Starting /dee2/code/volunteer_pipeline.sh SRR7172646 current disk space = 3058776686592 free memory = 1080862344 SRR7172646 SRAfilesize f9ff6f3ec29c665e6f934be2ded49d85 SRR7172646.sra SRR7172646.sra file validated SRR7172646 is paired end SRR7172646 is conventional basespace SRR7172646 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.888 18.0 18.0 30.0 18.0 32.0 2 26.491 27.0 25.0 31.0 18.0 33.0 3 29.1735 30.0 27.0 33.0 25.0 33.0 4 30.26475 31.0 29.0 33.0 27.0 33.0 5 31.48575 33.0 31.0 33.0 29.0 33.0 6 36.75875 38.0 37.0 38.0 34.0 38.0 7 37.44725 38.0 38.0 38.0 37.0 38.0 8 37.4285 38.0 38.0 38.0 37.0 38.0 9 37.5535 38.0 38.0 38.0 38.0 38.0 10-14 37.6119 38.0 38.0 38.0 38.0 38.0 15-19 37.5332 38.0 38.0 38.0 38.0 38.0 20-24 37.47555 38.0 38.0 38.0 37.8 38.0 25-29 37.5366 38.0 38.0 38.0 38.0 38.0 30-34 37.482800000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4371 38.0 38.0 38.0 37.6 38.0 40-44 37.351549999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.23375 38.0 38.0 38.0 36.8 38.0 50-54 37.30225 38.0 38.0 38.0 37.0 38.0 55-59 37.1824 38.0 38.0 38.0 36.8 38.0 60-64 37.1029 38.0 38.0 38.0 36.4 38.0 65-69 37.0407 38.0 38.0 38.0 36.0 38.0 70-74 37.050599999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.93005 38.0 38.0 38.0 35.8 38.0 80-84 36.868700000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.70265 38.0 38.0 38.0 34.8 38.0 90-94 36.7722 38.0 38.0 38.0 35.0 38.0 95-99 36.73265 38.0 38.0 38.0 35.0 38.0 100-104 36.6653 38.0 38.0 38.0 34.6 38.0 105-109 36.2856 38.0 38.0 38.0 33.6 38.0 110-114 36.16265 38.0 37.8 38.0 33.6 38.0 115-119 36.1441 38.0 37.6 38.0 33.6 38.0 120-124 36.100899999999996 38.0 37.6 38.0 33.6 38.0 125-129 35.7538 38.0 36.4 38.0 31.8 38.0 130-134 35.29535 38.0 36.0 38.0 28.6 38.0 135-139 35.003499999999995 38.0 35.6 38.0 28.0 38.0 140-144 34.79665 38.0 35.2 38.0 27.8 38.0 145-149 34.40495 38.0 34.8 38.0 27.2 38.0 150-151 30.484875 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 2.0 8 0.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 0.0 20 5.0 21 2.0 22 7.0 23 5.0 24 8.0 25 19.0 26 7.0 27 17.0 28 11.0 29 30.0 30 44.0 31 64.0 32 75.0 33 104.0 34 150.0 35 299.0 36 718.0 37 2422.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.40174448435095 17.008722421754747 12.647511544381734 36.942021549512575 2 18.316582914572866 19.22110552763819 35.82914572864321 26.633165829145728 3 18.775 23.7 28.325 29.2 4 20.825 29.475 25.1 24.6 5 20.974999999999998 33.425 25.8 19.8 6 17.9 34.8 27.224999999999998 20.075000000000003 7 14.174999999999999 24.025 43.575 18.224999999999998 8 17.1 25.650000000000002 29.95 27.3 9 15.45 25.95 33.525 25.074999999999996 10-14 18.465 30.64 27.67 23.225 15-19 18.965 30.104999999999997 28.15 22.78 20-24 18.93 29.794999999999998 28.48 22.795 25-29 19.185 29.505 28.52 22.79 30-34 19.595000000000002 29.220000000000002 28.275 22.91 35-39 19.45 29.49 27.794999999999998 23.265 40-44 19.55 29.535 27.74 23.175 45-49 19.139999999999997 29.4 27.77 23.69 50-54 19.895 29.15 27.55 23.405 55-59 19.645000000000003 29.45 27.48 23.425 60-64 19.36 29.555 28.050000000000004 23.035 65-69 20.14 28.24 27.894999999999996 23.724999999999998 70-74 19.835 28.705000000000002 28.349999999999998 23.11 75-79 20.195 28.285 27.83 23.69 80-84 20.06 28.58 27.665 23.695 85-89 20.075000000000003 28.804999999999996 27.925 23.195 90-94 20.06 28.79 27.639999999999997 23.51 95-99 19.96 28.884999999999998 28.18 22.975 100-104 20.365 28.07 28.475 23.09 105-109 20.21 27.83 27.944999999999997 24.015 110-114 20.349999999999998 28.58 27.99 23.080000000000002 115-119 20.29 28.565 28.050000000000004 23.095 120-124 19.939999999999998 28.645 27.605 23.810000000000002 125-129 20.745 28.754999999999995 27.279999999999998 23.22 130-134 20.405 28.895 27.500000000000004 23.200000000000003 135-139 20.605 28.18 27.839999999999996 23.375 140-144 20.125 28.4 27.689999999999998 23.785 145-149 21.029999999999998 28.175 27.105 23.69 150-151 21.175 28.1625 27.0125 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 4.0 25 6.5 26 7.0 27 12.0 28 15.5 29 22.5 30 30.0 31 35.5 32 46.5 33 63.5 34 74.5 35 94.5 36 125.0 37 150.5 38 153.0 39 159.5 40 192.0 41 216.5 42 238.0 43 265.0 44 269.5 45 255.0 46 265.0 47 245.5 48 209.5 49 179.0 50 140.5 51 121.0 52 100.5 53 80.5 54 61.0 55 45.0 56 34.0 57 20.0 58 12.0 59 10.0 60 8.5 61 6.0 62 3.5 63 2.5 64 1.5 65 1.0 66 2.0 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.8625 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.3125 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTGAC 10 0.0068343505 144.975 145 >>END_MODULE SRR7172646 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0085 34.0 33.0 34.0 32.0 34.0 2 33.019 34.0 33.0 34.0 32.0 34.0 3 33.00375 34.0 33.0 34.0 32.0 34.0 4 32.9545 34.0 33.0 34.0 32.0 34.0 5 32.95075 34.0 33.0 34.0 32.0 34.0 6 37.003 38.0 38.0 38.0 37.0 38.0 7 37.03475 38.0 38.0 38.0 37.0 38.0 8 37.00625 38.0 38.0 38.0 37.0 38.0 9 36.88525 38.0 38.0 38.0 37.0 38.0 10-14 36.95985 38.0 38.0 38.0 37.0 38.0 15-19 36.96745 38.0 38.0 38.0 37.0 38.0 20-24 36.9321 38.0 38.0 38.0 37.0 38.0 25-29 36.66465 38.0 38.0 38.0 36.6 38.0 30-34 36.05855 38.0 38.0 38.0 35.2 38.0 35-39 36.371750000000006 38.0 38.0 38.0 35.4 38.0 40-44 36.77445 38.0 38.0 38.0 36.6 38.0 45-49 36.740100000000005 38.0 38.0 38.0 36.4 38.0 50-54 36.7544 38.0 38.0 38.0 36.2 38.0 55-59 36.6234 38.0 38.0 38.0 35.8 38.0 60-64 36.471450000000004 38.0 38.0 38.0 35.2 38.0 65-69 36.290499999999994 38.0 38.0 38.0 34.4 38.0 70-74 36.376149999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.349450000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.30885 38.0 38.0 38.0 34.6 38.0 85-89 36.19845 38.0 38.0 38.0 34.2 38.0 90-94 36.0683 38.0 38.0 38.0 34.0 38.0 95-99 35.96455 38.0 38.0 38.0 33.6 38.0 100-104 35.843900000000005 38.0 38.0 38.0 33.4 38.0 105-109 35.740050000000004 38.0 37.8 38.0 32.6 38.0 110-114 35.371050000000004 38.0 37.0 38.0 30.6 38.0 115-119 35.161950000000004 38.0 37.0 38.0 29.0 38.0 120-124 34.88165 38.0 36.0 38.0 27.8 38.0 125-129 34.63035 38.0 36.0 38.0 26.0 38.0 130-134 34.2943 38.0 35.6 38.0 24.6 38.0 135-139 33.568599999999996 38.0 33.4 38.0 19.8 38.0 140-144 32.923 38.0 33.0 38.0 14.2 38.0 145-149 31.793199999999995 38.0 32.2 38.0 10.6 38.0 150-151 26.662125 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 8.0 4 6.0 5 5.0 6 5.0 7 4.0 8 3.0 9 4.0 10 6.0 11 2.0 12 3.0 13 7.0 14 2.0 15 6.0 16 6.0 17 7.0 18 3.0 19 1.0 20 8.0 21 7.0 22 7.0 23 9.0 24 12.0 25 15.0 26 20.0 27 23.0 28 29.0 29 53.0 30 38.0 31 66.0 32 73.0 33 102.0 34 185.0 35 311.0 36 668.0 37 2280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.724999999999994 17.175 17.4 27.700000000000003 2 24.55 23.599999999999998 34.300000000000004 17.549999999999997 3 21.025 27.400000000000002 30.025000000000002 21.55 4 24.975 34.949999999999996 22.650000000000002 17.424999999999997 5 24.675 36.95 21.425 16.950000000000003 6 20.075000000000003 37.175000000000004 25.074999999999996 17.675 7 19.925 17.849999999999998 40.175 22.05 8 20.775 23.599999999999998 28.9 26.724999999999998 9 22.25 25.6 28.599999999999998 23.549999999999997 10-14 23.119999999999997 29.625 26.740000000000002 20.515 15-19 23.18 28.599999999999998 27.67 20.549999999999997 20-24 22.925 28.9 27.634999999999998 20.54 25-29 23.318250377073905 28.511814982403216 27.898441427853193 20.271493212669682 30-34 23.064746732026144 28.405841503267975 27.98202614379085 20.547385620915033 35-39 22.95148179936386 28.76760741152118 27.904276265966576 20.376634523148383 40-44 23.355 28.345 27.665 20.635 45-49 23.76 27.735 28.34 20.165 50-54 22.855 28.720000000000002 27.655 20.77 55-59 23.11 28.599999999999998 27.68 20.61 60-64 23.705000000000002 27.975 27.775 20.544999999999998 65-69 22.865 28.93 27.295 20.91 70-74 23.36 28.365000000000002 27.52 20.755000000000003 75-79 23.335 27.96 27.85 20.855 80-84 23.655 28.235 27.889999999999997 20.22 85-89 23.830000000000002 27.685 28.24 20.244999999999997 90-94 23.025000000000002 28.63 27.834999999999997 20.51 95-99 23.400000000000002 28.185 27.665 20.75 100-104 24.04 27.525 28.23 20.205000000000002 105-109 23.3 28.285 28.01 20.405 110-114 23.9 28.27 27.425 20.405 115-119 23.375 28.29 27.944999999999997 20.39 120-124 23.455000000000002 28.51 27.855 20.18 125-129 23.94 27.79 28.33 19.939999999999998 130-134 24.025 28.494999999999997 27.66 19.82 135-139 24.884999999999998 27.735 27.965 19.415 140-144 24.09 28.12 27.689999999999998 20.1 145-149 24.4 27.91 27.939999999999998 19.75 150-151 25.6125 28.1375 26.737499999999997 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 2.0 27 4.0 28 8.5 29 10.5 30 14.0 31 21.0 32 28.5 33 37.0 34 51.5 35 64.5 36 78.0 37 105.0 38 141.0 39 178.0 40 214.0 41 243.5 42 271.0 43 279.5 44 280.5 45 288.0 46 272.5 47 238.0 48 229.0 49 219.5 50 172.0 51 127.5 52 99.0 53 80.0 54 64.0 55 47.5 56 33.5 57 24.0 58 16.0 59 8.0 60 5.0 61 7.0 62 7.0 63 4.5 64 3.5 65 4.0 66 2.0 67 1.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.5499999999999999 30-34 2.08 35-39 0.9650000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra Read 633388 spots for SRR7172646.sra Written 633388 spots for SRR7172646.sra Read 633370 spots for SRR7172646.sra Written 633370 spots for SRR7172646.sra SRR ids: ['SRR7172646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9lqyl9k2 SRR7172646.sra spots: 12667418 blocks: [[1, 633370], [633371, 1266740], [1266741, 1900110], [1900111, 2533480], [2533481, 3166850], [3166851, 3800220], [3800221, 4433590], [4433591, 5066960], [5066961, 5700330], [5700331, 6333700], [6333701, 6967070], [6967071, 7600440], [7600441, 8233810], [8233811, 8867180], [8867181, 9500550], [9500551, 10133920], [10133921, 10767290], [10767291, 11400660], [11400661, 12034030], [12034031, 12667418]] SRR7172646 file size 4270871 SRR7172646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172646 SRR7172646_1.fastq SRR7172646_2.fastq Input file: SRR7172646_1.fastq Paired file: SRR7172646_2.fastq trimmed: SRR7172646-trimmed-pair1.fastq, SRR7172646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:50:54 2025 >> started Mon Feb 10 15:51:09 2025 >> done (15.176s) 12667418 read pairs processed; of these: 33162 ( 0.26%) short read pairs filtered out after trimming by size control 20314 ( 0.16%) empty read pairs filtered out after trimming by size control 12613942 (99.58%) read pairs available; of these: 5804627 (46.02%) trimmed read pairs available after processing 6809315 (53.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 9 0.00% 21 12 0.00% 22 11 0.00% 23 7 0.00% 24 12 0.00% 25 8 0.00% 26 17 0.00% 27 15 0.00% 28 10 0.00% 29 11 0.00% 30 8 0.00% 31 7 0.00% 32 5 0.00% 33 13 0.00% 34 4 0.00% 35 11 0.00% 36 6 0.00% 37 8 0.00% 38 7 0.00% 39 5 0.00% 40 13 0.00% 41 12 0.00% 42 4 0.00% 43 10 0.00% 44 13 0.00% 45 7 0.00% 46 15 0.00% 47 23 0.00% 48 18 0.00% 49 25 0.00% 50 17 0.00% 51 26 0.00% 52 33 0.00% 53 44 0.00% 54 32 0.00% 55 35 0.00% 56 41 0.00% 57 56 0.00% 58 64 0.00% 59 63 0.00% 60 74 0.00% 61 67 0.00% 62 73 0.00% 63 84 0.00% 64 101 0.00% 65 99 0.00% 66 95 0.00% 67 137 0.00% 68 142 0.00% 69 151 0.00% 70 188 0.00% 71 235 0.00% 72 242 0.00% 73 298 0.00% 74 322 0.00% 75 344 0.00% 76 429 0.00% 77 465 0.00% 78 507 0.00% 79 580 0.00% 80 699 0.01% 81 795 0.01% 82 992 0.01% 83 1185 0.01% 84 2912 0.02% 85 4111 0.03% 86 4317 0.03% 87 4570 0.04% 88 4661 0.04% 89 4467 0.04% 90 4403 0.03% 91 4402 0.03% 92 4520 0.04% 93 4563 0.04% 94 4654 0.04% 95 4958 0.04% 96 5232 0.04% 97 5651 0.04% 98 5975 0.05% 99 6354 0.05% 100 6824 0.05% 101 7300 0.06% 102 7856 0.06% 103 8645 0.07% 104 9259 0.07% 105 9860 0.08% 106 10278 0.08% 107 11215 0.09% 108 11793 0.09% 109 12479 0.10% 110 13405 0.11% 111 14057 0.11% 112 14896 0.12% 113 16056 0.13% 114 16917 0.13% 115 17752 0.14% 116 18750 0.15% 117 19393 0.15% 118 20359 0.16% 119 20906 0.17% 120 22005 0.17% 121 23490 0.19% 122 24500 0.19% 123 25738 0.20% 124 27063 0.21% 125 28303 0.22% 126 29434 0.23% 127 30749 0.24% 128 32023 0.25% 129 33857 0.27% 130 35367 0.28% 131 37376 0.30% 132 39382 0.31% 133 41143 0.33% 134 44190 0.35% 135 46550 0.37% 136 49062 0.39% 137 52458 0.42% 138 55288 0.44% 139 59479 0.47% 140 63928 0.51% 141 70481 0.56% 142 76931 0.61% 143 87186 0.69% 144 99804 0.79% 145 117000 0.93% 146 143157 1.13% 147 191482 1.52% 148 284228 2.25% 149 555139 4.40% 150 3025038 23.98% 151 6809315 53.98% 12613942 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=14.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=AACGAGGAAGCAGCCGCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=24 prefix-density=0.74 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=106.95 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.2 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7172646 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:52:03 Started mapping on | Feb 10 15:52:03 Finished on | Feb 10 15:53:40 Mapping speed, Million of reads per hour | 468.15 Number of input reads | 12613942 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11823618 Uniquely mapped reads % | 93.73% Average mapped length | 294.92 Number of splices: Total | 11164605 Number of splices: Annotated (sjdb) | 10942136 Number of splices: GT/AG | 10980743 Number of splices: GC/AG | 141133 Number of splices: AT/AC | 9726 Number of splices: Non-canonical | 33003 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328371 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 46764 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 496214 496214 496214 N_multimapping 328371 328371 328371 N_noFeature 310307 11704856 356443 N_ambiguous 135790 644 62797 UnstrandedReadsAssigned:11377521 PositiveStrandReadsAssigned:118118 NegativeStrandReadsAssigned:11404378 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172646-trimmed-pair1.fastq SRR7172646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,613,942 reads, 11,329,397 reads pseudoaligned [quant] estimated average fragment length: 237.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR7172646.ke.tsv 34699 SRR7172646.se.tsv 87100 total ==> SRR7172646.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.9 1580 61.5095 Potri.005G024800.1.v4.1 1035 798.901 406 35.2535 Potri.004G059700.1.v4.1 961 724.91 40 3.82776 Potri.007G009000.2.v4.1 1416 1179.9 0 0 Potri.003G141000.2.v4.1 2943 2706.9 416 10.6608 Potri.016G087400.1.v4.1 270 77.4712 871 779.914 Potri.015G069301.1.v4.1 564 330.76 0 0 Potri.010G195200.1.v4.1 1773 1536.9 657.904 29.6952 Potri.012G127500.1.v4.1 977 740.91 3809 356.627 ==> SRR7172646.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 697 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 178 SRR7172646 completed mapping pipeline successfully