Starting /dee2/code/volunteer_pipeline.sh SRR7172640 current disk space = 3059123650560 free memory = 1448530884 SRR7172640 SRAfilesize 06c512c7c9fcf501b6c5a13a63683d0d SRR7172640.sra SRR7172640.sra file validated SRR7172640 is paired end SRR7172640 is conventional basespace SRR7172640 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172640_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.04275 32.0 18.0 33.0 18.0 33.0 2 26.46525 29.0 18.0 31.0 18.0 33.0 3 30.5845 32.0 30.0 33.0 27.0 33.0 4 31.61475 33.0 32.0 33.0 27.0 33.0 5 32.3965 33.0 33.0 33.0 32.0 33.0 6 37.07375 38.0 37.0 38.0 36.0 38.0 7 37.5275 38.0 38.0 38.0 37.0 38.0 8 37.61675 38.0 38.0 38.0 38.0 38.0 9 37.68075 38.0 38.0 38.0 38.0 38.0 10-14 37.657349999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.613 38.0 38.0 38.0 38.0 38.0 20-24 37.6249 38.0 38.0 38.0 38.0 38.0 25-29 37.6263 38.0 38.0 38.0 38.0 38.0 30-34 37.5883 38.0 38.0 38.0 38.0 38.0 35-39 37.6085 38.0 38.0 38.0 38.0 38.0 40-44 37.52465 38.0 38.0 38.0 38.0 38.0 45-49 37.4757 38.0 38.0 38.0 38.0 38.0 50-54 37.44155 38.0 38.0 38.0 37.6 38.0 55-59 37.34855 38.0 38.0 38.0 37.0 38.0 60-64 37.29965 38.0 38.0 38.0 37.0 38.0 65-69 37.2161 38.0 38.0 38.0 37.0 38.0 70-74 37.2328 38.0 38.0 38.0 36.8 38.0 75-79 37.1798 38.0 38.0 38.0 36.4 38.0 80-84 37.10045 38.0 38.0 38.0 36.0 38.0 85-89 36.95405 38.0 38.0 38.0 35.8 38.0 90-94 36.9582 38.0 38.0 38.0 36.0 38.0 95-99 37.06224999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.83245 38.0 38.0 38.0 35.4 38.0 105-109 36.66765 38.0 38.0 38.0 34.6 38.0 110-114 36.50445 38.0 38.0 38.0 34.0 38.0 115-119 36.5252 38.0 38.0 38.0 34.0 38.0 120-124 36.4699 38.0 38.0 38.0 34.0 38.0 125-129 36.14385 38.0 37.6 38.0 33.6 38.0 130-134 35.7903 38.0 36.6 38.0 32.2 38.0 135-139 35.39835 38.0 36.0 38.0 30.4 38.0 140-144 35.354299999999995 38.0 36.0 38.0 31.0 38.0 145-149 35.0302 38.0 36.0 38.0 31.0 38.0 150-151 31.970125 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 2.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 2.0 20 0.0 21 4.0 22 5.0 23 2.0 24 4.0 25 6.0 26 8.0 27 13.0 28 18.0 29 26.0 30 30.0 31 34.0 32 60.0 33 81.0 34 124.0 35 236.0 36 632.0 37 2705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.7324516785351 12.156663275686673 12.436419125127161 39.67446592065107 2 17.749244712990937 19.31017119838872 42.522658610271904 20.41792547834844 3 19.55 25.825 26.625 28.000000000000004 4 23.724999999999998 33.275 21.95 21.05 5 21.8 36.199999999999996 23.1 18.9 6 15.725 37.6 25.85 20.825 7 14.124999999999998 21.4 46.150000000000006 18.325 8 18.25 21.675 32.025 28.050000000000004 9 18.375 22.650000000000002 32.5 26.474999999999998 10-14 19.675 29.86 26.505000000000003 23.96 15-19 19.495 28.375 28.515 23.615 20-24 19.715 27.845 28.549999999999997 23.89 25-29 19.88 28.599999999999998 27.560000000000002 23.96 30-34 20.06 27.655 28.27 24.015 35-39 19.855 28.34 27.805000000000003 24.0 40-44 19.845 28.555000000000003 27.96 23.64 45-49 19.8 27.985 28.455000000000002 23.76 50-54 19.99 28.845 27.63 23.535 55-59 19.36 28.455000000000002 27.93 24.255 60-64 19.939999999999998 28.16 28.105000000000004 23.794999999999998 65-69 20.105 28.134999999999998 28.199999999999996 23.56 70-74 20.445 27.889999999999997 27.825 23.84 75-79 20.21 28.335 27.860000000000003 23.595 80-84 20.175 27.77 28.15 23.905 85-89 20.055 28.16 27.605 24.18 90-94 20.5 27.925 27.694999999999997 23.880000000000003 95-99 20.435 27.985 28.025 23.555 100-104 20.599999999999998 27.785 28.08 23.535 105-109 20.205000000000002 28.360000000000003 27.625 23.810000000000002 110-114 20.405 28.050000000000004 27.76 23.785 115-119 20.195 28.46 27.779999999999998 23.565 120-124 20.255000000000003 27.365000000000002 28.235 24.145 125-129 20.665 28.29 27.474999999999998 23.57 130-134 20.785 28.595 27.62 23.0 135-139 20.695 28.625 27.165 23.515 140-144 20.505000000000003 28.23 27.435 23.830000000000002 145-149 20.445 28.475 27.41 23.669999999999998 150-151 20.8 27.650000000000002 26.8375 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.5 23 3.5 24 2.5 25 2.0 26 4.5 27 5.0 28 7.5 29 9.0 30 14.0 31 19.5 32 23.5 33 32.5 34 46.0 35 66.5 36 91.0 37 112.5 38 137.0 39 174.5 40 209.5 41 232.5 42 250.0 43 276.0 44 295.5 45 288.5 46 279.5 47 262.0 48 227.5 49 195.0 50 157.0 51 125.0 52 105.0 53 82.0 54 67.5 55 56.5 56 37.0 57 25.5 58 19.0 59 10.5 60 7.5 61 9.5 62 8.0 63 5.0 64 3.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73385667257534 97.475 2 1.2408204608761713 2.45 3 0.02532286654849329 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5750000000000002 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.7874999999999996 0.0 0.0 0.0 0.0 130-131 3.0875 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.825 0.0 0.0 0.0 0.0 136-137 4.175 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172640 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172640_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18725 34.0 33.0 34.0 33.0 34.0 2 33.2465 34.0 33.0 34.0 33.0 34.0 3 33.22675 34.0 33.0 34.0 33.0 34.0 4 33.249 34.0 33.0 34.0 33.0 34.0 5 33.29475 34.0 33.0 34.0 33.0 34.0 6 37.35575 38.0 38.0 38.0 38.0 38.0 7 37.394 38.0 38.0 38.0 38.0 38.0 8 37.465 38.0 38.0 38.0 38.0 38.0 9 37.38525 38.0 38.0 38.0 38.0 38.0 10-14 37.3521 38.0 38.0 38.0 38.0 38.0 15-19 37.372550000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.3552 38.0 38.0 38.0 38.0 38.0 25-29 37.18495 38.0 38.0 38.0 37.8 38.0 30-34 36.6856 38.0 38.0 38.0 37.0 38.0 35-39 36.9017 38.0 38.0 38.0 37.0 38.0 40-44 37.216300000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.227700000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.19045 38.0 38.0 38.0 37.0 38.0 55-59 37.11985 38.0 38.0 38.0 37.0 38.0 60-64 36.987849999999995 38.0 38.0 38.0 36.4 38.0 65-69 36.98045 38.0 38.0 38.0 36.2 38.0 70-74 36.946200000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.89534999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.927350000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.7924 38.0 38.0 38.0 36.0 38.0 90-94 36.715199999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.6656 38.0 38.0 38.0 35.0 38.0 100-104 36.60445 38.0 38.0 38.0 35.0 38.0 105-109 36.49354999999999 38.0 38.0 38.0 34.6 38.0 110-114 36.327 38.0 38.0 38.0 34.0 38.0 115-119 36.14675000000001 38.0 38.0 38.0 33.8 38.0 120-124 35.9489 38.0 37.8 38.0 33.4 38.0 125-129 35.66525 38.0 37.0 38.0 31.4 38.0 130-134 35.54675 38.0 36.2 38.0 31.0 38.0 135-139 35.2439 38.0 36.0 38.0 30.6 38.0 140-144 34.83995 38.0 36.0 38.0 29.4 38.0 145-149 34.19645 38.0 35.2 38.0 26.2 38.0 150-151 29.6445 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 4.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.0 10 1.0 11 4.0 12 2.0 13 0.0 14 0.0 15 3.0 16 1.0 17 1.0 18 2.0 19 1.0 20 8.0 21 2.0 22 10.0 23 9.0 24 4.0 25 12.0 26 17.0 27 19.0 28 26.0 29 18.0 30 32.0 31 53.0 32 57.0 33 82.0 34 131.0 35 233.0 36 499.0 37 2755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.725 15.225 19.1 32.95 2 23.925 22.625 36.275 17.175 3 20.875 25.55 31.574999999999996 22.0 4 24.125 33.775 22.2 19.900000000000002 5 24.2 36.199999999999996 22.175 17.424999999999997 6 17.65 38.95 23.974999999999998 19.425 7 17.575 16.55 44.425 21.45 8 21.725 21.775 29.4 27.1 9 23.9 22.725 28.15 25.224999999999998 10-14 23.095 28.79 26.435 21.68 15-19 22.305 28.03 28.050000000000004 21.615000000000002 20-24 23.195 28.07 27.860000000000003 20.875 25-29 22.99462554623537 28.354010748907527 27.751268270631375 20.900095434225726 30-34 23.013127098809402 28.52854380787626 27.393914724737968 21.06441436857637 35-39 23.43868138515046 27.914713443217902 27.723171530823127 20.923433640808508 40-44 23.32 28.1 28.075 20.505000000000003 45-49 23.085 28.185 28.02 20.71 50-54 22.84 28.310000000000002 28.025 20.825 55-59 23.345 28.485 27.68 20.49 60-64 23.84 28.910000000000004 27.215 20.035 65-69 23.75 28.37 27.505000000000003 20.375 70-74 23.51 28.294999999999998 27.715 20.48 75-79 23.474999999999998 27.85 28.16 20.515 80-84 23.355 28.410000000000004 27.725 20.51 85-89 23.315 27.83 27.79 21.065 90-94 23.53 28.64 27.76 20.07 95-99 24.05 28.395 27.455000000000002 20.1 100-104 23.815 27.794999999999998 27.93 20.46 105-109 23.635 28.310000000000002 27.43 20.625 110-114 24.03 28.244999999999997 27.315 20.41 115-119 23.925 27.894999999999996 27.905 20.275000000000002 120-124 24.115000000000002 28.560000000000002 27.400000000000002 19.925 125-129 23.97 28.875 27.250000000000004 19.905 130-134 24.75 28.499999999999996 27.105 19.645000000000003 135-139 24.09 28.17 27.384999999999998 20.355 140-144 25.119999999999997 28.175 26.875 19.830000000000002 145-149 24.295 28.499999999999996 27.51 19.695 150-151 25.2625 27.675 26.85 20.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.5 26 3.5 27 3.5 28 6.5 29 7.5 30 7.5 31 13.0 32 16.0 33 23.0 34 35.0 35 59.0 36 96.0 37 115.0 38 131.5 39 175.0 40 221.0 41 235.5 42 272.0 43 284.0 44 278.0 45 294.0 46 287.0 47 255.5 48 220.0 49 209.5 50 178.0 51 136.0 52 113.0 53 93.0 54 64.5 55 44.5 56 36.5 57 27.0 58 17.5 59 9.5 60 6.5 61 3.5 62 0.5 63 4.5 64 4.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.455 30-34 1.73 35-39 0.8049999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70853380602685 97.45 2 1.2914661939731578 2.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9875 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.8375000000000004 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.475 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.237500000000001 0.0 0.0 0.0 0.0 138-139 4.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGACA 10 0.0068519996 144.85 8 ATTTAGG 10 0.0068519996 144.85 6 >>END_MODULE Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra Read 622722 spots for SRR7172640.sra Written 622722 spots for SRR7172640.sra Read 622713 spots for SRR7172640.sra Written 622713 spots for SRR7172640.sra SRR ids: ['SRR7172640.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oxwtidrt SRR7172640.sra spots: 12454269 blocks: [[1, 622713], [622714, 1245426], [1245427, 1868139], [1868140, 2490852], [2490853, 3113565], [3113566, 3736278], [3736279, 4358991], [4358992, 4981704], [4981705, 5604417], [5604418, 6227130], [6227131, 6849843], [6849844, 7472556], [7472557, 8095269], [8095270, 8717982], [8717983, 9340695], [9340696, 9963408], [9963409, 10586121], [10586122, 11208834], [11208835, 11831547], [11831548, 12454269]] SRR7172640 file size 4198642 SRR7172640 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172640 SRR7172640_1.fastq SRR7172640_2.fastq Input file: SRR7172640_1.fastq Paired file: SRR7172640_2.fastq trimmed: SRR7172640-trimmed-pair1.fastq, SRR7172640-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:16:54 2025 >> started Mon Feb 10 15:17:10 2025 >> done (16.021s) 12454269 read pairs processed; of these: 8361 ( 0.07%) short read pairs filtered out after trimming by size control 6683 ( 0.05%) empty read pairs filtered out after trimming by size control 12439225 (99.88%) read pairs available; of these: 5014719 (40.31%) trimmed read pairs available after processing 7424506 (59.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 3 0.00% 37 3 0.00% 38 3 0.00% 39 1 0.00% 40 3 0.00% 41 2 0.00% 42 4 0.00% 43 5 0.00% 44 4 0.00% 45 5 0.00% 46 8 0.00% 47 5 0.00% 48 8 0.00% 49 10 0.00% 50 9 0.00% 51 9 0.00% 52 9 0.00% 53 11 0.00% 54 15 0.00% 55 25 0.00% 56 20 0.00% 57 21 0.00% 58 33 0.00% 59 41 0.00% 60 40 0.00% 61 42 0.00% 62 48 0.00% 63 46 0.00% 64 69 0.00% 65 64 0.00% 66 87 0.00% 67 95 0.00% 68 82 0.00% 69 112 0.00% 70 140 0.00% 71 189 0.00% 72 205 0.00% 73 242 0.00% 74 264 0.00% 75 307 0.00% 76 344 0.00% 77 409 0.00% 78 447 0.00% 79 472 0.00% 80 534 0.00% 81 667 0.01% 82 755 0.01% 83 839 0.01% 84 1433 0.01% 85 1771 0.01% 86 2034 0.02% 87 2245 0.02% 88 2424 0.02% 89 2397 0.02% 90 2562 0.02% 91 2768 0.02% 92 2989 0.02% 93 3259 0.03% 94 3427 0.03% 95 3738 0.03% 96 4055 0.03% 97 4234 0.03% 98 4579 0.04% 99 5051 0.04% 100 5449 0.04% 101 5691 0.05% 102 6066 0.05% 103 6660 0.05% 104 7119 0.06% 105 7731 0.06% 106 8161 0.07% 107 8790 0.07% 108 9232 0.07% 109 9801 0.08% 110 10291 0.08% 111 10801 0.09% 112 11693 0.09% 113 12576 0.10% 114 13433 0.11% 115 14105 0.11% 116 14737 0.12% 117 15151 0.12% 118 16320 0.13% 119 16735 0.13% 120 17660 0.14% 121 18539 0.15% 122 19384 0.16% 123 20307 0.16% 124 20755 0.17% 125 22301 0.18% 126 23112 0.19% 127 24782 0.20% 128 25518 0.21% 129 26715 0.21% 130 27856 0.22% 131 29257 0.24% 132 31082 0.25% 133 32443 0.26% 134 34120 0.27% 135 36135 0.29% 136 38292 0.31% 137 40393 0.32% 138 43185 0.35% 139 45601 0.37% 140 48379 0.39% 141 52781 0.42% 142 58171 0.47% 143 64317 0.52% 144 72809 0.59% 145 85923 0.69% 146 106719 0.86% 147 141015 1.13% 148 213658 1.72% 149 521255 4.19% 150 2805969 22.56% 151 7424506 59.69% 12439225 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=16 prefix-density=0.39 prefix-fanout=2.9 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=9.20 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.3 sequence=TCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=57.33 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.8 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172640 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:17:57 Started mapping on | Feb 10 15:17:57 Finished on | Feb 10 15:19:44 Mapping speed, Million of reads per hour | 418.52 Number of input reads | 12439225 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11599479 Uniquely mapped reads % | 93.25% Average mapped length | 296.38 Number of splices: Total | 11913224 Number of splices: Annotated (sjdb) | 11722985 Number of splices: GT/AG | 11729419 Number of splices: GC/AG | 149198 Number of splices: AT/AC | 8359 Number of splices: Non-canonical | 26248 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296361 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 30730 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551233 551233 551233 N_multimapping 296361 296361 296361 N_noFeature 254171 11501994 292765 N_ambiguous 114029 711 54722 UnstrandedReadsAssigned:11231279 PositiveStrandReadsAssigned:96774 NegativeStrandReadsAssigned:11251992 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172640 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172640-trimmed-pair1.fastq SRR7172640-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,439,225 reads, 11,151,587 reads pseudoaligned [quant] estimated average fragment length: 241.312 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7172640.ke.tsv 34699 SRR7172640.se.tsv 87100 total ==> SRR7172640.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.69 850 42.3015 Potri.005G024800.1.v4.1 1035 794.688 187 20.8179 Potri.004G059700.1.v4.1 961 720.702 26 3.19161 Potri.007G009000.2.v4.1 1416 1175.69 0 0 Potri.003G141000.2.v4.1 2943 2702.69 411 13.4536 Potri.016G087400.1.v4.1 270 75.6181 703.554 823.122 Potri.015G069301.1.v4.1 564 326.796 0 0 Potri.010G195200.1.v4.1 1773 1532.69 327 18.875 Potri.012G127500.1.v4.1 977 736.702 2848 342.011 ==> SRR7172640.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 147 SRR7172640 completed mapping pipeline successfully