Starting /dee2/code/volunteer_pipeline.sh SRR7172643 current disk space = 3058466619392 free memory = 1579923864 SRR7172643 SRAfilesize 89ba7df0b3528a6c881e61d5a5fffca9 SRR7172643.sra SRR7172643.sra file validated SRR7172643 is paired end SRR7172643 is conventional basespace SRR7172643 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.8135 25.0 18.0 32.0 18.0 33.0 2 27.5295 29.0 27.0 31.0 18.0 33.0 3 29.18875 31.0 28.0 33.0 18.0 33.0 4 31.30975 33.0 31.0 33.0 29.0 33.0 5 32.0065 33.0 32.0 33.0 31.0 33.0 6 36.865 38.0 37.0 38.0 35.0 38.0 7 37.3355 38.0 38.0 38.0 37.0 38.0 8 37.55225 38.0 38.0 38.0 37.0 38.0 9 37.613 38.0 38.0 38.0 38.0 38.0 10-14 37.619600000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5966 38.0 38.0 38.0 38.0 38.0 20-24 37.585950000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.626549999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.63770000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5514 38.0 38.0 38.0 38.0 38.0 40-44 37.45525 38.0 38.0 38.0 37.6 38.0 45-49 37.4139 38.0 38.0 38.0 37.2 38.0 50-54 37.4187 38.0 38.0 38.0 37.0 38.0 55-59 37.32645 38.0 38.0 38.0 37.0 38.0 60-64 37.282399999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.286899999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.2346 38.0 38.0 38.0 36.6 38.0 75-79 37.13605 38.0 38.0 38.0 36.2 38.0 80-84 36.99444999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.924749999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.91955 38.0 38.0 38.0 35.8 38.0 95-99 36.90025000000001 38.0 38.0 38.0 35.6 38.0 100-104 36.782500000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.58695 38.0 38.0 38.0 34.6 38.0 110-114 36.28515 38.0 37.8 38.0 33.8 38.0 115-119 36.39345000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.33605 38.0 38.0 38.0 34.0 38.0 125-129 35.89195 38.0 36.8 38.0 32.6 38.0 130-134 35.24085 38.0 35.6 38.0 29.0 38.0 135-139 35.13875 38.0 35.6 38.0 28.2 38.0 140-144 35.089650000000006 38.0 35.4 38.0 29.0 38.0 145-149 34.52375000000001 38.0 35.2 38.0 27.8 38.0 150-151 30.99425 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 0.0 17 1.0 18 2.0 19 2.0 20 0.0 21 3.0 22 1.0 23 6.0 24 6.0 25 5.0 26 10.0 27 16.0 28 15.0 29 29.0 30 38.0 31 48.0 32 57.0 33 107.0 34 165.0 35 293.0 36 707.0 37 2484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.563543003851095 18.10012836970475 8.549422336328627 33.78690629011553 2 19.79874213836478 20.830188679245282 38.51572327044025 20.855345911949684 3 17.75 26.825 27.3 28.125 4 23.525 32.574999999999996 22.85 21.05 5 22.225 34.949999999999996 23.275000000000002 19.55 6 17.549999999999997 36.125 25.05 21.275 7 13.825000000000001 22.025 45.625 18.525 8 17.325 21.675 32.175 28.825 9 19.175 22.75 31.65 26.424999999999997 10-14 20.485 29.875 26.545 23.095 15-19 20.265 28.465 27.625 23.645 20-24 20.155 28.23 28.000000000000004 23.615 25-29 19.98 28.685 27.805000000000003 23.53 30-34 19.900000000000002 29.035 27.905 23.16 35-39 20.31 28.28 28.17 23.24 40-44 20.005 28.815 27.805000000000003 23.375 45-49 20.52 28.125 27.529999999999998 23.825 50-54 20.369999999999997 28.375 27.74 23.515 55-59 20.51 28.24 27.57 23.68 60-64 20.669999999999998 27.925 27.26 24.145 65-69 19.885 28.255000000000003 28.225 23.635 70-74 20.265 28.455000000000002 28.09 23.189999999999998 75-79 20.745 27.82 27.544999999999998 23.89 80-84 20.665 27.98 27.894999999999996 23.46 85-89 20.169999999999998 27.744999999999997 28.825 23.26 90-94 20.32 28.625 27.544999999999998 23.51 95-99 20.445 27.939999999999998 28.115000000000002 23.5 100-104 20.995 28.68 27.465 22.86 105-109 20.495 27.860000000000003 27.834999999999997 23.810000000000002 110-114 20.495 27.88 28.075 23.549999999999997 115-119 20.595 28.28 27.975 23.150000000000002 120-124 20.69 28.04 27.61 23.66 125-129 20.515 27.855 28.144999999999996 23.485 130-134 20.815 28.384999999999998 27.445000000000004 23.355 135-139 20.669999999999998 27.935 27.96 23.435 140-144 21.099999999999998 27.944999999999997 27.73 23.225 145-149 21.04 27.544999999999998 27.939999999999998 23.474999999999998 150-151 21.65 27.987499999999997 27.3 23.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 3.5 27 5.5 28 7.5 29 10.0 30 17.5 31 20.0 32 26.5 33 42.5 34 59.0 35 76.5 36 102.5 37 123.0 38 138.0 39 154.0 40 174.5 41 223.5 42 263.5 43 278.0 44 277.5 45 272.0 46 282.0 47 268.0 48 215.0 49 184.0 50 167.0 51 137.0 52 107.0 53 84.0 54 66.5 55 50.5 56 34.5 57 23.5 58 19.5 59 16.5 60 15.5 61 11.5 62 9.5 63 8.5 64 5.0 65 3.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.9875 0.025 0.0 0.0 0.0 138-139 4.387499999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172643 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98525 33.0 33.0 34.0 32.0 34.0 2 33.03875 34.0 33.0 34.0 32.0 34.0 3 33.1015 34.0 33.0 34.0 32.0 34.0 4 33.02275 34.0 33.0 34.0 33.0 34.0 5 33.07675 34.0 33.0 34.0 32.0 34.0 6 37.1305 38.0 38.0 38.0 37.0 38.0 7 37.20325 38.0 38.0 38.0 37.0 38.0 8 37.21825 38.0 38.0 38.0 37.0 38.0 9 37.16425 38.0 38.0 38.0 37.0 38.0 10-14 37.1026 38.0 38.0 38.0 37.0 38.0 15-19 37.13415 38.0 38.0 38.0 37.0 38.0 20-24 37.12725 38.0 38.0 38.0 37.0 38.0 25-29 36.88165 38.0 38.0 38.0 36.6 38.0 30-34 36.267849999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.5216 38.0 38.0 38.0 35.6 38.0 40-44 36.9131 38.0 38.0 38.0 36.4 38.0 45-49 36.94515 38.0 38.0 38.0 36.6 38.0 50-54 36.9157 38.0 38.0 38.0 36.4 38.0 55-59 36.756899999999995 38.0 38.0 38.0 36.2 38.0 60-64 36.66015 38.0 38.0 38.0 35.6 38.0 65-69 36.522000000000006 38.0 38.0 38.0 34.8 38.0 70-74 36.50475 38.0 38.0 38.0 34.6 38.0 75-79 36.398399999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.34375 38.0 38.0 38.0 34.0 38.0 85-89 36.22455 38.0 38.0 38.0 33.8 38.0 90-94 36.26455 38.0 38.0 38.0 34.0 38.0 95-99 36.223949999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.130100000000006 38.0 38.0 38.0 33.8 38.0 105-109 36.08195 38.0 38.0 38.0 33.8 38.0 110-114 35.8676 38.0 37.8 38.0 33.4 38.0 115-119 35.5041 38.0 37.0 38.0 30.6 38.0 120-124 35.37355 38.0 36.6 38.0 30.0 38.0 125-129 34.91015 38.0 36.0 38.0 27.8 38.0 130-134 34.5169 38.0 35.2 38.0 25.4 38.0 135-139 34.17195 38.0 33.8 38.0 24.6 38.0 140-144 33.589549999999996 38.0 33.0 38.0 22.0 38.0 145-149 32.32985 38.0 33.0 38.0 10.8 38.0 150-151 27.780625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 5.0 5 2.0 6 10.0 7 2.0 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 2.0 14 0.0 15 3.0 16 4.0 17 5.0 18 1.0 19 5.0 20 5.0 21 7.0 22 8.0 23 11.0 24 12.0 25 18.0 26 20.0 27 29.0 28 33.0 29 39.0 30 45.0 31 72.0 32 84.0 33 121.0 34 176.0 35 292.0 36 592.0 37 2380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.25 17.75 12.35 27.650000000000002 2 23.1 25.1 35.75 16.05 3 20.225 26.0 33.175 20.599999999999998 4 24.099999999999998 34.675 22.35 18.875 5 24.65 37.75 19.55 18.05 6 17.825 38.125 24.2 19.85 7 18.65 17.775 43.125 20.45 8 21.475 22.650000000000002 27.55 28.325 9 21.675 24.375 28.549999999999997 25.4 10-14 23.225 28.98 26.16 21.634999999999998 15-19 22.915 28.18 27.634999999999998 21.27 20-24 22.81 29.04 27.555000000000003 20.595 25-29 23.29916591297357 28.14792483167521 27.555019596020504 20.99788965933072 30-34 23.00495884668473 28.16318184141915 28.035376514493127 20.796482797402994 35-39 23.281864971238267 28.105762438187504 27.823191038449895 20.78918155212433 40-44 23.34 27.889999999999997 28.09 20.68 45-49 23.189999999999998 28.535 27.500000000000004 20.775 50-54 23.22 27.93 27.685 21.165 55-59 22.905 27.665 27.805000000000003 21.625 60-64 23.195 28.025 28.025 20.755000000000003 65-69 22.78 28.08 27.93 21.21 70-74 23.115 27.794999999999998 28.08 21.01 75-79 23.79 27.884999999999998 27.975 20.349999999999998 80-84 23.605 27.915 27.49 20.990000000000002 85-89 23.544999999999998 28.03 27.889999999999997 20.535 90-94 23.645 28.084999999999997 27.97 20.3 95-99 23.1 28.144999999999996 27.85 20.905 100-104 23.525 28.42 27.47 20.585 105-109 23.615 27.634999999999998 27.91 20.84 110-114 23.21 28.235 27.21 21.345 115-119 23.365 28.199999999999996 27.72 20.715 120-124 23.895 28.33 27.485 20.29 125-129 23.935000000000002 28.225 27.375 20.465 130-134 24.375 28.055000000000003 27.405 20.165 135-139 24.310000000000002 28.050000000000004 27.67 19.97 140-144 24.22 28.345 27.72 19.715 145-149 24.75 27.400000000000002 27.21 20.64 150-151 25.025 27.437499999999996 27.975 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.5 24 3.0 25 2.0 26 3.0 27 3.5 28 6.0 29 9.5 30 10.5 31 14.5 32 25.5 33 38.0 34 51.5 35 62.5 36 77.5 37 104.0 38 143.0 39 170.0 40 195.0 41 230.0 42 249.5 43 270.0 44 283.0 45 285.0 46 277.0 47 251.5 48 236.5 49 222.5 50 170.0 51 125.5 52 113.5 53 90.0 54 59.0 55 45.5 56 43.0 57 31.0 58 22.0 59 18.0 60 11.0 61 9.5 62 6.5 63 3.5 64 4.0 65 4.5 66 4.0 67 2.5 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.49 30-34 2.1950000000000003 35-39 0.91 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755992 spots for SRR7172643.sra Written 755992 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra Read 755978 spots for SRR7172643.sra Written 755978 spots for SRR7172643.sra SRR ids: ['SRR7172643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcreuee7 SRR7172643.sra spots: 15119574 blocks: [[1, 755978], [755979, 1511956], [1511957, 2267934], [2267935, 3023912], [3023913, 3779890], [3779891, 4535868], [4535869, 5291846], [5291847, 6047824], [6047825, 6803802], [6803803, 7559780], [7559781, 8315758], [8315759, 9071736], [9071737, 9827714], [9827715, 10583692], [10583693, 11339670], [11339671, 12095648], [12095649, 12851626], [12851627, 13607604], [13607605, 14363582], [14363583, 15119574]] SRR7172643 file size 5101827 SRR7172643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172643 SRR7172643_1.fastq SRR7172643_2.fastq Input file: SRR7172643_1.fastq Paired file: SRR7172643_2.fastq trimmed: SRR7172643-trimmed-pair1.fastq, SRR7172643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:37:33 2025 >> started Mon Feb 10 16:37:48 2025 >> done (15.881s) 15119574 read pairs processed; of these: 20356 ( 0.13%) short read pairs filtered out after trimming by size control 15328 ( 0.10%) empty read pairs filtered out after trimming by size control 15083890 (99.76%) read pairs available; of these: 6219089 (41.23%) trimmed read pairs available after processing 8864801 (58.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 3 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 5 0.00% 35 6 0.00% 36 3 0.00% 37 1 0.00% 38 6 0.00% 39 4 0.00% 40 2 0.00% 41 5 0.00% 42 6 0.00% 43 6 0.00% 44 2 0.00% 45 9 0.00% 46 4 0.00% 47 8 0.00% 48 6 0.00% 49 6 0.00% 50 10 0.00% 51 8 0.00% 52 16 0.00% 53 18 0.00% 54 19 0.00% 55 24 0.00% 56 22 0.00% 57 31 0.00% 58 39 0.00% 59 35 0.00% 60 54 0.00% 61 48 0.00% 62 42 0.00% 63 64 0.00% 64 77 0.00% 65 81 0.00% 66 83 0.00% 67 106 0.00% 68 117 0.00% 69 127 0.00% 70 163 0.00% 71 161 0.00% 72 223 0.00% 73 259 0.00% 74 287 0.00% 75 331 0.00% 76 367 0.00% 77 458 0.00% 78 476 0.00% 79 531 0.00% 80 641 0.00% 81 734 0.00% 82 860 0.01% 83 1036 0.01% 84 2031 0.01% 85 2916 0.02% 86 2789 0.02% 87 2958 0.02% 88 3069 0.02% 89 3253 0.02% 90 3441 0.02% 91 3493 0.02% 92 3826 0.03% 93 4245 0.03% 94 4421 0.03% 95 4605 0.03% 96 5161 0.03% 97 5649 0.04% 98 6103 0.04% 99 6531 0.04% 100 7001 0.05% 101 7646 0.05% 102 8285 0.05% 103 8876 0.06% 104 9497 0.06% 105 10158 0.07% 106 10984 0.07% 107 11923 0.08% 108 12787 0.08% 109 13717 0.09% 110 14392 0.10% 111 15400 0.10% 112 16385 0.11% 113 17706 0.12% 114 18524 0.12% 115 19825 0.13% 116 20944 0.14% 117 22326 0.15% 118 23355 0.15% 119 24492 0.16% 120 25928 0.17% 121 26909 0.18% 122 28359 0.19% 123 29928 0.20% 124 31731 0.21% 125 33125 0.22% 126 35147 0.23% 127 36763 0.24% 128 38262 0.25% 129 40628 0.27% 130 42276 0.28% 131 44291 0.29% 132 46589 0.31% 133 49137 0.33% 134 51816 0.34% 135 54321 0.36% 136 56966 0.38% 137 60594 0.40% 138 64001 0.42% 139 68502 0.45% 140 73859 0.49% 141 79521 0.53% 142 87397 0.58% 143 95844 0.64% 144 109003 0.72% 145 127279 0.84% 146 154579 1.02% 147 203355 1.35% 148 296777 1.97% 149 584060 3.87% 150 3175769 21.05% 151 8864801 58.77% 15083890 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=7.73 fanout-score-rank=16 prefix-density=0.65 prefix-fanout=2.5 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=142.97 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=22.3 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=125.67 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=22.7 sequence=CAAAGAAGAAGAT SRR7172643 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:38:38 Started mapping on | Feb 10 16:38:38 Finished on | Feb 10 16:41:29 Mapping speed, Million of reads per hour | 317.56 Number of input reads | 15083890 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13587138 Uniquely mapped reads % | 90.08% Average mapped length | 295.59 Number of splices: Total | 13620972 Number of splices: Annotated (sjdb) | 13373762 Number of splices: GT/AG | 13399441 Number of splices: GC/AG | 176909 Number of splices: AT/AC | 9793 Number of splices: Non-canonical | 34829 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362798 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 60880 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.01% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1150627 1150627 1150627 N_multimapping 362798 362798 362798 N_noFeature 351148 13468364 402164 N_ambiguous 135821 900 67580 UnstrandedReadsAssigned:13100169 PositiveStrandReadsAssigned:117874 NegativeStrandReadsAssigned:13117394 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172643-trimmed-pair1.fastq SRR7172643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,083,890 reads, 13,069,087 reads pseudoaligned [quant] estimated average fragment length: 236.597 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52401 SRR7172643.ke.tsv 34699 SRR7172643.se.tsv 87100 total ==> SRR7172643.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.4 1091 47.9928 Potri.005G024800.1.v4.1 1035 799.403 218 21.382 Potri.004G059700.1.v4.1 961 725.424 34 3.67489 Potri.007G009000.2.v4.1 1416 1180.4 0 0 Potri.003G141000.2.v4.1 2943 2707.4 462 13.3797 Potri.016G087400.1.v4.1 270 79.3436 1027.94 1015.81 Potri.015G069301.1.v4.1 564 331.9 0 0 Potri.010G195200.1.v4.1 1773 1537.4 336 17.136 Potri.012G127500.1.v4.1 977 741.409 2240 236.891 ==> SRR7172643.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 249 SRR7172643 completed mapping pipeline successfully