Starting /dee2/code/volunteer_pipeline.sh SRR7172644 current disk space = 3058763239424 free memory = 1010877872 SRR7172644 SRAfilesize 359ceb40a8e1d0d38a77e4db418e503f SRR7172644.sra SRR7172644.sra file validated SRR7172644 is paired end SRR7172644 is conventional basespace SRR7172644 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.959 33.0 32.0 33.0 25.0 34.0 2 30.46625 32.0 31.0 33.0 25.0 33.0 3 31.89375 33.0 32.0 33.0 28.0 33.0 4 32.59075 33.0 33.0 33.0 32.0 34.0 5 32.76075 33.0 33.0 34.0 32.0 34.0 6 37.149 38.0 37.0 38.0 36.0 38.0 7 37.5135 38.0 38.0 38.0 37.0 38.0 8 37.626 38.0 38.0 38.0 38.0 38.0 9 37.64625 38.0 38.0 38.0 38.0 38.0 10-14 37.661100000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5791 38.0 38.0 38.0 38.0 38.0 20-24 37.5314 38.0 38.0 38.0 38.0 38.0 25-29 37.517849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.523 38.0 38.0 38.0 38.0 38.0 35-39 37.47595 38.0 38.0 38.0 38.0 38.0 40-44 37.42479999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.29635 38.0 38.0 38.0 37.0 38.0 50-54 37.29855 38.0 38.0 38.0 37.0 38.0 55-59 37.27815 38.0 38.0 38.0 37.0 38.0 60-64 37.1954 38.0 38.0 38.0 36.8 38.0 65-69 37.22965000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.126149999999996 38.0 38.0 38.0 36.2 38.0 75-79 37.02375 38.0 38.0 38.0 36.0 38.0 80-84 36.961400000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.76585 38.0 38.0 38.0 35.2 38.0 90-94 36.67945 38.0 38.0 38.0 34.6 38.0 95-99 36.7471 38.0 38.0 38.0 35.0 38.0 100-104 36.67875 38.0 38.0 38.0 34.8 38.0 105-109 36.45649999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.2296 38.0 38.0 38.0 33.8 38.0 115-119 36.1748 38.0 37.4 38.0 33.6 38.0 120-124 35.951499999999996 38.0 37.0 38.0 32.2 38.0 125-129 35.8089 38.0 36.8 38.0 32.0 38.0 130-134 35.25625 38.0 35.8 38.0 28.8 38.0 135-139 35.0441 38.0 35.8 38.0 28.0 38.0 140-144 35.0003 38.0 35.4 38.0 28.6 38.0 145-149 34.6733 38.0 35.4 38.0 28.8 38.0 150-151 30.606499999999997 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 2.0 18 0.0 19 2.0 20 3.0 21 1.0 22 6.0 23 5.0 24 6.0 25 6.0 26 12.0 27 17.0 28 21.0 29 27.0 30 37.0 31 46.0 32 75.0 33 94.0 34 161.0 35 242.0 36 613.0 37 2615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.56047873694933 13.368983957219251 13.114336643748409 35.95620066208301 2 19.16876574307305 19.496221662468514 38.841309823677584 22.493702770780857 3 19.05 25.224999999999998 26.8 28.925 4 22.725 33.525 23.025000000000002 20.724999999999998 5 21.375 35.525 24.224999999999998 18.875 6 16.75 36.15 25.474999999999998 21.625 7 13.075000000000001 21.525 45.525 19.875 8 17.349999999999998 22.05 30.349999999999998 30.25 9 18.475 21.275 33.725 26.525 10-14 19.744999999999997 29.345 27.529999999999998 23.380000000000003 15-19 20.005 28.38 27.79 23.825 20-24 19.175 28.235 28.575 24.015 25-29 19.79 28.89 27.985 23.335 30-34 19.505 28.71 27.98 23.805 35-39 19.994999999999997 28.415000000000003 27.584999999999997 24.005000000000003 40-44 19.275000000000002 29.395 27.865000000000002 23.465 45-49 19.985 28.485 28.21 23.32 50-54 19.85 28.720000000000002 27.900000000000002 23.53 55-59 20.255000000000003 28.16 28.28 23.305 60-64 19.805 28.62 27.655 23.919999999999998 65-69 19.45 29.24 27.200000000000003 24.11 70-74 19.885 28.74 27.93 23.445 75-79 19.835 28.505000000000003 27.415 24.245 80-84 19.439999999999998 28.62 28.305000000000003 23.635 85-89 19.415 28.73 27.68 24.175 90-94 20.21 28.16 28.050000000000004 23.580000000000002 95-99 19.975 28.144999999999996 27.765 24.115000000000002 100-104 19.99 28.025 28.185 23.799999999999997 105-109 19.775000000000002 28.255000000000003 27.915 24.055 110-114 20.22702270227023 28.202820282028203 28.107810781078108 23.462346234623464 115-119 20.225 28.544999999999998 27.21 24.02 120-124 19.98 28.01 28.389999999999997 23.62 125-129 20.405 27.855 27.77 23.97 130-134 20.76 28.185 27.55 23.505000000000003 135-139 20.544999999999998 28.470000000000002 27.505000000000003 23.48 140-144 20.580000000000002 28.16 27.529999999999998 23.73 145-149 20.880000000000003 28.51 26.655 23.955000000000002 150-151 20.7125 28.15 27.1 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 0.5 24 0.5 25 1.0 26 4.5 27 8.0 28 8.5 29 14.0 30 18.5 31 28.0 32 39.0 33 47.5 34 56.5 35 71.0 36 94.0 37 117.0 38 148.5 39 179.5 40 208.0 41 226.0 42 245.5 43 283.0 44 293.5 45 262.5 46 251.0 47 229.0 48 204.0 49 195.5 50 164.5 51 139.5 52 109.0 53 82.5 54 66.5 55 49.5 56 39.5 57 31.0 58 21.0 59 11.5 60 7.5 61 6.5 62 7.0 63 6.0 64 2.5 65 3.0 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.475 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172644 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04375 34.0 33.0 34.0 32.0 34.0 2 33.00525 34.0 33.0 34.0 32.0 34.0 3 33.103 34.0 33.0 34.0 32.0 34.0 4 33.10075 34.0 33.0 34.0 33.0 34.0 5 33.07 34.0 33.0 34.0 32.0 34.0 6 37.1635 38.0 38.0 38.0 37.0 38.0 7 37.1995 38.0 38.0 38.0 37.0 38.0 8 37.21325 38.0 38.0 38.0 37.0 38.0 9 37.1975 38.0 38.0 38.0 37.0 38.0 10-14 37.10275 38.0 38.0 38.0 37.0 38.0 15-19 37.13855 38.0 38.0 38.0 37.0 38.0 20-24 37.13435 38.0 38.0 38.0 37.0 38.0 25-29 36.7892 38.0 38.0 38.0 36.6 38.0 30-34 36.09635 38.0 38.0 38.0 35.4 38.0 35-39 36.38895 38.0 38.0 38.0 35.0 38.0 40-44 36.917 38.0 38.0 38.0 36.4 38.0 45-49 36.93155 38.0 38.0 38.0 36.2 38.0 50-54 36.948 38.0 38.0 38.0 36.8 38.0 55-59 36.82145 38.0 38.0 38.0 36.0 38.0 60-64 36.6178 38.0 38.0 38.0 35.4 38.0 65-69 36.47555 38.0 38.0 38.0 34.6 38.0 70-74 36.55865 38.0 38.0 38.0 35.0 38.0 75-79 36.489850000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.4425 38.0 38.0 38.0 34.6 38.0 85-89 36.34645 38.0 38.0 38.0 34.2 38.0 90-94 36.23635 38.0 38.0 38.0 34.0 38.0 95-99 36.138850000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.01815 38.0 38.0 38.0 33.6 38.0 105-109 35.80755 38.0 37.8 38.0 33.0 38.0 110-114 35.66265 38.0 37.4 38.0 31.8 38.0 115-119 35.4914 38.0 37.0 38.0 31.0 38.0 120-124 35.0989 38.0 36.2 38.0 28.4 38.0 125-129 35.0461 38.0 36.0 38.0 28.2 38.0 130-134 34.83284999999999 38.0 36.0 38.0 27.8 38.0 135-139 34.24325 38.0 34.8 38.0 24.0 38.0 140-144 33.8438 38.0 33.0 38.0 23.2 38.0 145-149 32.8508 38.0 33.0 38.0 15.0 38.0 150-151 27.570625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 3.0 5 3.0 6 1.0 7 2.0 8 3.0 9 0.0 10 2.0 11 3.0 12 3.0 13 4.0 14 4.0 15 5.0 16 4.0 17 5.0 18 4.0 19 4.0 20 9.0 21 13.0 22 14.0 23 8.0 24 10.0 25 11.0 26 14.0 27 28.0 28 27.0 29 34.0 30 49.0 31 44.0 32 87.0 33 116.0 34 193.0 35 308.0 36 554.0 37 2417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 16.975 16.35 27.625 2 24.375 23.974999999999998 34.675 16.975 3 20.125 27.150000000000002 31.5 21.224999999999998 4 24.425 34.775 21.45 19.35 5 25.35 38.05 20.549999999999997 16.05 6 18.6 36.95 24.425 20.025000000000002 7 17.849999999999998 17.075000000000003 44.074999999999996 21.0 8 20.525 22.45 28.050000000000004 28.975 9 22.075 24.65 28.975 24.3 10-14 23.64 28.725 26.540000000000003 21.095 15-19 23.115 28.444999999999997 27.505000000000003 20.935000000000002 20-24 22.919999999999998 28.475 27.58 21.025 25-29 23.01727176594995 28.163553048995414 27.88660053376303 20.932574651291606 30-34 23.213919113118457 28.26421679326627 27.966536645452678 20.555327448162593 35-39 22.902115598744814 28.084826399433144 27.953234133009413 21.059823868812632 40-44 23.04 28.285 27.905 20.77 45-49 23.3 27.775 28.515 20.41 50-54 23.05 27.93 28.585 20.435 55-59 23.13 28.044999999999998 28.37 20.455000000000002 60-64 23.494999999999997 28.134999999999998 27.689999999999998 20.68 65-69 23.330000000000002 27.860000000000003 27.834999999999997 20.974999999999998 70-74 23.125 28.13 28.349999999999998 20.395 75-79 23.73 28.15 28.08 20.04 80-84 23.275000000000002 28.565 27.839999999999996 20.32 85-89 23.735 28.475 27.83 19.96 90-94 23.905 28.26 28.105000000000004 19.73 95-99 23.78 28.17 28.110000000000003 19.939999999999998 100-104 24.02 28.08 27.77 20.13 105-109 24.205 27.87 27.925 20.0 110-114 24.14 28.38 27.505000000000003 19.975 115-119 24.175 27.965 27.495000000000005 20.365 120-124 24.55 27.555000000000003 27.534999999999997 20.36 125-129 24.295 28.215 27.82 19.67 130-134 24.055 28.075 27.725 20.145 135-139 24.4 27.88 27.96 19.759999999999998 140-144 24.38 28.144999999999996 27.534999999999997 19.939999999999998 145-149 25.330000000000002 28.144999999999996 27.125 19.400000000000002 150-151 25.75 27.8875 27.212500000000002 19.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 1.5 23 1.0 24 1.5 25 2.0 26 2.0 27 2.0 28 4.0 29 6.0 30 9.5 31 14.0 32 21.5 33 37.5 34 47.5 35 67.0 36 93.5 37 117.0 38 141.5 39 182.0 40 219.0 41 251.5 42 270.0 43 269.0 44 302.5 45 309.5 46 268.5 47 244.5 48 220.5 49 181.0 50 157.0 51 130.5 52 98.5 53 82.5 54 58.0 55 45.0 56 43.5 57 30.5 58 21.5 59 14.0 60 9.0 61 5.5 62 4.0 63 3.0 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.705 30-34 2.58 35-39 1.21 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTAAG 10 0.0068785893 144.66249 5 TATCATC 10 0.0068785893 144.66249 8 >>END_MODULE Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765517 spots for SRR7172644.sra Written 765517 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra Read 765512 spots for SRR7172644.sra Written 765512 spots for SRR7172644.sra SRR ids: ['SRR7172644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wpb6j_u3 SRR7172644.sra spots: 15310245 blocks: [[1, 765512], [765513, 1531024], [1531025, 2296536], [2296537, 3062048], [3062049, 3827560], [3827561, 4593072], [4593073, 5358584], [5358585, 6124096], [6124097, 6889608], [6889609, 7655120], [7655121, 8420632], [8420633, 9186144], [9186145, 9951656], [9951657, 10717168], [10717169, 11482680], [11482681, 12248192], [12248193, 13013704], [13013705, 13779216], [13779217, 14544728], [14544729, 15310245]] SRR7172644 file size 5166439 SRR7172644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172644 SRR7172644_1.fastq SRR7172644_2.fastq Input file: SRR7172644_1.fastq Paired file: SRR7172644_2.fastq trimmed: SRR7172644-trimmed-pair1.fastq, SRR7172644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:55:09 2025 >> started Mon Feb 10 15:55:25 2025 >> done (16.827s) 15310245 read pairs processed; of these: 16727 ( 0.11%) short read pairs filtered out after trimming by size control 11212 ( 0.07%) empty read pairs filtered out after trimming by size control 15282306 (99.82%) read pairs available; of these: 7911458 (51.77%) trimmed read pairs available after processing 7370848 (48.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 0 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 1 0.00% 36 3 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 4 0.00% 41 7 0.00% 42 9 0.00% 43 5 0.00% 44 5 0.00% 45 8 0.00% 46 4 0.00% 47 9 0.00% 48 16 0.00% 49 8 0.00% 50 14 0.00% 51 13 0.00% 52 25 0.00% 53 18 0.00% 54 19 0.00% 55 22 0.00% 56 28 0.00% 57 28 0.00% 58 38 0.00% 59 38 0.00% 60 47 0.00% 61 53 0.00% 62 65 0.00% 63 92 0.00% 64 102 0.00% 65 100 0.00% 66 132 0.00% 67 136 0.00% 68 168 0.00% 69 218 0.00% 70 214 0.00% 71 276 0.00% 72 286 0.00% 73 366 0.00% 74 397 0.00% 75 441 0.00% 76 568 0.00% 77 639 0.00% 78 645 0.00% 79 742 0.00% 80 860 0.01% 81 966 0.01% 82 1125 0.01% 83 1469 0.01% 84 2393 0.02% 85 2905 0.02% 86 2992 0.02% 87 3281 0.02% 88 3423 0.02% 89 3663 0.02% 90 3829 0.03% 91 4046 0.03% 92 4517 0.03% 93 4859 0.03% 94 5286 0.03% 95 5542 0.04% 96 6086 0.04% 97 6405 0.04% 98 7011 0.05% 99 7409 0.05% 100 8119 0.05% 101 8595 0.06% 102 9324 0.06% 103 10132 0.07% 104 10822 0.07% 105 11568 0.08% 106 12360 0.08% 107 12519 0.08% 108 13549 0.09% 109 14571 0.10% 110 15345 0.10% 111 16386 0.11% 112 17388 0.11% 113 18481 0.12% 114 19819 0.13% 115 20842 0.14% 116 21631 0.14% 117 22651 0.15% 118 23427 0.15% 119 24426 0.16% 120 25927 0.17% 121 27406 0.18% 122 28538 0.19% 123 30068 0.20% 124 32052 0.21% 125 33353 0.22% 126 34599 0.23% 127 35903 0.23% 128 36873 0.24% 129 39350 0.26% 130 40520 0.27% 131 42291 0.28% 132 44924 0.29% 133 46991 0.31% 134 49892 0.33% 135 52658 0.34% 136 55303 0.36% 137 58522 0.38% 138 61905 0.41% 139 66362 0.43% 140 71432 0.47% 141 77739 0.51% 142 85065 0.56% 143 94595 0.62% 144 108159 0.71% 145 127135 0.83% 146 156142 1.02% 147 211582 1.38% 148 329293 2.15% 149 821824 5.38% 150 4588982 30.03% 151 7370848 48.23% 15282306 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=14.39 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.6 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=26.12 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172644 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:56:21 Started mapping on | Feb 10 15:56:21 Finished on | Feb 10 15:58:07 Mapping speed, Million of reads per hour | 519.02 Number of input reads | 15282306 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14409614 Uniquely mapped reads % | 94.29% Average mapped length | 295.21 Number of splices: Total | 14561539 Number of splices: Annotated (sjdb) | 14305208 Number of splices: GT/AG | 14329791 Number of splices: GC/AG | 186724 Number of splices: AT/AC | 10686 Number of splices: Non-canonical | 34338 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347311 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 45068 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541429 541429 541429 N_multimapping 347311 347311 347311 N_noFeature 358481 14286403 406131 N_ambiguous 148403 948 72275 UnstrandedReadsAssigned:13902730 PositiveStrandReadsAssigned:122263 NegativeStrandReadsAssigned:13931208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172644-trimmed-pair1.fastq SRR7172644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,282,306 reads, 13,839,944 reads pseudoaligned [quant] estimated average fragment length: 240.182 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7172644.ke.tsv 34699 SRR7172644.se.tsv 87100 total ==> SRR7172644.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.82 1310 52.5937 Potri.005G024800.1.v4.1 1035 795.818 356 31.947 Potri.004G059700.1.v4.1 961 721.831 24 2.37449 Potri.007G009000.2.v4.1 1416 1176.82 0 0 Potri.003G141000.2.v4.1 2943 2703.82 846 22.3454 Potri.016G087400.1.v4.1 270 78.7001 1042 945.556 Potri.015G069301.1.v4.1 564 328.882 0 0 Potri.010G195200.1.v4.1 1773 1533.82 401.817 18.7089 Potri.012G127500.1.v4.1 977 737.824 4791 463.732 ==> SRR7172644.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 389 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 191 SRR7172644 completed mapping pipeline successfully