32 16.0 33 27.0 34 42.5 35 52.5 36 67.0 37 96.5 38 128.0 39 165.0 40 219.5 41 254.0 42 269.5 43 289.5 44 296.5 45 284.0 46 268.0 47 257.5 48 246.0 49 208.5 50 171.0 51 144.0 52 100.0 53 81.5 54 70.0 55 48.5 56 38.0 57 30.5 58 21.0 59 16.0 60 12.0 61 9.0 62 6.0 63 3.5 64 3.0 65 1.5 66 2.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.325 30-34 1.97 35-39 0.7799999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.15 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.975 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 4.05 0.0 0.0 0.0 0.0 138-139 4.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGCA 10 0.00687326 144.7 9 ATTTCCA 10 0.00687326 144.7 4 GAGATGC 10 0.00687326 144.7 1 >>END_MODULE Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812429 spots for SRR7172637.sra Written 812429 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra Read 812418 spots for SRR7172637.sra Written 812418 spots for SRR7172637.sra SRR ids: ['SRR7172637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4fuc2761 SRR7172637.sra spots: 16248371 blocks: [[1, 812418], [812419, 1624836], [1624837, 2437254], [2437255, 3249672], [3249673, 4062090], [4062091, 4874508], [4874509, 5686926], [5686927, 6499344], [6499345, 7311762], [7311763, 8124180], [8124181, 8936598], [8936599, 9749016], [9749017, 10561434], [10561435, 11373852], [11373853, 12186270], [12186271, 12998688], [12998689, 13811106], [13811107, 14623524], [14623525, 15435942], [15435943, 16248371]] SRR7172637 file size 5484339 SRR7172637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172637 SRR7172637_1.fastq SRR7172637_2.fastq Input file: SRR7172637_1.fastq Paired file: SRR7172637_2.fastq trimmed: SRR7172637-trimmed-pair1.fastq, SRR7172637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:03:58 2025 >> started Mon Feb 10 15:04:20 2025 >> done (22.684s) 16248371 read pairs processed; of these: 11741 ( 0.07%) short read pairs filtered out after trimming by size control 9448 ( 0.06%) empty read pairs filtered out after trimming by size control 16227182 (99.87%) read pairs available; of these: 6369622 (39.25%) trimmed read pairs available after processing 9857560 (60.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 0 0.00% 35 1 0.00% 36 3 0.00% 37 4 0.00% 38 1 0.00% 39 2 0.00% 40 4 0.00% 41 4 0.00% 42 5 0.00% 43 3 0.00% 44 6 0.00% 45 6 0.00% 46 5 0.00% 47 10 0.00% 48 2 0.00% 49 5 0.00% 50 11 0.00% 51 10 0.00% 52 9 0.00% 53 15 0.00% 54 14 0.00% 55 17 0.00% 56 24 0.00% 57 24 0.00% 58 31 0.00% 59 32 0.00% 60 45 0.00% 61 52 0.00% 62 55 0.00% 63 55 0.00% 64 39 0.00% 65 76 0.00% 66 69 0.00% 67 71 0.00% 68 110 0.00% 69 118 0.00% 70 144 0.00% 71 177 0.00% 72 195 0.00% 73 217 0.00% 74 251 0.00% 75 312 0.00% 76 361 0.00% 77 439 0.00% 78 437 0.00% 79 541 0.00% 80 620 0.00% 81 707 0.00% 82 798 0.00% 83 1025 0.01% 84 1680 0.01% 85 2080 0.01% 86 2241 0.01% 87 2471 0.02% 88 2662 0.02% 89 2789 0.02% 90 2940 0.02% 91 3080 0.02% 92 3339 0.02% 93 3668 0.02% 94 3909 0.02% 95 4277 0.03% 96 4632 0.03% 97 5010 0.03% 98 5488 0.03% 99 5882 0.04% 100 6205 0.04% 101 6703 0.04% 102 7299 0.04% 103 7955 0.05% 104 8526 0.05% 105 9281 0.06% 106 9844 0.06% 107 10637 0.07% 108 11255 0.07% 109 11878 0.07% 110 12723 0.08% 111 13566 0.08% 112 14357 0.09% 113 15372 0.09% 114 16321 0.10% 115 17189 0.11% 116 18264 0.11% 117 19115 0.12% 118 20497 0.13% 119 21315 0.13% 120 22418 0.14% 121 23485 0.14% 122 24916 0.15% 123 25911 0.16% 124 27676 0.17% 125 28867 0.18% 126 30231 0.19% 127 31892 0.20% 128 33201 0.20% 129 35462 0.22% 130 36742 0.23% 131 38732 0.24% 132 40784 0.25% 133 43232 0.27% 134 45455 0.28% 135 47635 0.29% 136 50757 0.31% 137 54298 0.33% 138 57485 0.35% 139 62283 0.38% 140 66492 0.41% 141 72371 0.45% 142 79853 0.49% 143 87542 0.54% 144 100357 0.62% 145 119444 0.74% 146 147297 0.91% 147 199201 1.23% 148 317785 1.96% 149 601499 3.71% 150 3494686 21.54% 151 9857560 60.75% 16227182 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=3.4 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=372.21 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=34.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.6 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=382.90 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR7172637 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:05:09 Started mapping on | Feb 10 15:05:10 Finished on | Feb 10 15:07:17 Mapping speed, Million of reads per hour | 459.98 Number of input reads | 16227182 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15297498 Uniquely mapped reads % | 94.27% Average mapped length | 296.59 Number of splices: Total | 16106560 Number of splices: Annotated (sjdb) | 15844977 Number of splices: GT/AG | 15857938 Number of splices: GC/AG | 202335 Number of splices: AT/AC | 11964 Number of splices: Non-canonical | 34323 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394918 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 30562 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 545472 545472 545472 N_multimapping 394918 394918 394918 N_noFeature 311096 15171806 354482 N_ambiguous 153055 1039 70149 UnstrandedReadsAssigned:14833347 PositiveStrandReadsAssigned:124653 NegativeStrandReadsAssigned:14872867 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172637-trimmed-pair1.fastq SRR7172637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,227,182 reads, 14,730,599 reads pseudoaligned [quant] estimated average fragment length: 241.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR7172637.ke.tsv 34699 SRR7172637.se.tsv 87100 total ==> SRR7172637.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.56 1150 40.6794 Potri.005G024800.1.v4.1 1035 794.565 171 13.5322 Potri.004G059700.1.v4.1 961 720.591 26 2.26875 Potri.007G009000.2.v4.1 1416 1175.56 0 0 Potri.003G141000.2.v4.1 2943 2702.56 556 12.936 Potri.016G087400.1.v4.1 270 75.5647 1136.7 945.862 Potri.015G069301.1.v4.1 564 326.567 0 0 Potri.010G195200.1.v4.1 1773 1532.56 262 10.7494 Potri.012G127500.1.v4.1 977 736.586 2190 186.949 ==> SRR7172637.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 212 SRR7172637 completed mapping pipeline successfully