Starting /dee2/code/volunteer_pipeline.sh SRR7172642 current disk space = 3059021279232 free memory = 1434280064 SRR7172642 SRAfilesize 8bc766fd7a7aa4be47d0b43788a310f5 SRR7172642.sra SRR7172642.sra file validated SRR7172642 is paired end SRR7172642 is conventional basespace SRR7172642 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.683 33.0 32.0 33.0 30.0 34.0 2 31.213 33.0 31.0 33.0 28.0 34.0 3 32.4035 33.0 33.0 33.0 31.0 34.0 4 32.6845 33.0 33.0 34.0 32.0 34.0 5 32.87175 33.0 33.0 34.0 32.0 34.0 6 37.00275 38.0 37.0 38.0 35.0 38.0 7 37.49775 38.0 38.0 38.0 37.0 38.0 8 37.554 38.0 38.0 38.0 38.0 38.0 9 37.5855 38.0 38.0 38.0 38.0 38.0 10-14 37.592099999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5629 38.0 38.0 38.0 38.0 38.0 20-24 37.5606 38.0 38.0 38.0 38.0 38.0 25-29 37.53830000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.513999999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.47265 38.0 38.0 38.0 38.0 38.0 40-44 37.4544 38.0 38.0 38.0 37.4 38.0 45-49 37.35675 38.0 38.0 38.0 37.0 38.0 50-54 37.409800000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.29965 38.0 38.0 38.0 37.0 38.0 60-64 37.227000000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.222249999999995 38.0 38.0 38.0 36.4 38.0 70-74 37.1665 38.0 38.0 38.0 36.2 38.0 75-79 37.05159999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.00455000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.772149999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.75005 38.0 38.0 38.0 35.0 38.0 95-99 36.83665 38.0 38.0 38.0 35.2 38.0 100-104 36.68805 38.0 38.0 38.0 34.4 38.0 105-109 36.439550000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.25015 38.0 37.8 38.0 34.0 38.0 115-119 36.222699999999996 38.0 37.6 38.0 33.6 38.0 120-124 36.07865 38.0 37.4 38.0 33.0 38.0 125-129 35.80714999999999 38.0 36.8 38.0 32.2 38.0 130-134 35.16375 38.0 36.0 38.0 28.4 38.0 135-139 35.0601 38.0 35.8 38.0 28.0 38.0 140-144 34.8781 38.0 35.4 38.0 28.0 38.0 145-149 34.50735 38.0 34.8 38.0 27.4 38.0 150-151 30.555124999999997 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 5.0 22 3.0 23 5.0 24 11.0 25 10.0 26 13.0 27 18.0 28 25.0 29 31.0 30 37.0 31 47.0 32 73.0 33 92.0 34 148.0 35 245.0 36 625.0 37 2606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.84611477907567 14.220416455053325 11.985779583544947 36.94768918232605 2 20.211161387631975 19.10507792860734 36.777275012569135 23.906485671191554 3 20.325 24.675 26.674999999999997 28.325 4 23.45 31.75 23.400000000000002 21.4 5 21.525 34.975 24.725 18.775 6 17.575 34.525 26.775 21.125 7 13.05 22.55 44.525 19.875 8 18.425 21.6 30.725 29.25 9 18.375 22.1 32.975 26.55 10-14 19.905 28.605000000000004 27.175 24.315 15-19 20.135 28.025 28.28 23.56 20-24 20.275000000000002 27.465 28.77 23.49 25-29 20.005 27.245 28.515 24.235 30-34 20.385 28.32 27.939999999999998 23.355 35-39 19.950000000000003 28.299999999999997 27.800000000000004 23.95 40-44 20.655 27.865000000000002 27.810000000000002 23.669999999999998 45-49 19.985 28.000000000000004 27.83 24.185000000000002 50-54 20.235 27.800000000000004 27.605 24.36 55-59 20.36 27.860000000000003 28.485 23.294999999999998 60-64 20.34 27.855 28.000000000000004 23.805 65-69 20.415 28.299999999999997 27.42 23.865 70-74 20.43 27.63 28.365000000000002 23.575 75-79 20.474999999999998 27.46 28.325 23.74 80-84 20.175 27.605 28.165000000000003 24.055 85-89 20.485 28.17 27.27 24.075 90-94 20.32 27.905 28.389999999999997 23.385 95-99 20.19 27.894999999999996 28.025 23.89 100-104 20.544999999999998 27.68 28.28 23.494999999999997 105-109 20.865000000000002 28.28 27.93 22.925 110-114 21.05 27.955000000000002 27.96 23.035 115-119 20.495 28.03 27.975 23.5 120-124 21.395 27.400000000000002 27.46 23.745 125-129 20.835 27.650000000000002 27.950000000000003 23.565 130-134 20.845 27.634999999999998 27.500000000000004 24.02 135-139 21.23 27.85 27.185 23.735 140-144 21.145 27.534999999999997 27.395000000000003 23.925 145-149 21.055 28.46 26.525 23.96 150-151 20.9375 28.15 26.7125 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 2.5 26 3.5 27 5.0 28 9.0 29 10.5 30 12.5 31 17.5 32 28.0 33 35.5 34 46.0 35 67.5 36 85.0 37 97.5 38 124.0 39 168.0 40 207.0 41 228.0 42 260.5 43 271.5 44 264.5 45 269.0 46 278.0 47 268.5 48 236.0 49 202.5 50 159.0 51 134.5 52 116.0 53 99.5 54 73.5 55 48.0 56 38.0 57 29.0 58 23.0 59 17.0 60 13.0 61 10.0 62 11.0 63 9.0 64 3.5 65 2.5 66 2.0 67 0.5 68 1.5 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7999999999999998 0.0 0.0 0.0 0.0 120-121 2.15 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.0999999999999996 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAGT 30 0.0017979635 72.49375 145 TTTTTTT 35 0.0033135517 62.1375 2 >>END_MODULE SRR7172642 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0965 34.0 33.0 34.0 32.0 34.0 2 33.159 34.0 33.0 34.0 33.0 34.0 3 33.1235 34.0 33.0 34.0 33.0 34.0 4 33.10075 34.0 33.0 34.0 33.0 34.0 5 33.11425 34.0 33.0 34.0 33.0 34.0 6 37.21725 38.0 38.0 38.0 37.0 38.0 7 37.23075 38.0 38.0 38.0 37.0 38.0 8 37.132 38.0 38.0 38.0 37.0 38.0 9 37.21175 38.0 38.0 38.0 37.0 38.0 10-14 37.155199999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.17955 38.0 38.0 38.0 37.2 38.0 20-24 37.18185 38.0 38.0 38.0 37.4 38.0 25-29 36.88525 38.0 38.0 38.0 37.0 38.0 30-34 36.2111 38.0 38.0 38.0 36.0 38.0 35-39 36.4897 38.0 38.0 38.0 35.6 38.0 40-44 36.9627 38.0 38.0 38.0 36.8 38.0 45-49 36.992900000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.023799999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.8423 38.0 38.0 38.0 36.2 38.0 60-64 36.63705 38.0 38.0 38.0 35.2 38.0 65-69 36.551550000000006 38.0 38.0 38.0 34.8 38.0 70-74 36.592650000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.58355 38.0 38.0 38.0 35.2 38.0 80-84 36.45805 38.0 38.0 38.0 34.4 38.0 85-89 36.41825 38.0 38.0 38.0 34.4 38.0 90-94 36.270799999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.2312 38.0 38.0 38.0 34.0 38.0 100-104 36.09785 38.0 38.0 38.0 33.8 38.0 105-109 36.00445 38.0 38.0 38.0 33.4 38.0 110-114 35.851749999999996 38.0 37.6 38.0 33.0 38.0 115-119 35.62499999999999 38.0 37.0 38.0 31.2 38.0 120-124 35.29565 38.0 36.2 38.0 29.8 38.0 125-129 35.15185 38.0 36.0 38.0 28.8 38.0 130-134 34.930150000000005 38.0 35.8 38.0 28.4 38.0 135-139 34.36995 38.0 35.0 38.0 25.0 38.0 140-144 33.9034 38.0 33.0 38.0 23.8 38.0 145-149 32.80825 38.0 33.0 38.0 16.2 38.0 150-151 27.58925 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 3.0 5 4.0 6 2.0 7 1.0 8 0.0 9 2.0 10 2.0 11 7.0 12 2.0 13 3.0 14 1.0 15 2.0 16 3.0 17 4.0 18 2.0 19 9.0 20 7.0 21 5.0 22 5.0 23 4.0 24 15.0 25 15.0 26 15.0 27 22.0 28 23.0 29 28.0 30 46.0 31 61.0 32 77.0 33 130.0 34 190.0 35 270.0 36 596.0 37 2427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 17.125 17.2 27.625 2 23.599999999999998 24.875 33.875 17.65 3 21.275 27.375 30.349999999999998 21.0 4 25.15 35.099999999999994 20.474999999999998 19.275000000000002 5 24.45 36.65 21.3 17.599999999999998 6 18.475 37.974999999999994 24.575 18.975 7 18.725 17.7 41.8 21.775 8 20.9 22.85 27.775 28.475 9 23.075000000000003 23.65 28.749999999999996 24.525 10-14 23.330000000000002 28.58 26.174999999999997 21.915000000000003 15-19 22.08 28.025 28.175 21.72 20-24 23.14 28.365000000000002 27.065 21.43 25-29 23.378779493887407 28.837349700659054 26.734416662474214 21.049454142979325 30-34 22.758232191324833 28.50924361140984 27.66425974292006 21.068264454345265 35-39 22.550457787444987 28.554808032778595 27.882037533512065 21.012696646264352 40-44 22.725 28.315 28.144999999999996 20.815 45-49 23.599999999999998 28.065 27.279999999999998 21.055 50-54 23.03 28.305000000000003 27.485 21.18 55-59 23.465 28.275 27.155 21.105 60-64 23.169999999999998 28.21 27.765 20.855 65-69 23.44 27.43 28.07 21.060000000000002 70-74 23.41 27.92 27.965 20.705000000000002 75-79 23.544999999999998 27.67 27.700000000000003 21.085 80-84 23.549999999999997 27.83 27.779999999999998 20.84 85-89 23.605 28.675 26.974999999999998 20.745 90-94 23.775 28.23 27.224999999999998 20.77 95-99 23.465 27.355 28.110000000000003 21.07 100-104 23.69 27.889999999999997 27.325 21.095 105-109 24.015 28.139999999999997 27.02 20.825 110-114 24.19 27.955000000000002 27.43 20.424999999999997 115-119 24.01 28.095 27.105 20.79 120-124 24.505 27.694999999999997 27.275 20.525 125-129 24.005000000000003 28.9 26.805 20.29 130-134 24.635 28.565 26.674999999999997 20.125 135-139 24.845 27.794999999999998 27.034999999999997 20.325 140-144 24.575 28.115000000000002 27.400000000000002 19.91 145-149 24.625 28.815 26.86 19.7 150-151 25.0 28.3375 26.950000000000003 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 1.5 24 1.0 25 2.0 26 2.0 27 2.5 28 4.0 29 4.5 30 12.0 31 17.0 32 21.0 33 32.5 34 45.0 35 59.5 36 73.0 37 92.5 38 131.5 39 169.0 40 203.0 41 246.0 42 275.5 43 276.0 44 267.0 45 276.0 46 277.5 47 254.0 48 233.5 49 211.5 50 186.0 51 152.0 52 103.0 53 77.5 54 68.0 55 49.5 56 37.5 57 29.0 58 21.5 59 19.5 60 16.5 61 14.5 62 8.5 63 1.5 64 3.0 65 3.0 66 1.5 67 1.5 68 2.0 69 2.0 70 2.0 71 2.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.615 30-34 2.365 35-39 1.155 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.1624999999999996 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGATA 10 0.006875036 144.6875 2 AAAGAGT 30 0.0018128043 72.34375 145 GTAGGGA 20 0.0059980154 28.937498 135-139 >>END_MODULE Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708499 spots for SRR7172642.sra Written 708499 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra Read 708481 spots for SRR7172642.sra Written 708481 spots for SRR7172642.sra SRR ids: ['SRR7172642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3dm42pv0 SRR7172642.sra spots: 14169638 blocks: [[1, 708481], [708482, 1416962], [1416963, 2125443], [2125444, 2833924], [2833925, 3542405], [3542406, 4250886], [4250887, 4959367], [4959368, 5667848], [5667849, 6376329], [6376330, 7084810], [7084811, 7793291], [7793292, 8501772], [8501773, 9210253], [9210254, 9918734], [9918735, 10627215], [10627216, 11335696], [11335697, 12044177], [12044178, 12752658], [12752659, 13461139], [13461140, 14169638]] SRR7172642 file size 4779925 SRR7172642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172642 SRR7172642_1.fastq SRR7172642_2.fastq Input file: SRR7172642_1.fastq Paired file: SRR7172642_2.fastq trimmed: SRR7172642-trimmed-pair1.fastq, SRR7172642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:37:01 2025 >> started Mon Feb 10 15:37:17 2025 >> done (15.639s) 14169638 read pairs processed; of these: 22433 ( 0.16%) short read pairs filtered out after trimming by size control 15601 ( 0.11%) empty read pairs filtered out after trimming by size control 14131604 (99.73%) read pairs available; of these: 7452337 (52.74%) trimmed read pairs available after processing 6679267 (47.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 4 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 5 0.00% 39 7 0.00% 40 9 0.00% 41 4 0.00% 42 9 0.00% 43 4 0.00% 44 8 0.00% 45 5 0.00% 46 17 0.00% 47 10 0.00% 48 12 0.00% 49 16 0.00% 50 19 0.00% 51 16 0.00% 52 29 0.00% 53 16 0.00% 54 25 0.00% 55 31 0.00% 56 38 0.00% 57 38 0.00% 58 40 0.00% 59 56 0.00% 60 59 0.00% 61 68 0.00% 62 77 0.00% 63 71 0.00% 64 97 0.00% 65 96 0.00% 66 127 0.00% 67 161 0.00% 68 169 0.00% 69 177 0.00% 70 194 0.00% 71 285 0.00% 72 294 0.00% 73 370 0.00% 74 405 0.00% 75 451 0.00% 76 598 0.00% 77 690 0.00% 78 711 0.01% 79 764 0.01% 80 878 0.01% 81 1036 0.01% 82 1199 0.01% 83 1508 0.01% 84 2624 0.02% 85 3188 0.02% 86 3502 0.02% 87 3763 0.03% 88 3811 0.03% 89 3963 0.03% 90 4309 0.03% 91 4550 0.03% 92 4769 0.03% 93 5133 0.04% 94 5666 0.04% 95 6097 0.04% 96 6430 0.05% 97 6997 0.05% 98 7528 0.05% 99 7824 0.06% 100 8510 0.06% 101 9102 0.06% 102 10029 0.07% 103 10701 0.08% 104 11444 0.08% 105 12135 0.09% 106 13050 0.09% 107 13534 0.10% 108 14324 0.10% 109 15334 0.11% 110 16044 0.11% 111 17014 0.12% 112 18056 0.13% 113 19632 0.14% 114 20466 0.14% 115 21830 0.15% 116 22941 0.16% 117 23701 0.17% 118 24976 0.18% 119 26063 0.18% 120 27221 0.19% 121 28293 0.20% 122 29382 0.21% 123 31251 0.22% 124 32574 0.23% 125 33750 0.24% 126 35583 0.25% 127 37012 0.26% 128 38506 0.27% 129 39964 0.28% 130 41456 0.29% 131 43192 0.31% 132 45506 0.32% 133 47939 0.34% 134 50823 0.36% 135 52458 0.37% 136 55245 0.39% 137 58501 0.41% 138 62095 0.44% 139 65240 0.46% 140 70150 0.50% 141 75987 0.54% 142 82993 0.59% 143 92119 0.65% 144 104578 0.74% 145 122543 0.87% 146 149207 1.06% 147 199670 1.41% 148 308811 2.19% 149 766488 5.42% 150 4203802 29.75% 151 6679267 47.26% 14131604 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=15 prefix-density=0.79 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=60.33 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.3 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=6.72 fanout-score-rank=20 prefix-density=0.90 prefix-fanout=2.3 sequence=TGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=399.88 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=31.3 sequence=AAGAAGAAGAAA SRR7172642 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:38:09 Started mapping on | Feb 10 15:38:09 Finished on | Feb 10 15:40:28 Mapping speed, Million of reads per hour | 366.00 Number of input reads | 14131604 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12881628 Uniquely mapped reads % | 91.15% Average mapped length | 294.60 Number of splices: Total | 12738721 Number of splices: Annotated (sjdb) | 12481309 Number of splices: GT/AG | 12525963 Number of splices: GC/AG | 167506 Number of splices: AT/AC | 10405 Number of splices: Non-canonical | 34847 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333279 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 48052 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 936713 936713 936713 N_multimapping 333279 333279 333279 N_noFeature 325102 12770226 367737 N_ambiguous 136382 1000 66859 UnstrandedReadsAssigned:12420144 PositiveStrandReadsAssigned:110402 NegativeStrandReadsAssigned:12447032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172642-trimmed-pair1.fastq SRR7172642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,131,604 reads, 12,416,922 reads pseudoaligned [quant] estimated average fragment length: 235.48 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7172642.ke.tsv 34699 SRR7172642.se.tsv 87100 total ==> SRR7172642.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.52 954 43.2317 Potri.005G024800.1.v4.1 1035 800.52 191 19.2838 Potri.004G059700.1.v4.1 961 726.541 15 1.66864 Potri.007G009000.2.v4.1 1416 1181.52 5 0.342028 Potri.003G141000.2.v4.1 2943 2708.52 445 13.2788 Potri.016G087400.1.v4.1 270 80.7834 844.698 845.107 Potri.015G069301.1.v4.1 564 333.048 0 0 Potri.010G195200.1.v4.1 1773 1538.52 642 33.7259 Potri.012G127500.1.v4.1 977 742.525 8993 978.871 ==> SRR7172642.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 575 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 303 SRR7172642 completed mapping pipeline successfully