Starting /dee2/code/volunteer_pipeline.sh SRR7172647 current disk space = 3058298007552 free memory = 1574834728 SRR7172647 SRAfilesize ca5870ef262179d17f5d7ff67a970444 SRR7172647.sra SRR7172647.sra file validated SRR7172647 is paired end SRR7172647 is conventional basespace SRR7172647 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.77975 18.0 18.0 32.0 18.0 33.0 2 26.518 27.0 25.0 31.0 18.0 33.0 3 28.94125 30.0 27.0 31.0 25.0 33.0 4 30.5655 31.0 29.0 33.0 27.0 33.0 5 31.536 33.0 32.0 33.0 30.0 33.0 6 36.46725 38.0 37.0 38.0 34.0 38.0 7 36.908 38.0 37.0 38.0 35.0 38.0 8 37.2425 38.0 38.0 38.0 36.0 38.0 9 37.4275 38.0 38.0 38.0 37.0 38.0 10-14 37.5501 38.0 38.0 38.0 37.6 38.0 15-19 37.5323 38.0 38.0 38.0 38.0 38.0 20-24 37.560500000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.5807 38.0 38.0 38.0 38.0 38.0 30-34 37.55525 38.0 38.0 38.0 38.0 38.0 35-39 37.50025000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.4225 38.0 38.0 38.0 37.8 38.0 45-49 37.44725 38.0 38.0 38.0 37.4 38.0 50-54 37.39155000000001 38.0 38.0 38.0 37.2 38.0 55-59 37.30499999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.28045 38.0 38.0 38.0 37.0 38.0 65-69 37.26135 38.0 38.0 38.0 36.8 38.0 70-74 37.226749999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.159749999999995 38.0 38.0 38.0 36.6 38.0 80-84 37.119600000000005 38.0 38.0 38.0 36.2 38.0 85-89 36.99034999999999 38.0 38.0 38.0 35.8 38.0 90-94 36.88805 38.0 38.0 38.0 35.8 38.0 95-99 36.846199999999996 38.0 38.0 38.0 35.8 38.0 100-104 36.771950000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.59780000000001 38.0 38.0 38.0 34.4 38.0 110-114 36.40500000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.4596 38.0 38.0 38.0 34.0 38.0 120-124 36.30309999999999 38.0 38.0 38.0 34.0 38.0 125-129 36.06465 38.0 37.4 38.0 33.0 38.0 130-134 35.414199999999994 38.0 36.2 38.0 29.4 38.0 135-139 35.402499999999996 38.0 36.0 38.0 30.6 38.0 140-144 35.25695 38.0 36.0 38.0 30.2 38.0 145-149 34.84930000000001 38.0 35.4 38.0 29.2 38.0 150-151 31.333875 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 1.0 24 7.0 25 9.0 26 14.0 27 10.0 28 15.0 29 23.0 30 33.0 31 56.0 32 67.0 33 95.0 34 142.0 35 286.0 36 677.0 37 2547.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.54808424257803 11.773661507231667 14.057345851306774 33.62090839888353 2 21.424987456096336 18.41445057701957 37.45609633718013 22.70446562970396 3 19.575 25.8 24.975 29.65 4 21.5 32.4 22.275 23.825 5 22.650000000000002 34.075 24.349999999999998 18.925 6 18.175 35.4 26.424999999999997 20.0 7 13.950000000000001 24.5 43.35 18.2 8 16.675 24.474999999999998 31.775 27.075 9 17.625 23.95 32.9 25.525 10-14 19.18 30.445 27.405 22.97 15-19 19.655 29.494999999999997 27.595 23.255 20-24 19.655 29.775000000000002 27.650000000000002 22.919999999999998 25-29 19.575 29.21 27.66 23.555 30-34 20.09 29.060000000000002 27.76 23.09 35-39 18.705 29.62 27.975 23.7 40-44 20.055 28.849999999999998 28.000000000000004 23.095 45-49 19.42 29.360000000000003 27.68 23.54 50-54 19.625 29.025000000000002 28.175 23.175 55-59 19.925 29.580000000000002 27.29 23.205000000000002 60-64 19.93 28.675 28.095 23.3 65-69 20.25 29.035 27.43 23.285 70-74 20.02 28.694999999999997 27.735 23.549999999999997 75-79 20.105 28.535 27.71 23.65 80-84 19.625 29.28 27.265 23.830000000000002 85-89 19.900000000000002 28.715000000000003 27.655 23.73 90-94 20.32 28.265 27.165 24.25 95-99 20.349999999999998 27.62 28.115000000000002 23.915 100-104 19.84 28.555000000000003 27.750000000000004 23.855 105-109 19.96 28.494999999999997 27.71 23.835 110-114 20.990000000000002 29.03 26.674999999999997 23.305 115-119 20.73 28.48 27.57 23.22 120-124 20.205000000000002 27.905 27.595 24.295 125-129 20.755000000000003 28.985 26.950000000000003 23.31 130-134 20.775 28.54 27.265 23.419999999999998 135-139 20.775 28.804999999999996 26.740000000000002 23.68 140-144 21.105 28.410000000000004 26.52 23.965 145-149 20.990000000000002 28.29 26.810000000000002 23.91 150-151 21.15 28.812500000000004 26.5 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 2.0 20 0.5 21 0.5 22 1.5 23 2.5 24 5.0 25 5.0 26 7.5 27 12.0 28 14.0 29 16.5 30 23.5 31 33.0 32 41.0 33 50.5 34 66.5 35 82.0 36 99.0 37 108.0 38 120.5 39 164.5 40 202.5 41 231.5 42 253.0 43 269.5 44 277.5 45 271.0 46 250.5 47 237.0 48 232.5 49 203.0 50 161.5 51 130.0 52 114.0 53 91.5 54 59.5 55 44.5 56 33.5 57 20.0 58 18.5 59 14.5 60 7.0 61 4.5 62 4.5 63 2.5 64 1.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.6624999999999996 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.6 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 8.225 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCATT 10 0.006830828 145.0 9 AGCTTCA 10 0.006830828 145.0 145 CTGCTCC 10 0.006830828 145.0 8 AACAAAA 40 0.005621335 54.375 6 >>END_MODULE SRR7172647 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0815 34.0 33.0 34.0 32.0 34.0 2 33.1545 34.0 33.0 34.0 33.0 34.0 3 33.156 34.0 33.0 34.0 33.0 34.0 4 33.1615 34.0 33.0 34.0 33.0 34.0 5 33.11275 34.0 33.0 34.0 33.0 34.0 6 37.29075 38.0 38.0 38.0 37.0 38.0 7 37.30525 38.0 38.0 38.0 37.0 38.0 8 37.291 38.0 38.0 38.0 37.0 38.0 9 37.26925 38.0 38.0 38.0 37.0 38.0 10-14 37.15185 38.0 38.0 38.0 37.0 38.0 15-19 37.2304 38.0 38.0 38.0 37.8 38.0 20-24 37.1811 38.0 38.0 38.0 37.8 38.0 25-29 36.9984 38.0 38.0 38.0 37.0 38.0 30-34 36.694399999999995 38.0 38.0 38.0 36.8 38.0 35-39 36.772099999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.02075000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.051249999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.9995 38.0 38.0 38.0 36.8 38.0 55-59 36.960699999999996 38.0 38.0 38.0 36.8 38.0 60-64 36.8039 38.0 38.0 38.0 36.2 38.0 65-69 36.67785 38.0 38.0 38.0 35.8 38.0 70-74 36.67905 38.0 38.0 38.0 36.0 38.0 75-79 36.5613 38.0 38.0 38.0 35.0 38.0 80-84 36.5866 38.0 38.0 38.0 35.4 38.0 85-89 36.51885 38.0 38.0 38.0 34.8 38.0 90-94 36.450450000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.408249999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.317699999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.2065 38.0 38.0 38.0 34.0 38.0 110-114 36.09325 38.0 38.0 38.0 33.8 38.0 115-119 35.810500000000005 38.0 37.4 38.0 32.6 38.0 120-124 35.64455 38.0 37.0 38.0 32.0 38.0 125-129 35.3096 38.0 36.0 38.0 30.4 38.0 130-134 34.843 38.0 35.4 38.0 27.8 38.0 135-139 34.4781 38.0 35.0 38.0 26.4 38.0 140-144 33.98845 38.0 33.6 38.0 23.6 38.0 145-149 32.8588 38.0 33.0 38.0 14.8 38.0 150-151 28.248375000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 10.0 4 4.0 5 2.0 6 0.0 7 2.0 8 2.0 9 1.0 10 5.0 11 0.0 12 1.0 13 1.0 14 4.0 15 4.0 16 2.0 17 0.0 18 3.0 19 7.0 20 6.0 21 4.0 22 9.0 23 5.0 24 11.0 25 8.0 26 18.0 27 19.0 28 29.0 29 33.0 30 44.0 31 53.0 32 67.0 33 94.0 34 148.0 35 278.0 36 623.0 37 2494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0 14.975 19.55 29.475 2 23.05 22.925 35.5 18.525 3 21.925 26.950000000000003 29.65 21.475 4 24.349999999999998 33.925 21.5 20.225 5 23.549999999999997 36.325 22.075 18.05 6 18.825 36.675000000000004 25.6 18.9 7 19.7 16.400000000000002 42.325 21.575 8 21.825 22.425 30.3 25.45 9 23.275000000000002 24.4 29.15 23.175 10-14 23.35 28.999999999999996 26.085 21.565 15-19 23.405 27.935 27.87 20.79 20-24 22.884999999999998 29.2 27.27 20.645 25-29 23.478391657475186 28.57715832748421 27.288679434473078 20.65577058056753 30-34 22.989320240927267 28.268461811003693 28.217846839095007 20.524371108974034 35-39 23.31155778894472 28.376884422110553 27.768844221105525 20.542713567839197 40-44 23.185 27.76 27.839999999999996 21.215 45-49 23.925 27.715 27.839999999999996 20.52 50-54 23.18 28.075 27.750000000000004 20.995 55-59 23.765 27.634999999999998 27.73 20.87 60-64 23.615 27.785 28.075 20.525 65-69 23.445 27.715 27.894999999999996 20.945 70-74 23.855 27.884999999999998 27.495000000000005 20.765 75-79 23.905 27.66 28.060000000000002 20.375 80-84 23.685000000000002 27.755000000000003 27.839999999999996 20.72 85-89 23.44 27.87 28.515 20.175 90-94 24.07 28.084999999999997 27.589999999999996 20.255000000000003 95-99 23.549999999999997 28.315 28.050000000000004 20.085 100-104 24.205 27.389999999999997 28.255000000000003 20.150000000000002 105-109 23.830000000000002 27.415 28.585 20.169999999999998 110-114 24.165 27.665 28.110000000000003 20.06 115-119 23.285 28.335 27.944999999999997 20.435 120-124 23.78 27.6 28.315 20.305 125-129 25.005 27.395000000000003 28.22 19.38 130-134 24.740000000000002 28.235 27.52 19.505 135-139 25.095 28.09 27.91 18.905 140-144 24.7 28.335 27.794999999999998 19.17 145-149 25.650000000000002 27.139999999999997 28.155 19.055 150-151 26.650000000000002 26.987499999999997 27.700000000000003 18.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 1.0 25 2.0 26 2.0 27 4.0 28 6.0 29 9.0 30 13.5 31 14.0 32 23.5 33 32.0 34 39.0 35 48.5 36 59.5 37 90.5 38 134.5 39 169.5 40 196.0 41 214.0 42 244.0 43 279.0 44 308.0 45 312.0 46 304.5 47 290.5 48 242.5 49 206.5 50 181.5 51 148.0 52 113.0 53 88.0 54 64.5 55 45.5 56 32.0 57 22.0 58 13.5 59 8.5 60 7.5 61 5.5 62 5.0 63 3.5 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.27 30-34 1.2149999999999999 35-39 0.5 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.65 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.675000000000001 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 6.050000000000001 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646489 spots for SRR7172647.sra Written 646489 spots for SRR7172647.sra Read 646508 spots for SRR7172647.sra Written 646508 spots for SRR7172647.sra SRR ids: ['SRR7172647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7hsyj4zt SRR7172647.sra spots: 12929799 blocks: [[1, 646489], [646490, 1292978], [1292979, 1939467], [1939468, 2585956], [2585957, 3232445], [3232446, 3878934], [3878935, 4525423], [4525424, 5171912], [5171913, 5818401], [5818402, 6464890], [6464891, 7111379], [7111380, 7757868], [7757869, 8404357], [8404358, 9050846], [9050847, 9697335], [9697336, 10343824], [10343825, 10990313], [10990314, 11636802], [11636803, 12283291], [12283292, 12929799]] SRR7172647 file size 4359784 SRR7172647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172647 SRR7172647_1.fastq SRR7172647_2.fastq Input file: SRR7172647_1.fastq Paired file: SRR7172647_2.fastq trimmed: SRR7172647-trimmed-pair1.fastq, SRR7172647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:52:54 2025 >> started Mon Feb 10 16:53:08 2025 >> done (14.147s) 12929799 read pairs processed; of these: 21797 ( 0.17%) short read pairs filtered out after trimming by size control 14991 ( 0.12%) empty read pairs filtered out after trimming by size control 12893011 (99.72%) read pairs available; of these: 5535436 (42.93%) trimmed read pairs available after processing 7357575 (57.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 0 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 2 0.00% 33 3 0.00% 34 5 0.00% 35 4 0.00% 36 1 0.00% 37 1 0.00% 38 8 0.00% 39 5 0.00% 40 0 0.00% 41 3 0.00% 42 10 0.00% 43 6 0.00% 44 6 0.00% 45 12 0.00% 46 14 0.00% 47 10 0.00% 48 13 0.00% 49 17 0.00% 50 9 0.00% 51 34 0.00% 52 16 0.00% 53 25 0.00% 54 20 0.00% 55 47 0.00% 56 33 0.00% 57 48 0.00% 58 54 0.00% 59 81 0.00% 60 85 0.00% 61 98 0.00% 62 107 0.00% 63 120 0.00% 64 134 0.00% 65 158 0.00% 66 174 0.00% 67 199 0.00% 68 240 0.00% 69 290 0.00% 70 289 0.00% 71 408 0.00% 72 448 0.00% 73 495 0.00% 74 567 0.00% 75 648 0.01% 76 849 0.01% 77 931 0.01% 78 1012 0.01% 79 1110 0.01% 80 1392 0.01% 81 1500 0.01% 82 1799 0.01% 83 2070 0.02% 84 3331 0.03% 85 4322 0.03% 86 4473 0.03% 87 5122 0.04% 88 5404 0.04% 89 5626 0.04% 90 5944 0.05% 91 6159 0.05% 92 6720 0.05% 93 7237 0.06% 94 8125 0.06% 95 8511 0.07% 96 9278 0.07% 97 9996 0.08% 98 10745 0.08% 99 11363 0.09% 100 12445 0.10% 101 13026 0.10% 102 14234 0.11% 103 15024 0.12% 104 16257 0.13% 105 17297 0.13% 106 18252 0.14% 107 19301 0.15% 108 20595 0.16% 109 21496 0.17% 110 22666 0.18% 111 24250 0.19% 112 25095 0.19% 113 26640 0.21% 114 27528 0.21% 115 29715 0.23% 116 30364 0.24% 117 32179 0.25% 118 32855 0.25% 119 34149 0.26% 120 35477 0.28% 121 37198 0.29% 122 38520 0.30% 123 39991 0.31% 124 41718 0.32% 125 42883 0.33% 126 45229 0.35% 127 46358 0.36% 128 47109 0.37% 129 49204 0.38% 130 50856 0.39% 131 52553 0.41% 132 54551 0.42% 133 56427 0.44% 134 58303 0.45% 135 60380 0.47% 136 62635 0.49% 137 64836 0.50% 138 67308 0.52% 139 70424 0.55% 140 73970 0.57% 141 78601 0.61% 142 83952 0.65% 143 89755 0.70% 144 99091 0.77% 145 111253 0.86% 146 129559 1.00% 147 164014 1.27% 148 228502 1.77% 149 429618 3.33% 150 2443784 18.95% 151 7357575 57.07% 12893011 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=32 prefix-density=0.58 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.17 sequence-density-rank=14 fanout-score=29.36 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=8.9 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=28 prefix-density=0.66 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=27 fanout-score=20.15 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172647 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:53:55 Started mapping on | Feb 10 16:53:55 Finished on | Feb 10 16:55:18 Mapping speed, Million of reads per hour | 559.21 Number of input reads | 12893011 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12224498 Uniquely mapped reads % | 94.81% Average mapped length | 292.67 Number of splices: Total | 11489430 Number of splices: Annotated (sjdb) | 11266306 Number of splices: GT/AG | 11299078 Number of splices: GC/AG | 145364 Number of splices: AT/AC | 9950 Number of splices: Non-canonical | 35038 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373195 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 50997 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 315040 315040 315040 N_multimapping 373195 373195 373195 N_noFeature 283478 12085515 337498 N_ambiguous 148836 657 63714 UnstrandedReadsAssigned:11792184 PositiveStrandReadsAssigned:138326 NegativeStrandReadsAssigned:11823286 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172647-trimmed-pair1.fastq SRR7172647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,893,011 reads, 11,765,124 reads pseudoaligned [quant] estimated average fragment length: 215.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7172647.ke.tsv 34699 SRR7172647.se.tsv 87100 total ==> SRR7172647.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.36 1033 40.5938 Potri.005G024800.1.v4.1 1035 820.355 499 43.1062 Potri.004G059700.1.v4.1 961 746.361 67 6.36161 Potri.007G009000.2.v4.1 1416 1201.36 0 0 Potri.003G141000.2.v4.1 2943 2728.36 511 13.2727 Potri.016G087400.1.v4.1 270 87.1228 1153 937.86 Potri.015G069301.1.v4.1 564 350.84 0 0 Potri.010G195200.1.v4.1 1773 1558.36 337 15.3251 Potri.012G127500.1.v4.1 977 762.361 2312 214.916 ==> SRR7172647.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 856 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 321 SRR7172647 completed mapping pipeline successfully