Starting /dee2/code/volunteer_pipeline.sh SRR7172638 current disk space = 3059103383552 free memory = 1531484092 SRR7172638 SRAfilesize 3e258595f38d5316e6b8f2427d679dea SRR7172638.sra SRR7172638.sra file validated SRR7172638 is paired end SRR7172638 is conventional basespace SRR7172638 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.93175 32.0 28.0 33.0 18.0 34.0 2 31.58025 33.0 32.0 33.0 27.0 34.0 3 31.8535 33.0 31.0 33.0 29.0 34.0 4 32.561 33.0 33.0 34.0 32.0 34.0 5 32.83125 33.0 33.0 34.0 32.0 34.0 6 37.0585 38.0 37.0 38.0 36.0 38.0 7 37.41125 38.0 38.0 38.0 37.0 38.0 8 37.559 38.0 38.0 38.0 38.0 38.0 9 37.60525 38.0 38.0 38.0 38.0 38.0 10-14 37.6654 38.0 38.0 38.0 38.0 38.0 15-19 37.6148 38.0 38.0 38.0 38.0 38.0 20-24 37.575450000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6087 38.0 38.0 38.0 38.0 38.0 30-34 37.64675 38.0 38.0 38.0 38.0 38.0 35-39 37.60905 38.0 38.0 38.0 38.0 38.0 40-44 37.5543 38.0 38.0 38.0 38.0 38.0 45-49 37.521699999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.4419 38.0 38.0 38.0 37.8 38.0 55-59 37.39085 38.0 38.0 38.0 37.2 38.0 60-64 37.346999999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.25555 38.0 38.0 38.0 36.8 38.0 70-74 37.20515 38.0 38.0 38.0 36.8 38.0 75-79 37.063250000000004 38.0 38.0 38.0 36.2 38.0 80-84 36.9936 38.0 38.0 38.0 35.8 38.0 85-89 36.8781 38.0 38.0 38.0 35.6 38.0 90-94 36.90195 38.0 38.0 38.0 35.6 38.0 95-99 36.8971 38.0 38.0 38.0 35.6 38.0 100-104 36.743700000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.559549999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.34945 38.0 38.0 38.0 34.0 38.0 115-119 36.21145 38.0 38.0 38.0 33.8 38.0 120-124 36.34065 38.0 38.0 38.0 34.0 38.0 125-129 36.006150000000005 38.0 37.0 38.0 33.0 38.0 130-134 35.5173 38.0 36.2 38.0 30.0 38.0 135-139 35.27095 38.0 36.0 38.0 29.0 38.0 140-144 35.1729 38.0 36.0 38.0 30.0 38.0 145-149 34.5193 38.0 35.2 38.0 27.0 38.0 150-151 30.704874999999998 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 4.0 21 2.0 22 3.0 23 1.0 24 4.0 25 9.0 26 11.0 27 8.0 28 15.0 29 24.0 30 43.0 31 54.0 32 57.0 33 87.0 34 139.0 35 239.0 36 671.0 37 2620.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.768796510136 13.651526815499102 11.983577110597896 41.596099563767005 2 19.421906693711968 19.26977687626775 37.09432048681541 24.213995943204868 3 22.15 24.099999999999998 24.474999999999998 29.275000000000002 4 22.875 32.6 21.349999999999998 23.175 5 21.475 35.5 25.3 17.724999999999998 6 17.675 35.025 27.125 20.175 7 14.274999999999999 21.7 43.625 20.4 8 17.775 23.125 30.55 28.549999999999997 9 18.375 22.675 34.300000000000004 24.65 10-14 20.32 29.01 27.66 23.01 15-19 20.145 28.685 28.01 23.16 20-24 20.485 28.110000000000003 27.950000000000003 23.455000000000002 25-29 20.3 28.435 27.894999999999996 23.369999999999997 30-34 20.03 28.044999999999998 28.15 23.775 35-39 20.669999999999998 27.915 27.794999999999998 23.62 40-44 20.085 28.799999999999997 27.839999999999996 23.275000000000002 45-49 20.405 28.565 27.82 23.21 50-54 20.615 28.93 27.075 23.380000000000003 55-59 20.265 28.165000000000003 28.16 23.41 60-64 20.215 27.865000000000002 28.194999999999997 23.724999999999998 65-69 20.185 27.805000000000003 27.905 24.104999999999997 70-74 20.560000000000002 28.065 28.07 23.305 75-79 20.645 27.750000000000004 28.035 23.57 80-84 20.535 28.125 27.6 23.74 85-89 20.43 27.794999999999998 28.244999999999997 23.53 90-94 20.849999999999998 27.935 27.625 23.59 95-99 21.115000000000002 28.04 27.29 23.555 100-104 20.424999999999997 28.01 28.349999999999998 23.215 105-109 20.325 27.68 27.975 24.02 110-114 20.812487492495496 28.001801080648388 27.881729037422453 23.30398238943366 115-119 20.894699929866746 27.742711151187255 27.988177537320908 23.374411381625087 120-124 20.880000000000003 27.43 28.34 23.35 125-129 20.565 27.515 28.105000000000004 23.815 130-134 20.955 28.050000000000004 27.71 23.285 135-139 20.835 28.310000000000002 27.029999999999998 23.825 140-144 21.15 27.389999999999997 27.73 23.73 145-149 21.215 27.985 27.33 23.47 150-151 21.4125 28.487499999999997 26.2125 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 3.5 25 5.0 26 4.5 27 6.0 28 10.5 29 18.5 30 19.5 31 21.0 32 28.5 33 39.0 34 52.5 35 74.0 36 91.5 37 100.5 38 126.0 39 160.5 40 201.5 41 228.0 42 236.0 43 249.5 44 288.5 45 290.5 46 266.5 47 254.0 48 209.0 49 199.5 50 177.5 51 131.0 52 113.0 53 93.5 54 66.5 55 39.5 56 35.5 57 39.0 58 31.5 59 22.0 60 18.5 61 14.0 62 9.5 63 6.5 64 3.5 65 2.5 66 1.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 1.4000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.19 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.3375000000000004 0.0 0.0 0.0 0.0 132-133 3.5999999999999996 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCC 10 0.0056292964 154.56001 1 CTGAAGT 10 0.0068449317 144.90001 6 >>END_MODULE SRR7172638 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14925 34.0 33.0 34.0 32.0 34.0 2 33.2355 34.0 33.0 34.0 33.0 34.0 3 33.099 34.0 33.0 34.0 32.0 34.0 4 33.18925 34.0 33.0 34.0 33.0 34.0 5 33.2005 34.0 33.0 34.0 33.0 34.0 6 37.3355 38.0 38.0 38.0 37.0 38.0 7 37.29575 38.0 38.0 38.0 38.0 38.0 8 37.3035 38.0 38.0 38.0 38.0 38.0 9 37.31825 38.0 38.0 38.0 38.0 38.0 10-14 37.312200000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.318799999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.302499999999995 38.0 38.0 38.0 38.0 38.0 25-29 36.948249999999994 38.0 38.0 38.0 37.4 38.0 30-34 36.3554 38.0 38.0 38.0 36.6 38.0 35-39 36.64205 38.0 38.0 38.0 36.6 38.0 40-44 37.15785 38.0 38.0 38.0 37.0 38.0 45-49 37.1965 38.0 38.0 38.0 37.2 38.0 50-54 37.17935 38.0 38.0 38.0 37.0 38.0 55-59 37.0587 38.0 38.0 38.0 37.0 38.0 60-64 36.9316 38.0 38.0 38.0 36.4 38.0 65-69 36.81975 38.0 38.0 38.0 36.0 38.0 70-74 36.8446 38.0 38.0 38.0 36.0 38.0 75-79 36.880399999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.7494 38.0 38.0 38.0 35.8 38.0 85-89 36.749649999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.624 38.0 38.0 38.0 35.0 38.0 95-99 36.510650000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.388999999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.384100000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.213499999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.998200000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.81445000000001 38.0 37.6 38.0 32.6 38.0 125-129 35.633050000000004 38.0 37.2 38.0 31.6 38.0 130-134 35.314499999999995 38.0 36.4 38.0 29.4 38.0 135-139 35.1192 38.0 36.0 38.0 28.6 38.0 140-144 34.689800000000005 38.0 35.8 38.0 27.6 38.0 145-149 33.6982 38.0 33.8 38.0 20.8 38.0 150-151 29.930999999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 1.0 5 3.0 6 2.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 5.0 13 0.0 14 3.0 15 0.0 16 0.0 17 4.0 18 5.0 19 5.0 20 4.0 21 3.0 22 9.0 23 6.0 24 15.0 25 16.0 26 15.0 27 10.0 28 27.0 29 36.0 30 41.0 31 53.0 32 64.0 33 98.0 34 168.0 35 242.0 36 433.0 37 2719.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.65 15.075 17.349999999999998 30.925000000000004 2 21.925 24.25 36.075 17.75 3 19.925 27.224999999999998 30.775000000000002 22.075 4 24.875 33.175 21.675 20.275000000000002 5 24.224999999999998 35.825 22.35 17.599999999999998 6 18.975 36.1 25.324999999999996 19.6 7 18.5 18.075 41.85 21.575 8 21.075 22.2 28.050000000000004 28.675 9 22.7 24.5 28.575 24.224999999999998 10-14 23.025000000000002 28.9 26.305 21.77 15-19 22.93 27.810000000000002 27.889999999999997 21.37 20-24 22.93 28.93 27.089999999999996 21.05 25-29 22.831073246962745 27.947774361042498 28.204869687956847 21.01628270403791 30-34 23.169919573792328 27.79058449874494 27.88279288970852 21.156703037754212 35-39 23.285381420322157 27.89484348090366 27.930300881369668 20.88947421740452 40-44 23.49 27.73 27.810000000000002 20.97 45-49 23.549999999999997 28.065 27.355 21.029999999999998 50-54 23.445 28.444999999999997 27.295 20.815 55-59 23.05 27.834999999999997 27.82 21.295 60-64 23.315 27.73 27.985 20.97 65-69 23.43 27.985 27.529999999999998 21.055 70-74 23.855 28.16 26.735 21.25 75-79 23.47 28.265 28.084999999999997 20.18 80-84 23.485 27.800000000000004 27.515 21.2 85-89 23.455000000000002 28.255000000000003 27.065 21.224999999999998 90-94 23.935000000000002 27.965 27.49 20.61 95-99 23.96 27.644999999999996 27.675 20.72 100-104 23.61 28.144999999999996 27.6 20.645 105-109 23.735 27.675 28.084999999999997 20.505000000000003 110-114 23.78 27.975 27.48 20.765 115-119 23.715 28.189999999999998 27.62 20.474999999999998 120-124 23.745 27.615000000000002 27.950000000000003 20.69 125-129 24.075 28.29 27.6 20.035 130-134 24.705 27.894999999999996 27.279999999999998 20.119999999999997 135-139 24.035 28.505000000000003 27.315 20.145 140-144 24.285 27.705000000000002 28.04 19.97 145-149 24.485 28.194999999999997 26.855 20.465 150-151 26.075 28.299999999999997 26.200000000000003 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 2.5 27 1.0 28 5.0 29 6.5 30 7.0 31 15.5 32 23.5 33 23.5 34 36.5 35 63.0 36 79.5 37 104.0 38 134.0 39 173.0 40 208.0 41 243.0 42 272.0 43 271.5 44 284.5 45 277.0 46 258.0 47 253.0 48 225.5 49 183.0 50 163.5 51 157.5 52 127.5 53 92.0 54 69.0 55 59.0 56 48.0 57 35.0 58 24.5 59 14.0 60 10.5 61 7.0 62 5.5 63 7.0 64 6.5 65 5.0 66 3.0 67 2.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.815 30-34 2.395 35-39 1.29 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.2874999999999996 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACTC 10 0.006862618 144.77501 8 >>END_MODULE Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739025 spots for SRR7172638.sra Written 739025 spots for SRR7172638.sra Read 739030 spots for SRR7172638.sra Written 739030 spots for SRR7172638.sra SRR ids: ['SRR7172638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yivevwlx SRR7172638.sra spots: 14780505 blocks: [[1, 739025], [739026, 1478050], [1478051, 2217075], [2217076, 2956100], [2956101, 3695125], [3695126, 4434150], [4434151, 5173175], [5173176, 5912200], [5912201, 6651225], [6651226, 7390250], [7390251, 8129275], [8129276, 8868300], [8868301, 9607325], [9607326, 10346350], [10346351, 11085375], [11085376, 11824400], [11824401, 12563425], [12563426, 13302450], [13302451, 14041475], [14041476, 14780505]] SRR7172638 file size 4986927 SRR7172638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172638 SRR7172638_1.fastq SRR7172638_2.fastq Input file: SRR7172638_1.fastq Paired file: SRR7172638_2.fastq trimmed: SRR7172638-trimmed-pair1.fastq, SRR7172638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:02:06 2025 >> started Mon Feb 10 15:02:22 2025 >> done (15.758s) 14780505 read pairs processed; of these: 13970 ( 0.09%) short read pairs filtered out after trimming by size control 8609 ( 0.06%) empty read pairs filtered out after trimming by size control 14757926 (99.85%) read pairs available; of these: 5812624 (39.39%) trimmed read pairs available after processing 8945302 (60.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 5 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 0 0.00% 34 1 0.00% 35 4 0.00% 36 0 0.00% 37 9 0.00% 38 3 0.00% 39 4 0.00% 40 5 0.00% 41 3 0.00% 42 10 0.00% 43 5 0.00% 44 2 0.00% 45 2 0.00% 46 10 0.00% 47 9 0.00% 48 10 0.00% 49 9 0.00% 50 10 0.00% 51 15 0.00% 52 16 0.00% 53 29 0.00% 54 28 0.00% 55 21 0.00% 56 20 0.00% 57 31 0.00% 58 44 0.00% 59 43 0.00% 60 50 0.00% 61 49 0.00% 62 63 0.00% 63 65 0.00% 64 80 0.00% 65 88 0.00% 66 113 0.00% 67 126 0.00% 68 157 0.00% 69 174 0.00% 70 211 0.00% 71 222 0.00% 72 251 0.00% 73 276 0.00% 74 329 0.00% 75 373 0.00% 76 481 0.00% 77 549 0.00% 78 541 0.00% 79 634 0.00% 80 733 0.00% 81 839 0.01% 82 944 0.01% 83 1158 0.01% 84 2014 0.01% 85 2533 0.02% 86 2669 0.02% 87 2971 0.02% 88 3187 0.02% 89 3237 0.02% 90 3307 0.02% 91 3567 0.02% 92 4000 0.03% 93 4147 0.03% 94 4571 0.03% 95 5024 0.03% 96 5353 0.04% 97 5628 0.04% 98 6163 0.04% 99 6568 0.04% 100 7107 0.05% 101 7788 0.05% 102 8239 0.06% 103 8763 0.06% 104 9463 0.06% 105 10126 0.07% 106 11129 0.08% 107 11612 0.08% 108 12488 0.08% 109 13240 0.09% 110 14025 0.10% 111 14614 0.10% 112 15709 0.11% 113 16564 0.11% 114 17541 0.12% 115 18979 0.13% 116 19553 0.13% 117 20838 0.14% 118 21227 0.14% 119 22356 0.15% 120 23597 0.16% 121 24732 0.17% 122 25875 0.18% 123 27264 0.18% 124 28361 0.19% 125 29552 0.20% 126 31394 0.21% 127 32713 0.22% 128 34076 0.23% 129 35571 0.24% 130 37280 0.25% 131 38526 0.26% 132 40800 0.28% 133 42977 0.29% 134 44870 0.30% 135 46944 0.32% 136 49593 0.34% 137 52591 0.36% 138 55354 0.38% 139 58861 0.40% 140 62865 0.43% 141 67901 0.46% 142 74449 0.50% 143 81454 0.55% 144 92890 0.63% 145 106432 0.72% 146 129610 0.88% 147 170609 1.16% 148 257317 1.74% 149 506429 3.43% 150 3146559 21.32% 151 8945302 60.61% 14757926 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.68 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=420.11 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=34.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=115.18 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=20.8 sequence=GAAGAAGAGAGG SRR7172638 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:03:14 Started mapping on | Feb 10 15:03:14 Finished on | Feb 10 15:05:25 Mapping speed, Million of reads per hour | 405.56 Number of input reads | 14757926 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13728757 Uniquely mapped reads % | 93.03% Average mapped length | 295.91 Number of splices: Total | 13895686 Number of splices: Annotated (sjdb) | 13653094 Number of splices: GT/AG | 13670270 Number of splices: GC/AG | 176622 Number of splices: AT/AC | 10615 Number of splices: Non-canonical | 38179 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375007 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 40128 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667804 667804 667804 N_multimapping 375007 375007 375007 N_noFeature 332304 13597967 390972 N_ambiguous 139441 846 66832 UnstrandedReadsAssigned:13257012 PositiveStrandReadsAssigned:129944 NegativeStrandReadsAssigned:13270953 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172638-trimmed-pair1.fastq SRR7172638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,757,926 reads, 13,194,454 reads pseudoaligned [quant] estimated average fragment length: 237.956 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR7172638.ke.tsv 34699 SRR7172638.se.tsv 87100 total ==> SRR7172638.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.04 985 39.664 Potri.005G024800.1.v4.1 1035 798.044 274 24.624 Potri.004G059700.1.v4.1 961 724.064 85 8.41931 Potri.007G009000.2.v4.1 1416 1179.04 0 0 Potri.003G141000.2.v4.1 2943 2706.04 373.398 9.89626 Potri.016G087400.1.v4.1 270 76.9873 906 844.002 Potri.015G069301.1.v4.1 564 329.976 0 0 Potri.010G195200.1.v4.1 1773 1536.04 219 10.2253 Potri.012G127500.1.v4.1 977 740.049 5911 572.842 ==> SRR7172638.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 62 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 420 SRR7172638 completed mapping pipeline successfully