Starting /dee2/code/volunteer_pipeline.sh SRR7172641 current disk space = 3059136634880 free memory = 1293227004 SRR7172641 SRAfilesize 9c7f4cfb796c0df92cf4c70061bcc112 SRR7172641.sra SRR7172641.sra file validated SRR7172641 is paired end SRR7172641 is conventional basespace SRR7172641 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.819 25.0 18.0 32.0 18.0 33.0 2 27.59475 29.0 25.0 31.0 18.0 33.0 3 29.7945 31.0 29.0 33.0 25.0 33.0 4 31.55175 33.0 31.0 33.0 29.0 33.0 5 31.6125 33.0 31.0 33.0 29.0 33.0 6 36.6415 38.0 37.0 38.0 34.0 38.0 7 37.367 38.0 38.0 38.0 37.0 38.0 8 37.44175 38.0 38.0 38.0 37.0 38.0 9 37.579 38.0 38.0 38.0 38.0 38.0 10-14 37.566950000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.578500000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.4784 38.0 38.0 38.0 37.8 38.0 25-29 37.5323 38.0 38.0 38.0 38.0 38.0 30-34 37.47430000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.474199999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.42385 38.0 38.0 38.0 37.0 38.0 45-49 37.2702 38.0 38.0 38.0 36.8 38.0 50-54 37.354699999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.212 38.0 38.0 38.0 36.6 38.0 60-64 37.1747 38.0 38.0 38.0 36.6 38.0 65-69 37.175 38.0 38.0 38.0 36.2 38.0 70-74 37.094100000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.9893 38.0 38.0 38.0 36.0 38.0 80-84 36.9436 38.0 38.0 38.0 35.6 38.0 85-89 36.6971 38.0 38.0 38.0 34.8 38.0 90-94 36.74695 38.0 38.0 38.0 34.6 38.0 95-99 36.69655 38.0 38.0 38.0 34.8 38.0 100-104 36.68305 38.0 38.0 38.0 34.8 38.0 105-109 36.29765 38.0 37.6 38.0 33.4 38.0 110-114 36.22185 38.0 37.6 38.0 33.6 38.0 115-119 36.1831 38.0 37.4 38.0 33.6 38.0 120-124 36.10755 38.0 37.2 38.0 33.2 38.0 125-129 35.732749999999996 38.0 36.4 38.0 31.8 38.0 130-134 35.208450000000006 38.0 35.6 38.0 28.6 38.0 135-139 34.924099999999996 38.0 35.2 38.0 27.8 38.0 140-144 34.818599999999996 38.0 35.0 38.0 27.6 38.0 145-149 34.395450000000004 38.0 34.6 38.0 27.4 38.0 150-151 30.734125 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 4.0 22 5.0 23 5.0 24 3.0 25 14.0 26 15.0 27 17.0 28 24.0 29 25.0 30 42.0 31 58.0 32 70.0 33 110.0 34 179.0 35 306.0 36 780.0 37 2337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.50717213114754 16.3422131147541 11.244877049180328 41.90573770491803 2 18.677727501256914 21.2166918049271 38.05932629462041 22.046254399195576 3 19.650000000000002 25.5 26.35 28.499999999999996 4 23.325000000000003 34.175 21.2 21.3 5 22.625 34.9 23.425 19.05 6 16.3 36.975 26.85 19.875 7 14.174999999999999 20.925 46.675 18.224999999999998 8 18.825 21.425 31.05 28.7 9 18.825 23.275000000000002 31.2 26.700000000000003 10-14 19.885 30.070000000000004 26.515 23.53 15-19 20.02 28.32 28.13 23.53 20-24 19.02 29.459999999999997 28.410000000000004 23.11 25-29 20.1 28.58 28.325 22.994999999999997 30-34 19.82 29.03 27.615000000000002 23.535 35-39 19.585 28.49 27.865000000000002 24.060000000000002 40-44 19.67 29.054999999999996 27.725 23.549999999999997 45-49 19.634999999999998 28.375 28.299999999999997 23.69 50-54 19.994999999999997 28.025 28.360000000000003 23.62 55-59 19.7 29.080000000000002 27.33 23.89 60-64 19.865 28.33 28.155 23.65 65-69 19.89 28.64 27.650000000000002 23.82 70-74 20.01 28.24 28.18 23.57 75-79 19.79 28.18 28.439999999999998 23.59 80-84 20.385 28.455000000000002 27.74 23.419999999999998 85-89 19.575 28.29 28.275 23.86 90-94 19.665 28.42 27.96 23.955000000000002 95-99 19.64 28.875 27.365000000000002 24.12 100-104 19.64 29.075 27.915 23.369999999999997 105-109 19.59 28.904999999999998 27.38 24.125 110-114 19.965 28.26 28.23 23.544999999999998 115-119 20.885 28.21 27.88 23.025000000000002 120-124 19.689999999999998 28.87 27.694999999999997 23.745 125-129 20.815 28.675 27.694999999999997 22.814999999999998 130-134 20.72 28.1 27.41 23.77 135-139 20.48 28.43 27.450000000000003 23.64 140-144 20.64 28.405 26.935 24.02 145-149 20.805 28.439999999999998 27.339999999999996 23.415 150-151 20.474999999999998 28.037499999999998 27.900000000000002 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.5 24 2.5 25 4.0 26 5.5 27 9.0 28 8.5 29 9.5 30 15.0 31 18.5 32 25.0 33 39.5 34 53.5 35 76.5 36 105.5 37 125.5 38 159.0 39 183.0 40 204.5 41 232.0 42 267.0 43 280.5 44 281.5 45 305.0 46 280.5 47 230.0 48 211.0 49 187.5 50 147.0 51 128.5 52 109.5 53 78.5 54 48.5 55 35.5 56 32.0 57 25.5 58 19.5 59 10.0 60 10.0 61 11.5 62 6.5 63 3.5 64 3.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGAT 10 0.006832588 144.9875 4 ACATCTC 10 0.006832588 144.9875 4 AATAATG 10 0.006832588 144.9875 9 >>END_MODULE SRR7172641 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.055 34.0 33.0 34.0 32.0 34.0 2 33.066 34.0 33.0 34.0 32.0 34.0 3 33.13425 34.0 33.0 34.0 33.0 34.0 4 33.052 34.0 33.0 34.0 32.0 34.0 5 33.05325 34.0 33.0 34.0 32.0 34.0 6 37.2475 38.0 38.0 38.0 37.0 38.0 7 37.23925 38.0 38.0 38.0 37.0 38.0 8 37.2265 38.0 38.0 38.0 37.0 38.0 9 37.2515 38.0 38.0 38.0 37.0 38.0 10-14 37.15545 38.0 38.0 38.0 37.0 38.0 15-19 37.193000000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.2063 38.0 38.0 38.0 37.0 38.0 25-29 36.99705 38.0 38.0 38.0 36.8 38.0 30-34 36.3822 38.0 38.0 38.0 35.8 38.0 35-39 36.6463 38.0 38.0 38.0 36.0 38.0 40-44 37.05515 38.0 38.0 38.0 36.8 38.0 45-49 37.0022 38.0 38.0 38.0 36.6 38.0 50-54 37.0234 38.0 38.0 38.0 36.4 38.0 55-59 36.88495 38.0 38.0 38.0 36.0 38.0 60-64 36.69945 38.0 38.0 38.0 35.4 38.0 65-69 36.469049999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.6447 38.0 38.0 38.0 34.8 38.0 75-79 36.56325 38.0 38.0 38.0 34.8 38.0 80-84 36.56145 38.0 38.0 38.0 34.6 38.0 85-89 36.44625 38.0 38.0 38.0 34.2 38.0 90-94 36.25 38.0 38.0 38.0 33.8 38.0 95-99 36.16645 38.0 38.0 38.0 33.6 38.0 100-104 36.01665 38.0 37.4 38.0 33.2 38.0 105-109 35.779849999999996 38.0 37.0 38.0 31.2 38.0 110-114 35.53035 38.0 37.0 38.0 30.2 38.0 115-119 35.21345 38.0 36.2 38.0 28.2 38.0 120-124 34.9545 38.0 36.0 38.0 27.6 38.0 125-129 34.72805 38.0 35.2 38.0 27.0 38.0 130-134 34.3189 38.0 34.0 38.0 25.2 38.0 135-139 33.511750000000006 38.0 33.0 38.0 20.6 38.0 140-144 32.615750000000006 38.0 33.0 38.0 13.8 38.0 145-149 31.30325 38.0 31.4 38.0 8.0 38.0 150-151 26.242874999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 3.0 6 2.0 7 2.0 8 1.0 9 2.0 10 2.0 11 1.0 12 0.0 13 0.0 14 3.0 15 2.0 16 0.0 17 2.0 18 5.0 19 11.0 20 2.0 21 7.0 22 11.0 23 18.0 24 20.0 25 18.0 26 20.0 27 27.0 28 33.0 29 38.0 30 62.0 31 84.0 32 90.0 33 129.0 34 214.0 35 334.0 36 733.0 37 2114.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 15.299999999999999 17.75 32.675 2 24.6 23.1 36.225 16.075 3 20.325 26.25 31.474999999999998 21.95 4 23.9 33.85 23.849999999999998 18.4 5 24.775 35.85 22.8 16.575 6 17.275 37.675 24.825 20.225 7 17.525 16.5 44.15 21.825 8 20.225 22.85 28.95 27.975 9 21.975 24.875 28.599999999999998 24.55 10-14 22.73 28.685 27.16 21.425 15-19 22.68 28.349999999999998 28.09 20.880000000000003 20-24 22.82 28.465 27.96 20.755000000000003 25-29 22.63496531617573 28.506082235850005 28.60158841861868 20.257364029355585 30-34 22.587887137098832 27.90958722383795 28.02694015000765 21.475585489055565 35-39 22.967448902346707 28.099924299772898 28.301791572041385 20.63083522583901 40-44 23.43 28.055000000000003 28.005000000000003 20.51 45-49 23.25 28.15 28.105000000000004 20.495 50-54 23.095 28.335 28.115000000000002 20.455000000000002 55-59 23.3 28.125 28.22 20.355 60-64 23.150000000000002 28.144999999999996 28.595 20.11 65-69 23.665 28.275 27.73 20.330000000000002 70-74 23.14 28.175 28.249999999999996 20.435 75-79 23.28 28.444999999999997 28.16 20.115 80-84 23.69 28.32 27.77 20.22 85-89 23.69 28.815 27.639999999999997 19.855 90-94 23.305 28.78 27.925 19.99 95-99 23.77 28.075 28.21 19.945 100-104 23.755000000000003 28.53 27.785 19.93 105-109 23.455000000000002 27.805000000000003 28.515 20.225 110-114 23.615 28.499999999999996 27.950000000000003 19.935 115-119 23.78 27.634999999999998 28.410000000000004 20.175 120-124 24.13 27.46 28.34 20.07 125-129 24.044999999999998 27.575 28.405 19.975 130-134 24.525 28.02 27.325 20.13 135-139 24.285 27.325 28.410000000000004 19.98 140-144 24.775 28.01 27.794999999999998 19.42 145-149 24.585 28.18 27.1 20.135 150-151 25.124999999999996 27.962500000000002 27.250000000000004 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.0 25 4.0 26 5.0 27 5.0 28 4.5 29 6.5 30 12.5 31 15.5 32 22.0 33 35.5 34 51.5 35 75.0 36 86.5 37 114.0 38 158.5 39 189.0 40 212.5 41 238.0 42 272.0 43 295.0 44 291.5 45 290.0 46 278.5 47 259.0 48 230.0 49 177.5 50 159.0 51 134.5 52 97.0 53 76.5 54 56.5 55 40.0 56 27.0 57 17.0 58 14.0 59 12.0 60 8.5 61 7.0 62 4.0 63 2.0 64 2.0 65 2.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.53 30-34 2.005 35-39 0.9249999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.7875 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.8499999999999996 0.0 0.0 0.0 0.0 136-137 4.175 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATAC 10 0.0068484643 144.875 145 AATTCAG 10 0.0068484643 144.875 9 CAATTCA 10 0.0068484643 144.875 8 >>END_MODULE Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra Read 735260 spots for SRR7172641.sra Written 735260 spots for SRR7172641.sra Read 735253 spots for SRR7172641.sra Written 735253 spots for SRR7172641.sra SRR ids: ['SRR7172641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rygg7gv_ SRR7172641.sra spots: 14705067 blocks: [[1, 735253], [735254, 1470506], [1470507, 2205759], [2205760, 2941012], [2941013, 3676265], [3676266, 4411518], [4411519, 5146771], [5146772, 5882024], [5882025, 6617277], [6617278, 7352530], [7352531, 8087783], [8087784, 8823036], [8823037, 9558289], [9558290, 10293542], [10293543, 11028795], [11028796, 11764048], [11764049, 12499301], [12499302, 13234554], [13234555, 13969807], [13969808, 14705067]] SRR7172641 file size 4961364 SRR7172641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172641 SRR7172641_1.fastq SRR7172641_2.fastq Input file: SRR7172641_1.fastq Paired file: SRR7172641_2.fastq trimmed: SRR7172641-trimmed-pair1.fastq, SRR7172641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:17:17 2025 >> started Mon Feb 10 15:17:33 2025 >> done (15.798s) 14705067 read pairs processed; of these: 10596 ( 0.07%) short read pairs filtered out after trimming by size control 8970 ( 0.06%) empty read pairs filtered out after trimming by size control 14685501 (99.87%) read pairs available; of these: 6855715 (46.68%) trimmed read pairs available after processing 7829786 (53.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 3 0.00% 27 1 0.00% 28 5 0.00% 29 6 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 2 0.00% 34 0 0.00% 35 3 0.00% 36 3 0.00% 37 8 0.00% 38 3 0.00% 39 6 0.00% 40 2 0.00% 41 6 0.00% 42 9 0.00% 43 10 0.00% 44 8 0.00% 45 10 0.00% 46 11 0.00% 47 7 0.00% 48 8 0.00% 49 13 0.00% 50 13 0.00% 51 11 0.00% 52 14 0.00% 53 17 0.00% 54 17 0.00% 55 23 0.00% 56 21 0.00% 57 24 0.00% 58 22 0.00% 59 32 0.00% 60 50 0.00% 61 58 0.00% 62 47 0.00% 63 65 0.00% 64 73 0.00% 65 81 0.00% 66 97 0.00% 67 125 0.00% 68 95 0.00% 69 143 0.00% 70 154 0.00% 71 182 0.00% 72 202 0.00% 73 261 0.00% 74 262 0.00% 75 295 0.00% 76 424 0.00% 77 440 0.00% 78 454 0.00% 79 480 0.00% 80 549 0.00% 81 629 0.00% 82 813 0.01% 83 899 0.01% 84 1518 0.01% 85 1882 0.01% 86 2030 0.01% 87 2281 0.02% 88 2389 0.02% 89 2556 0.02% 90 2720 0.02% 91 2822 0.02% 92 3120 0.02% 93 3439 0.02% 94 3794 0.03% 95 3944 0.03% 96 4221 0.03% 97 4681 0.03% 98 4855 0.03% 99 5295 0.04% 100 5745 0.04% 101 5920 0.04% 102 6621 0.05% 103 7370 0.05% 104 7905 0.05% 105 8346 0.06% 106 9163 0.06% 107 9533 0.06% 108 10245 0.07% 109 10706 0.07% 110 11392 0.08% 111 12369 0.08% 112 13120 0.09% 113 13906 0.09% 114 14974 0.10% 115 15664 0.11% 116 16440 0.11% 117 17394 0.12% 118 18229 0.12% 119 19317 0.13% 120 20213 0.14% 121 21262 0.14% 122 22267 0.15% 123 23998 0.16% 124 25684 0.17% 125 27038 0.18% 126 28537 0.19% 127 29997 0.20% 128 31165 0.21% 129 32732 0.22% 130 34703 0.24% 131 36713 0.25% 132 39237 0.27% 133 41826 0.28% 134 44918 0.31% 135 48299 0.33% 136 51462 0.35% 137 55494 0.38% 138 59577 0.41% 139 64761 0.44% 140 71083 0.48% 141 79242 0.54% 142 88743 0.60% 143 101020 0.69% 144 119086 0.81% 145 142107 0.97% 146 177790 1.21% 147 242805 1.65% 148 370574 2.52% 149 731260 4.98% 150 3699002 25.19% 151 7829786 53.32% 14685501 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=140.70 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.8 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=23 prefix-density=0.26 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=38.91 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=AGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACA SRR7172641 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:18:51 Started mapping on | Feb 10 15:18:51 Finished on | Feb 10 15:20:40 Mapping speed, Million of reads per hour | 485.03 Number of input reads | 14685501 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13875664 Uniquely mapped reads % | 94.49% Average mapped length | 296.09 Number of splices: Total | 13933099 Number of splices: Annotated (sjdb) | 13699603 Number of splices: GT/AG | 13715492 Number of splices: GC/AG | 176550 Number of splices: AT/AC | 9777 Number of splices: Non-canonical | 31280 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338329 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 30157 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481526 481526 481526 N_multimapping 338329 338329 338329 N_noFeature 355324 13764854 399861 N_ambiguous 136812 922 69895 UnstrandedReadsAssigned:13383528 PositiveStrandReadsAssigned:109888 NegativeStrandReadsAssigned:13405908 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172641-trimmed-pair1.fastq SRR7172641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,685,501 reads, 13,302,201 reads pseudoaligned [quant] estimated average fragment length: 244.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7172641.ke.tsv 34699 SRR7172641.se.tsv 87100 total ==> SRR7172641.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.26 1120 49.9248 Potri.005G024800.1.v4.1 1035 791.255 170 16.9921 Potri.004G059700.1.v4.1 961 717.266 21 2.31555 Potri.007G009000.2.v4.1 1416 1172.26 0 0 Potri.003G141000.2.v4.1 2943 2699.26 531.159 15.5631 Potri.016G087400.1.v4.1 270 74.3205 830 883.251 Potri.015G069301.1.v4.1 564 323.524 0 0 Potri.010G195200.1.v4.1 1773 1529.26 410 21.204 Potri.012G127500.1.v4.1 977 733.261 3711 400.265 ==> SRR7172641.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 135 SRR7172641 completed mapping pipeline successfully