Starting /dee2/code/volunteer_pipeline.sh SRR7172639 current disk space = 3059137810432 free memory = 1155409560 SRR7172639 SRAfilesize 16b3f1ba5db5e42e97da232c3f602bdd SRR7172639.sra SRR7172639.sra file validated SRR7172639 is paired end SRR7172639 is conventional basespace SRR7172639 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172639_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.6105 33.0 30.0 33.0 18.0 34.0 2 31.77725 33.0 32.0 34.0 28.0 34.0 3 31.99675 33.0 31.0 33.0 29.0 34.0 4 32.60925 33.0 33.0 34.0 32.0 34.0 5 32.766 33.0 33.0 34.0 32.0 34.0 6 37.195 38.0 37.0 38.0 36.0 38.0 7 37.3465 38.0 38.0 38.0 37.0 38.0 8 37.56225 38.0 38.0 38.0 38.0 38.0 9 37.66575 38.0 38.0 38.0 38.0 38.0 10-14 37.653850000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.612399999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.559349999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.61825 38.0 38.0 38.0 38.0 38.0 30-34 37.59185 38.0 38.0 38.0 38.0 38.0 35-39 37.533699999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.5212 38.0 38.0 38.0 38.0 38.0 45-49 37.497550000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.42745 38.0 38.0 38.0 38.0 38.0 55-59 37.3667 38.0 38.0 38.0 37.0 38.0 60-64 37.2721 38.0 38.0 38.0 37.0 38.0 65-69 37.22195000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.1985 38.0 38.0 38.0 36.8 38.0 75-79 37.123850000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.03985 38.0 38.0 38.0 36.0 38.0 85-89 36.9422 38.0 38.0 38.0 35.8 38.0 90-94 36.883799999999994 38.0 38.0 38.0 35.8 38.0 95-99 36.87215 38.0 38.0 38.0 35.4 38.0 100-104 36.7805 38.0 38.0 38.0 35.0 38.0 105-109 36.53375 38.0 38.0 38.0 34.4 38.0 110-114 36.339549999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.21595 38.0 38.0 38.0 34.0 38.0 120-124 36.22965 38.0 38.0 38.0 33.8 38.0 125-129 36.001850000000005 38.0 37.2 38.0 33.0 38.0 130-134 35.5748 38.0 36.4 38.0 30.6 38.0 135-139 35.4056 38.0 36.0 38.0 30.6 38.0 140-144 35.00915 38.0 35.8 38.0 28.2 38.0 145-149 34.6095 38.0 35.4 38.0 28.4 38.0 150-151 30.55 35.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 3.0 20 2.0 21 4.0 22 3.0 23 6.0 24 6.0 25 6.0 26 19.0 27 16.0 28 16.0 29 22.0 30 34.0 31 51.0 32 63.0 33 75.0 34 135.0 35 217.0 36 588.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.743589743589745 14.512820512820513 12.333333333333334 42.41025641025641 2 18.71345029239766 21.103483346046275 38.291380625476734 21.891685736079328 3 19.275000000000002 24.65 26.35 29.725 4 23.45 33.375 21.2 21.975 5 21.9 34.525 25.374999999999996 18.2 6 16.975 36.7 26.8 19.525000000000002 7 13.450000000000001 21.4 44.5 20.65 8 18.725 21.7 30.675 28.9 9 18.45 22.6 31.95 27.0 10-14 19.919999999999998 30.214999999999996 26.305 23.56 15-19 20.285 27.985 27.92 23.810000000000002 20-24 19.93 29.065 27.575 23.43 25-29 19.85 28.925 27.465 23.76 30-34 19.97 29.005 27.400000000000002 23.625 35-39 19.965 28.535 27.944999999999997 23.555 40-44 20.585 27.935 28.265 23.215 45-49 20.11 28.655 27.41 23.825 50-54 20.395 28.655 27.860000000000003 23.09 55-59 19.925 28.42 27.845 23.810000000000002 60-64 19.845 28.405 27.76 23.990000000000002 65-69 20.16 28.37 27.639999999999997 23.830000000000002 70-74 20.535 28.09 27.915 23.46 75-79 19.919999999999998 28.255000000000003 27.834999999999997 23.990000000000002 80-84 20.145 27.950000000000003 27.79 24.115000000000002 85-89 19.835 28.03 28.444999999999997 23.69 90-94 20.605 27.445000000000004 28.105000000000004 23.845 95-99 19.689999999999998 28.720000000000002 28.225 23.365 100-104 20.19 28.52 27.76 23.53 105-109 21.12 28.544999999999998 26.840000000000003 23.494999999999997 110-114 20.018011707609944 27.723019962975936 28.393455746235052 23.865512583179065 115-119 20.624342336022448 27.754672545973847 27.99518965776419 23.625795460239516 120-124 20.544999999999998 27.71 28.205000000000002 23.54 125-129 20.805 27.92 27.77 23.505000000000003 130-134 20.75 28.585 27.32 23.345 135-139 21.16 28.26 26.919999999999998 23.66 140-144 21.015 27.694999999999997 26.834999999999997 24.455 145-149 21.310000000000002 28.084999999999997 27.439999999999998 23.165 150-151 20.825 27.6125 27.487499999999997 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 5.0 28 7.5 29 14.5 30 24.0 31 28.5 32 30.5 33 40.0 34 51.5 35 66.0 36 84.5 37 113.0 38 149.5 39 183.5 40 201.0 41 219.0 42 245.5 43 262.0 44 286.0 45 294.5 46 263.0 47 238.0 48 222.5 49 200.0 50 172.5 51 134.5 52 114.0 53 95.0 54 69.5 55 43.5 56 24.0 57 25.5 58 26.5 59 16.0 60 11.0 61 8.5 62 6.5 63 5.0 64 1.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 1.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.065 115-119 0.215 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.11249999999999999 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.7125000000000004 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007739309 18.090624 130-134 >>END_MODULE SRR7172639 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172639_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23225 34.0 33.0 34.0 33.0 34.0 2 33.3185 34.0 33.0 34.0 33.0 34.0 3 33.25175 34.0 33.0 34.0 33.0 34.0 4 33.33175 34.0 33.0 34.0 33.0 34.0 5 33.32625 34.0 33.0 34.0 33.0 34.0 6 37.4285 38.0 38.0 38.0 38.0 38.0 7 37.40525 38.0 38.0 38.0 38.0 38.0 8 37.4675 38.0 38.0 38.0 38.0 38.0 9 37.41175 38.0 38.0 38.0 38.0 38.0 10-14 37.409 38.0 38.0 38.0 38.0 38.0 15-19 37.41605 38.0 38.0 38.0 38.0 38.0 20-24 37.42915000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.084050000000005 38.0 38.0 38.0 37.8 38.0 30-34 36.46505 38.0 38.0 38.0 37.0 38.0 35-39 36.740449999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.260450000000006 38.0 38.0 38.0 37.6 38.0 45-49 37.33115 38.0 38.0 38.0 38.0 38.0 50-54 37.260450000000006 38.0 38.0 38.0 37.6 38.0 55-59 37.2243 38.0 38.0 38.0 37.0 38.0 60-64 37.09685 38.0 38.0 38.0 37.0 38.0 65-69 37.01735000000001 38.0 38.0 38.0 36.8 38.0 70-74 37.01195 38.0 38.0 38.0 36.8 38.0 75-79 36.9701 38.0 38.0 38.0 36.6 38.0 80-84 36.919149999999995 38.0 38.0 38.0 36.4 38.0 85-89 36.8462 38.0 38.0 38.0 36.0 38.0 90-94 36.79325 38.0 38.0 38.0 35.8 38.0 95-99 36.7053 38.0 38.0 38.0 35.6 38.0 100-104 36.5817 38.0 38.0 38.0 35.0 38.0 105-109 36.51205 38.0 38.0 38.0 34.8 38.0 110-114 36.4113 38.0 38.0 38.0 34.2 38.0 115-119 36.29315 38.0 38.0 38.0 34.0 38.0 120-124 36.07015 38.0 38.0 38.0 33.4 38.0 125-129 35.9391 38.0 38.0 38.0 33.4 38.0 130-134 35.56225 38.0 36.8 38.0 31.8 38.0 135-139 35.253350000000005 38.0 36.0 38.0 30.4 38.0 140-144 34.90145 38.0 36.0 38.0 29.8 38.0 145-149 34.127449999999996 38.0 34.6 38.0 25.4 38.0 150-151 30.19375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 4.0 4 1.0 5 0.0 6 5.0 7 2.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 3.0 14 1.0 15 3.0 16 1.0 17 4.0 18 0.0 19 6.0 20 9.0 21 5.0 22 7.0 23 7.0 24 13.0 25 11.0 26 16.0 27 13.0 28 15.0 29 19.0 30 33.0 31 51.0 32 65.0 33 83.0 34 131.0 35 212.0 36 458.0 37 2818.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.475 14.649999999999999 17.299999999999997 31.574999999999996 2 22.8 23.125 37.574999999999996 16.5 3 20.65 26.174999999999997 30.5 22.675 4 24.0 35.199999999999996 21.65 19.15 5 24.275 37.5 21.275 16.950000000000003 6 17.1 40.300000000000004 24.05 18.55 7 18.85 16.925 41.975 22.25 8 20.175 22.95 27.6 29.275000000000002 9 21.375 25.1 28.325 25.2 10-14 23.32 28.76 26.11 21.81 15-19 23.035 27.88 27.474999999999998 21.61 20-24 22.415 28.34 27.865000000000002 21.38 25-29 22.739643181130933 27.95081141014011 27.804656788630176 21.50488862009878 30-34 22.910264290104486 28.088506453595574 28.05777504609711 20.943454210202827 35-39 23.268529769137302 28.01235317942487 27.617456460105306 21.101660591332525 40-44 23.075000000000003 27.860000000000003 27.98 21.085 45-49 23.244999999999997 28.685 26.93 21.14 50-54 23.674999999999997 28.299999999999997 27.18 20.845 55-59 23.335 28.76 27.05 20.855 60-64 23.56 28.225 27.16 21.055 65-69 23.89 28.410000000000004 27.6 20.1 70-74 23.75 28.18 27.18 20.89 75-79 23.815 27.55 27.58 21.055 80-84 23.865 28.555000000000003 27.32 20.26 85-89 23.605 28.265 27.284999999999997 20.845 90-94 23.635 28.18 27.46 20.724999999999998 95-99 23.75 28.21 27.529999999999998 20.51 100-104 23.485 27.98 28.044999999999998 20.49 105-109 23.76 27.68 27.915 20.645 110-114 23.075000000000003 28.720000000000002 27.525 20.68 115-119 23.65 27.950000000000003 27.935 20.465 120-124 23.630000000000003 28.52 27.32 20.53 125-129 23.849999999999998 28.405 27.310000000000002 20.435 130-134 23.849999999999998 27.965 27.084999999999997 21.099999999999998 135-139 23.885 28.315 27.345000000000002 20.455000000000002 140-144 24.11 27.955000000000002 27.575 20.36 145-149 24.88 28.34 27.045 19.735 150-151 25.674999999999997 28.199999999999996 26.625 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 2.0 22 1.5 23 0.5 24 0.5 25 0.0 26 1.5 27 4.0 28 7.5 29 8.5 30 7.5 31 10.0 32 18.0 33 21.5 34 27.5 35 54.5 36 77.5 37 105.0 38 145.5 39 171.5 40 196.0 41 237.0 42 275.5 43 288.5 44 296.0 45 296.0 46 273.0 47 250.0 48 219.5 49 187.5 50 173.0 51 148.0 52 112.5 53 91.5 54 76.5 55 55.5 56 37.5 57 31.5 58 23.0 59 18.5 60 13.5 61 4.0 62 5.0 63 4.5 64 5.0 65 4.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.79 30-34 2.3800000000000003 35-39 1.24 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3264691109994977 0.65 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 3.0250000000000004 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra Read 631729 spots for SRR7172639.sra Written 631729 spots for SRR7172639.sra Read 631723 spots for SRR7172639.sra Written 631723 spots for SRR7172639.sra SRR ids: ['SRR7172639.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ord72n2i SRR7172639.sra spots: 12634466 blocks: [[1, 631723], [631724, 1263446], [1263447, 1895169], [1895170, 2526892], [2526893, 3158615], [3158616, 3790338], [3790339, 4422061], [4422062, 5053784], [5053785, 5685507], [5685508, 6317230], [6317231, 6948953], [6948954, 7580676], [7580677, 8212399], [8212400, 8844122], [8844123, 9475845], [9475846, 10107568], [10107569, 10739291], [10739292, 11371014], [11371015, 12002737], [12002738, 12634466]] SRR7172639 file size 4259705 SRR7172639 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172639 SRR7172639_1.fastq SRR7172639_2.fastq Input file: SRR7172639_1.fastq Paired file: SRR7172639_2.fastq trimmed: SRR7172639-trimmed-pair1.fastq, SRR7172639-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:14:12 2025 >> started Mon Feb 10 15:14:27 2025 >> done (14.944s) 12634466 read pairs processed; of these: 9766 ( 0.08%) short read pairs filtered out after trimming by size control 6864 ( 0.05%) empty read pairs filtered out after trimming by size control 12617836 (99.87%) read pairs available; of these: 4805485 (38.08%) trimmed read pairs available after processing 7812351 (61.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 2 0.00% 36 6 0.00% 37 3 0.00% 38 3 0.00% 39 1 0.00% 40 1 0.00% 41 8 0.00% 42 5 0.00% 43 0 0.00% 44 6 0.00% 45 3 0.00% 46 5 0.00% 47 3 0.00% 48 8 0.00% 49 11 0.00% 50 11 0.00% 51 9 0.00% 52 7 0.00% 53 13 0.00% 54 18 0.00% 55 23 0.00% 56 19 0.00% 57 21 0.00% 58 32 0.00% 59 30 0.00% 60 33 0.00% 61 44 0.00% 62 34 0.00% 63 42 0.00% 64 55 0.00% 65 76 0.00% 66 69 0.00% 67 74 0.00% 68 103 0.00% 69 92 0.00% 70 133 0.00% 71 137 0.00% 72 168 0.00% 73 186 0.00% 74 237 0.00% 75 220 0.00% 76 315 0.00% 77 352 0.00% 78 373 0.00% 79 392 0.00% 80 507 0.00% 81 553 0.00% 82 658 0.01% 83 746 0.01% 84 1250 0.01% 85 1768 0.01% 86 1897 0.02% 87 2094 0.02% 88 2228 0.02% 89 2241 0.02% 90 2284 0.02% 91 2503 0.02% 92 2726 0.02% 93 2952 0.02% 94 3173 0.03% 95 3383 0.03% 96 3680 0.03% 97 4037 0.03% 98 4123 0.03% 99 4447 0.04% 100 4962 0.04% 101 5358 0.04% 102 5656 0.04% 103 5980 0.05% 104 6481 0.05% 105 6942 0.06% 106 7422 0.06% 107 8121 0.06% 108 8387 0.07% 109 8979 0.07% 110 9480 0.08% 111 10267 0.08% 112 10897 0.09% 113 11377 0.09% 114 12340 0.10% 115 12959 0.10% 116 13717 0.11% 117 14489 0.11% 118 14954 0.12% 119 15729 0.12% 120 16415 0.13% 121 17387 0.14% 122 18178 0.14% 123 18943 0.15% 124 20123 0.16% 125 21316 0.17% 126 22066 0.17% 127 23220 0.18% 128 24269 0.19% 129 25526 0.20% 130 27162 0.22% 131 27790 0.22% 132 29891 0.24% 133 31242 0.25% 134 33164 0.26% 135 34413 0.27% 136 36826 0.29% 137 38689 0.31% 138 41635 0.33% 139 44726 0.35% 140 47887 0.38% 141 51858 0.41% 142 57445 0.46% 143 63157 0.50% 144 72722 0.58% 145 85720 0.68% 146 104522 0.83% 147 140542 1.11% 148 215466 1.71% 149 433882 3.44% 150 2734156 21.67% 151 7812351 61.92% 12617836 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=20 prefix-density=0.37 prefix-fanout=3.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=39.66 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=21.12 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172639 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:15:13 Started mapping on | Feb 10 15:15:13 Finished on | Feb 10 15:16:49 Mapping speed, Million of reads per hour | 473.17 Number of input reads | 12617836 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11873181 Uniquely mapped reads % | 94.10% Average mapped length | 296.75 Number of splices: Total | 12086457 Number of splices: Annotated (sjdb) | 11890871 Number of splices: GT/AG | 11895383 Number of splices: GC/AG | 153694 Number of splices: AT/AC | 8852 Number of splices: Non-canonical | 28528 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307179 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 25080 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447830 447830 447830 N_multimapping 307179 307179 307179 N_noFeature 271500 11767295 311968 N_ambiguous 124288 887 58314 UnstrandedReadsAssigned:11477393 PositiveStrandReadsAssigned:104999 NegativeStrandReadsAssigned:11502899 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172639 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172639-trimmed-pair1.fastq SRR7172639-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,617,836 reads, 11,404,376 reads pseudoaligned [quant] estimated average fragment length: 245.313 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7172639.ke.tsv 34699 SRR7172639.se.tsv 87100 total ==> SRR7172639.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.69 729 33.2861 Potri.005G024800.1.v4.1 1035 790.687 200 20.4851 Potri.004G059700.1.v4.1 961 716.705 27 3.05096 Potri.007G009000.2.v4.1 1416 1171.69 0 0 Potri.003G141000.2.v4.1 2943 2698.69 433 12.9942 Potri.016G087400.1.v4.1 270 74.3444 1033 1125.29 Potri.015G069301.1.v4.1 564 323.406 0 0 Potri.010G195200.1.v4.1 1773 1528.69 227.842 12.0706 Potri.012G127500.1.v4.1 977 732.699 3412 377.135 ==> SRR7172639.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 458 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 152 SRR7172639 completed mapping pipeline successfully