Starting /dee2/code/volunteer_pipeline.sh SRR7172645 current disk space = 3058773307392 free memory = 1033214236 SRR7172645 SRAfilesize 103efe2f27dd598f4b9507bde07c80b8 SRR7172645.sra SRR7172645.sra file validated SRR7172645 is paired end SRR7172645 is conventional basespace SRR7172645 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01125 33.0 32.0 33.0 27.0 34.0 2 31.01075 33.0 31.0 33.0 27.0 33.0 3 31.93375 33.0 32.0 33.0 30.0 34.0 4 32.23025 33.0 33.0 33.0 31.0 34.0 5 32.6805 33.0 33.0 34.0 32.0 34.0 6 36.91175 38.0 37.0 38.0 35.0 38.0 7 37.44625 38.0 38.0 38.0 37.0 38.0 8 37.564 38.0 38.0 38.0 38.0 38.0 9 37.6155 38.0 38.0 38.0 38.0 38.0 10-14 37.611149999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.58985 38.0 38.0 38.0 38.0 38.0 20-24 37.58515 38.0 38.0 38.0 38.0 38.0 25-29 37.573 38.0 38.0 38.0 38.0 38.0 30-34 37.56385 38.0 38.0 38.0 38.0 38.0 35-39 37.5293 38.0 38.0 38.0 38.0 38.0 40-44 37.46445 38.0 38.0 38.0 37.6 38.0 45-49 37.34765 38.0 38.0 38.0 37.0 38.0 50-54 37.35985 38.0 38.0 38.0 37.0 38.0 55-59 37.28375 38.0 38.0 38.0 37.0 38.0 60-64 37.281699999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.283249999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.219300000000004 38.0 38.0 38.0 36.6 38.0 75-79 37.0866 38.0 38.0 38.0 36.0 38.0 80-84 37.029999999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.876000000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.838800000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.85925 38.0 38.0 38.0 35.0 38.0 100-104 36.7427 38.0 38.0 38.0 35.0 38.0 105-109 36.5104 38.0 38.0 38.0 34.0 38.0 110-114 36.372 38.0 38.0 38.0 34.0 38.0 115-119 36.269149999999996 38.0 37.8 38.0 34.0 38.0 120-124 36.143449999999994 38.0 37.4 38.0 33.4 38.0 125-129 36.00385 38.0 37.0 38.0 32.6 38.0 130-134 35.38215 38.0 36.0 38.0 29.6 38.0 135-139 35.16865 38.0 36.0 38.0 28.2 38.0 140-144 34.964400000000005 38.0 35.4 38.0 28.0 38.0 145-149 34.612249999999996 38.0 35.2 38.0 28.0 38.0 150-151 30.55675 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 3.0 17 0.0 18 1.0 19 1.0 20 1.0 21 3.0 22 2.0 23 7.0 24 5.0 25 16.0 26 12.0 27 11.0 28 18.0 29 29.0 30 34.0 31 37.0 32 75.0 33 90.0 34 153.0 35 271.0 36 619.0 37 2611.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.616858237547895 14.738186462324393 10.983397190293742 34.661558109833976 2 19.47302383939774 20.55207026348808 39.29736511919699 20.677540777917187 3 18.75 28.475 27.275 25.5 4 22.325 33.575 23.474999999999998 20.625 5 21.5 36.075 24.099999999999998 18.325 6 16.125 35.875 27.3 20.7 7 13.350000000000001 22.075 46.300000000000004 18.275 8 15.975 21.85 32.375 29.799999999999997 9 16.650000000000002 23.65 31.474999999999998 28.225 10-14 20.064999999999998 29.915000000000003 26.590000000000003 23.43 15-19 19.744999999999997 28.444999999999997 27.915 23.895 20-24 19.85 28.794999999999998 28.03 23.325000000000003 25-29 19.18 28.78 27.925 24.115000000000002 30-34 19.32 28.925 27.834999999999997 23.919999999999998 35-39 19.35 29.235 27.36 24.055 40-44 19.715 28.585 27.755000000000003 23.945 45-49 19.955000000000002 28.485 27.595 23.965 50-54 20.02 28.439999999999998 27.98 23.56 55-59 19.814999999999998 28.999999999999996 27.855 23.330000000000002 60-64 19.580000000000002 28.499999999999996 28.110000000000003 23.810000000000002 65-69 20.23 28.235 27.884999999999998 23.65 70-74 20.369999999999997 28.804999999999996 27.525 23.3 75-79 19.85 28.625 28.025 23.5 80-84 19.41 28.51 28.105000000000004 23.974999999999998 85-89 20.105 28.655 28.199999999999996 23.04 90-94 20.07 29.04 27.625 23.265 95-99 19.869999999999997 28.74 27.605 23.785 100-104 20.185 28.860000000000003 27.565 23.39 105-109 20.215 28.065 28.115000000000002 23.605 110-114 20.16802520378057 27.959193879081862 28.249237385607838 23.623543531529727 115-119 20.435 28.38 27.83 23.355 120-124 19.744999999999997 28.74 28.17 23.345 125-129 20.03 28.57 27.644999999999996 23.755000000000003 130-134 20.595 28.705000000000002 27.51 23.189999999999998 135-139 20.794999999999998 28.595 27.455000000000002 23.155 140-144 20.62 28.785 27.18 23.415 145-149 20.27 28.605000000000004 27.0 24.125 150-151 20.6125 27.462500000000002 26.950000000000003 24.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 4.0 26 3.0 27 6.0 28 9.0 29 11.0 30 18.5 31 30.0 32 35.5 33 40.5 34 55.0 35 83.5 36 103.5 37 129.0 38 164.5 39 178.0 40 196.0 41 235.0 42 273.5 43 287.5 44 272.5 45 257.5 46 261.0 47 233.5 48 200.0 49 188.5 50 167.0 51 130.5 52 101.5 53 84.5 54 64.5 55 48.0 56 35.5 57 24.0 58 13.5 59 12.0 60 11.0 61 8.0 62 4.0 63 2.0 64 1.5 65 0.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2625000000000002 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTGTT 10 0.006832588 144.9875 2 GAGTTCC 10 0.006832588 144.9875 3 TTGATCT 10 0.006832588 144.9875 7 CGTGTTC 10 0.006832588 144.9875 3 CTCGCTA 10 0.006832588 144.9875 8 >>END_MODULE SRR7172645 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2075 34.0 33.0 34.0 33.0 34.0 2 33.19525 34.0 33.0 34.0 33.0 34.0 3 33.23275 34.0 33.0 34.0 33.0 34.0 4 33.2395 34.0 33.0 34.0 33.0 34.0 5 33.22825 34.0 33.0 34.0 33.0 34.0 6 37.321 38.0 38.0 38.0 38.0 38.0 7 37.332 38.0 38.0 38.0 38.0 38.0 8 37.29 38.0 38.0 38.0 38.0 38.0 9 37.32125 38.0 38.0 38.0 38.0 38.0 10-14 37.2421 38.0 38.0 38.0 37.8 38.0 15-19 37.26735 38.0 38.0 38.0 37.8 38.0 20-24 37.2935 38.0 38.0 38.0 38.0 38.0 25-29 36.84735 38.0 38.0 38.0 36.8 38.0 30-34 36.00485 38.0 38.0 38.0 35.6 38.0 35-39 36.361149999999995 38.0 38.0 38.0 35.6 38.0 40-44 37.049549999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.0742 38.0 38.0 38.0 37.0 38.0 50-54 37.0959 38.0 38.0 38.0 37.0 38.0 55-59 36.9542 38.0 38.0 38.0 36.8 38.0 60-64 36.73180000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.6256 38.0 38.0 38.0 35.4 38.0 70-74 36.70625 38.0 38.0 38.0 36.0 38.0 75-79 36.6854 38.0 38.0 38.0 36.0 38.0 80-84 36.56075 38.0 38.0 38.0 35.4 38.0 85-89 36.54245 38.0 38.0 38.0 35.0 38.0 90-94 36.4238 38.0 38.0 38.0 34.6 38.0 95-99 36.307249999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.279700000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.132799999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.0261 38.0 38.0 38.0 33.6 38.0 115-119 35.83425 38.0 37.8 38.0 33.0 38.0 120-124 35.5488 38.0 37.0 38.0 31.0 38.0 125-129 35.39735 38.0 36.8 38.0 31.0 38.0 130-134 35.1871 38.0 36.2 38.0 30.0 38.0 135-139 34.5159 38.0 35.6 38.0 26.2 38.0 140-144 34.0304 38.0 33.8 38.0 24.2 38.0 145-149 33.15885 38.0 33.0 38.0 18.2 38.0 150-151 28.220125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 3.0 5 5.0 6 1.0 7 3.0 8 1.0 9 2.0 10 0.0 11 1.0 12 3.0 13 3.0 14 0.0 15 4.0 16 3.0 17 4.0 18 1.0 19 6.0 20 6.0 21 5.0 22 5.0 23 6.0 24 8.0 25 7.0 26 22.0 27 14.0 28 21.0 29 20.0 30 43.0 31 56.0 32 77.0 33 104.0 34 176.0 35 297.0 36 577.0 37 2496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.15 18.075 13.225000000000001 25.55 2 23.849999999999998 22.8 36.199999999999996 17.150000000000002 3 20.75 25.424999999999997 32.375 21.45 4 24.55 34.775 21.9 18.775 5 23.9 36.95 22.575 16.575 6 18.625 36.525 25.05 19.8 7 18.675 16.525000000000002 43.725 21.075 8 20.275000000000002 22.325 28.95 28.449999999999996 9 22.2 24.525 28.95 24.325 10-14 22.36 28.799999999999997 27.034999999999997 21.805 15-19 23.275000000000002 27.250000000000004 28.754999999999995 20.72 20-24 22.725 28.225 28.025 21.025 25-29 22.82126286060117 28.202541859995968 27.894896106516036 21.081299172886826 30-34 23.138832997987926 27.880101119537738 28.143218284063355 20.837847598410978 35-39 22.63681592039801 27.860696517412936 28.72880495481775 20.773682607371306 40-44 23.064999999999998 27.92 28.32 20.695 45-49 23.085 28.345 28.555000000000003 20.015 50-54 22.85 28.09 28.335 20.724999999999998 55-59 23.465 27.845 28.494999999999997 20.195 60-64 23.455000000000002 28.585 27.52 20.44 65-69 23.525 28.79 27.3 20.385 70-74 22.99 28.38 27.875 20.755000000000003 75-79 23.52 27.605 28.994999999999997 19.88 80-84 23.849999999999998 27.944999999999997 28.044999999999998 20.16 85-89 23.265 27.915 28.84 19.98 90-94 23.69 27.900000000000002 28.205000000000002 20.205000000000002 95-99 23.625 28.199999999999996 28.23 19.945 100-104 23.669999999999998 27.955000000000002 28.050000000000004 20.325 105-109 23.28 27.750000000000004 28.65 20.32 110-114 23.415 28.12 28.54 19.925 115-119 24.14 28.325 27.975 19.56 120-124 23.205000000000002 27.794999999999998 28.625 20.375 125-129 23.674999999999997 28.405 28.005000000000003 19.915 130-134 23.630000000000003 28.79 27.675 19.905 135-139 24.875 28.365000000000002 27.125 19.634999999999998 140-144 24.32 28.294999999999998 27.595 19.79 145-149 25.16 27.975 26.965 19.900000000000002 150-151 25.35 27.55 27.075 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 0.5 26 2.0 27 5.5 28 6.0 29 6.5 30 16.0 31 19.5 32 21.0 33 36.0 34 55.5 35 69.5 36 87.0 37 115.0 38 148.5 39 184.5 40 219.0 41 244.0 42 269.5 43 286.5 44 283.5 45 280.0 46 275.5 47 265.5 48 235.5 49 193.5 50 153.0 51 121.5 52 93.5 53 71.0 54 56.5 55 42.0 56 32.5 57 27.0 58 19.5 59 12.0 60 8.0 61 5.5 62 5.0 63 5.0 64 6.0 65 3.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.86 30-34 3.085 35-39 1.51 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.3375000000000004 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796343 spots for SRR7172645.sra Written 796343 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra Read 796336 spots for SRR7172645.sra Written 796336 spots for SRR7172645.sra SRR ids: ['SRR7172645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1zucm395 SRR7172645.sra spots: 15926727 blocks: [[1, 796336], [796337, 1592672], [1592673, 2389008], [2389009, 3185344], [3185345, 3981680], [3981681, 4778016], [4778017, 5574352], [5574353, 6370688], [6370689, 7167024], [7167025, 7963360], [7963361, 8759696], [8759697, 9556032], [9556033, 10352368], [10352369, 11148704], [11148705, 11945040], [11945041, 12741376], [12741377, 13537712], [13537713, 14334048], [14334049, 15130384], [15130385, 15926727]] SRR7172645 file size 5375344 SRR7172645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172645 SRR7172645_1.fastq SRR7172645_2.fastq Input file: SRR7172645_1.fastq Paired file: SRR7172645_2.fastq trimmed: SRR7172645-trimmed-pair1.fastq, SRR7172645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:52:50 2025 >> started Mon Feb 10 15:53:08 2025 >> done (18.066s) 15926727 read pairs processed; of these: 20946 ( 0.13%) short read pairs filtered out after trimming by size control 13030 ( 0.08%) empty read pairs filtered out after trimming by size control 15892751 (99.79%) read pairs available; of these: 8274758 (52.07%) trimmed read pairs available after processing 7617993 (47.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 1 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 0 0.00% 29 1 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 5 0.00% 34 1 0.00% 35 3 0.00% 36 4 0.00% 37 1 0.00% 38 4 0.00% 39 7 0.00% 40 2 0.00% 41 4 0.00% 42 4 0.00% 43 8 0.00% 44 5 0.00% 45 4 0.00% 46 7 0.00% 47 15 0.00% 48 12 0.00% 49 16 0.00% 50 9 0.00% 51 21 0.00% 52 24 0.00% 53 23 0.00% 54 25 0.00% 55 33 0.00% 56 41 0.00% 57 38 0.00% 58 56 0.00% 59 54 0.00% 60 86 0.00% 61 94 0.00% 62 102 0.00% 63 123 0.00% 64 104 0.00% 65 133 0.00% 66 188 0.00% 67 184 0.00% 68 222 0.00% 69 264 0.00% 70 312 0.00% 71 334 0.00% 72 445 0.00% 73 502 0.00% 74 559 0.00% 75 635 0.00% 76 760 0.00% 77 831 0.01% 78 936 0.01% 79 1122 0.01% 80 1193 0.01% 81 1433 0.01% 82 1635 0.01% 83 2074 0.01% 84 3203 0.02% 85 3930 0.02% 86 4174 0.03% 87 4547 0.03% 88 4777 0.03% 89 4990 0.03% 90 5193 0.03% 91 5585 0.04% 92 5994 0.04% 93 6531 0.04% 94 6990 0.04% 95 7483 0.05% 96 7903 0.05% 97 8666 0.05% 98 9107 0.06% 99 9717 0.06% 100 10232 0.06% 101 10724 0.07% 102 11735 0.07% 103 12695 0.08% 104 13724 0.09% 105 14353 0.09% 106 15154 0.10% 107 15912 0.10% 108 17037 0.11% 109 17778 0.11% 110 18904 0.12% 111 20018 0.13% 112 20823 0.13% 113 21783 0.14% 114 22960 0.14% 115 23999 0.15% 116 25368 0.16% 117 26312 0.17% 118 27432 0.17% 119 28458 0.18% 120 29595 0.19% 121 31279 0.20% 122 32244 0.20% 123 33690 0.21% 124 35382 0.22% 125 36754 0.23% 126 38223 0.24% 127 39874 0.25% 128 40965 0.26% 129 42901 0.27% 130 45292 0.28% 131 46439 0.29% 132 48482 0.31% 133 50942 0.32% 134 53375 0.34% 135 55924 0.35% 136 59142 0.37% 137 62451 0.39% 138 65816 0.41% 139 69495 0.44% 140 74191 0.47% 141 81867 0.52% 142 89209 0.56% 143 98671 0.62% 144 112428 0.71% 145 132272 0.83% 146 161733 1.02% 147 218891 1.38% 148 340257 2.14% 149 844803 5.32% 150 4713244 29.66% 151 7617993 47.93% 15892751 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=25 prefix-density=0.42 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=82.22 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.5 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=136.03 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=14.6 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7172645 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:54:00 Started mapping on | Feb 10 15:54:01 Finished on | Feb 10 15:55:45 Mapping speed, Million of reads per hour | 550.13 Number of input reads | 15892751 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15024765 Uniquely mapped reads % | 94.54% Average mapped length | 294.58 Number of splices: Total | 14907034 Number of splices: Annotated (sjdb) | 14630910 Number of splices: GT/AG | 14666404 Number of splices: GC/AG | 190523 Number of splices: AT/AC | 11667 Number of splices: Non-canonical | 38440 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356042 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 40532 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 532194 532194 532194 N_multimapping 356042 356042 356042 N_noFeature 454903 14896284 506367 N_ambiguous 149364 701 71937 UnstrandedReadsAssigned:14420498 PositiveStrandReadsAssigned:127780 NegativeStrandReadsAssigned:14446461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172645-trimmed-pair1.fastq SRR7172645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,892,751 reads, 14,353,360 reads pseudoaligned [quant] estimated average fragment length: 239.841 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR7172645.ke.tsv 34699 SRR7172645.se.tsv 87100 total ==> SRR7172645.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.16 989 39.8954 Potri.005G024800.1.v4.1 1035 796.159 257 23.1672 Potri.004G059700.1.v4.1 961 722.185 37 3.677 Potri.007G009000.2.v4.1 1416 1177.16 0 0 Potri.003G141000.2.v4.1 2943 2704.16 589.16 15.6366 Potri.016G087400.1.v4.1 270 81.2028 1020 901.509 Potri.015G069301.1.v4.1 564 330.107 0 0 Potri.010G195200.1.v4.1 1773 1534.16 380 17.7768 Potri.012G127500.1.v4.1 977 738.169 4593 446.561 ==> SRR7172645.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 205 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 151 SRR7172645 completed mapping pipeline successfully