Starting /dee2/code/volunteer_pipeline.sh SRR7172648 current disk space = 3058793041920 free memory = 1393048584 SRR7172648 SRAfilesize b4f7529490c98eb8aa84723e5ff66eb1 SRR7172648.sra SRR7172648.sra file validated SRR7172648 is paired end SRR7172648 is conventional basespace SRR7172648 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172648_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.29425 32.0 25.0 33.0 18.0 33.0 2 31.3435 33.0 31.0 33.0 27.0 34.0 3 31.46775 33.0 32.0 33.0 27.0 34.0 4 32.41175 33.0 33.0 33.0 32.0 34.0 5 32.865 33.0 33.0 34.0 32.0 34.0 6 36.97425 38.0 37.0 38.0 35.0 38.0 7 37.442 38.0 38.0 38.0 37.0 38.0 8 37.56775 38.0 38.0 38.0 38.0 38.0 9 37.6425 38.0 38.0 38.0 38.0 38.0 10-14 37.64525 38.0 38.0 38.0 38.0 38.0 15-19 37.5881 38.0 38.0 38.0 38.0 38.0 20-24 37.515249999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.490899999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5132 38.0 38.0 38.0 38.0 38.0 35-39 37.47105 38.0 38.0 38.0 38.0 38.0 40-44 37.3939 38.0 38.0 38.0 38.0 38.0 45-49 37.37015 38.0 38.0 38.0 38.0 38.0 50-54 37.3289 38.0 38.0 38.0 37.8 38.0 55-59 37.1949 38.0 38.0 38.0 37.0 38.0 60-64 37.181 38.0 38.0 38.0 37.0 38.0 65-69 37.12185000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.12705 38.0 38.0 38.0 36.6 38.0 75-79 37.0587 38.0 38.0 38.0 36.6 38.0 80-84 36.9622 38.0 38.0 38.0 36.2 38.0 85-89 36.747 38.0 38.0 38.0 35.8 38.0 90-94 36.749249999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.83755000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.644400000000005 38.0 38.0 38.0 35.2 38.0 105-109 36.43535 38.0 38.0 38.0 34.6 38.0 110-114 36.30355 38.0 38.0 38.0 34.0 38.0 115-119 36.256550000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.160000000000004 38.0 38.0 38.0 34.0 38.0 125-129 35.8327 38.0 37.4 38.0 33.0 38.0 130-134 35.507949999999994 38.0 36.8 38.0 31.6 38.0 135-139 35.22005 38.0 36.0 38.0 30.0 38.0 140-144 35.199799999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.83805 38.0 36.0 38.0 29.2 38.0 150-151 32.078125 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 3.0 11 1.0 12 1.0 13 2.0 14 2.0 15 5.0 16 3.0 17 2.0 18 3.0 19 7.0 20 3.0 21 4.0 22 5.0 23 10.0 24 7.0 25 8.0 26 11.0 27 15.0 28 16.0 29 27.0 30 37.0 31 35.0 32 55.0 33 72.0 34 135.0 35 177.0 36 490.0 37 2859.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.05655592188689 13.213289373573422 13.720517372558966 34.00963733198073 2 21.81360201511335 17.506297229219143 35.66750629722922 25.012594458438286 3 18.925 24.05 26.575 30.45 4 21.75 29.549999999999997 24.525 24.175 5 21.575 32.05 26.674999999999997 19.7 6 18.175 33.6 27.725 20.5 7 13.65 25.55 42.725 18.075 8 17.125 25.324999999999996 31.85 25.7 9 16.55 26.25 33.825 23.375 10-14 18.92 31.05 28.12 21.91 15-19 19.139999999999997 29.94 28.235 22.685 20-24 18.985 29.81 28.4 22.805 25-29 18.975 29.94 28.17 22.915 30-34 18.73 29.515 28.895 22.86 35-39 19.759999999999998 29.15 28.18 22.91 40-44 19.705000000000002 29.42 28.139999999999997 22.735 45-49 19.54 29.244999999999997 27.785 23.43 50-54 19.314999999999998 29.945 27.950000000000003 22.79 55-59 20.29 28.965000000000003 27.96 22.785 60-64 19.105 29.475 27.894999999999996 23.525 65-69 19.415 29.23 27.405 23.95 70-74 19.24 29.299999999999997 27.975 23.485 75-79 19.29 28.965000000000003 27.805000000000003 23.94 80-84 19.775000000000002 28.87 27.889999999999997 23.465 85-89 20.0 28.055000000000003 28.389999999999997 23.555 90-94 19.875 28.34 27.805000000000003 23.98 95-99 19.805 28.63 28.265 23.3 100-104 19.865 28.549999999999997 28.000000000000004 23.585 105-109 20.01 28.189999999999998 28.005000000000003 23.794999999999998 110-114 20.29 27.905 28.744999999999997 23.06 115-119 20.135 28.804999999999996 27.38 23.68 120-124 20.380000000000003 27.634999999999998 28.225 23.76 125-129 20.505000000000003 27.96 28.065 23.47 130-134 20.28 28.15 28.09 23.48 135-139 20.345 28.365000000000002 27.76 23.53 140-144 20.66 28.744999999999997 27.57 23.025000000000002 145-149 21.38 28.744999999999997 26.31 23.565 150-151 20.837500000000002 29.3375 25.912499999999998 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 1.5 11 1.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 3.0 18 3.0 19 2.0 20 2.0 21 1.5 22 3.5 23 6.5 24 5.5 25 4.0 26 5.0 27 11.5 28 15.0 29 22.0 30 29.0 31 42.5 32 64.0 33 69.5 34 85.5 35 107.0 36 118.0 37 142.5 38 152.0 39 170.0 40 208.5 41 203.0 42 221.0 43 263.5 44 250.0 45 219.5 46 226.0 47 229.0 48 220.5 49 195.5 50 156.5 51 135.0 52 100.0 53 68.0 54 62.0 55 48.0 56 33.5 57 26.0 58 16.0 59 12.5 60 8.0 61 6.5 62 5.0 63 3.0 64 2.0 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98913318170331 97.925 2 0.960323477381855 1.9 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.9875 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATC 10 0.006832588 144.9875 145 >>END_MODULE SRR7172648 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172648_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01925 34.0 33.0 34.0 32.0 34.0 2 33.06075 34.0 33.0 34.0 33.0 34.0 3 33.04225 34.0 33.0 34.0 33.0 34.0 4 33.04225 34.0 33.0 34.0 33.0 34.0 5 32.9635 34.0 33.0 34.0 33.0 34.0 6 37.02675 38.0 38.0 38.0 37.0 38.0 7 37.09525 38.0 38.0 38.0 37.0 38.0 8 37.104 38.0 38.0 38.0 38.0 38.0 9 37.04125 38.0 38.0 38.0 38.0 38.0 10-14 37.01705 38.0 38.0 38.0 37.4 38.0 15-19 36.98485000000001 38.0 38.0 38.0 37.4 38.0 20-24 36.9702 38.0 38.0 38.0 37.4 38.0 25-29 36.7943 38.0 38.0 38.0 37.0 38.0 30-34 36.298 38.0 38.0 38.0 36.4 38.0 35-39 36.52615 38.0 38.0 38.0 36.4 38.0 40-44 36.746950000000005 38.0 38.0 38.0 37.0 38.0 45-49 36.7339 38.0 38.0 38.0 37.0 38.0 50-54 36.71145 38.0 38.0 38.0 37.0 38.0 55-59 36.64625 38.0 38.0 38.0 36.4 38.0 60-64 36.48345 38.0 38.0 38.0 35.8 38.0 65-69 36.4759 38.0 38.0 38.0 36.0 38.0 70-74 36.447050000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.3926 38.0 38.0 38.0 36.0 38.0 80-84 36.372550000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.2839 38.0 38.0 38.0 35.0 38.0 90-94 36.1885 38.0 38.0 38.0 34.8 38.0 95-99 36.1086 38.0 38.0 38.0 34.4 38.0 100-104 36.041399999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.955 38.0 38.0 38.0 34.0 38.0 110-114 35.850899999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.61495 38.0 38.0 38.0 33.0 38.0 120-124 35.357150000000004 38.0 37.6 38.0 30.6 38.0 125-129 35.176 38.0 37.0 38.0 30.6 38.0 130-134 34.9125 38.0 36.4 38.0 28.6 38.0 135-139 34.638 38.0 36.0 38.0 27.6 38.0 140-144 34.23265 38.0 35.6 38.0 25.6 38.0 145-149 33.7589 38.0 34.6 38.0 21.4 38.0 150-151 29.308875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 8.0 4 8.0 5 7.0 6 8.0 7 7.0 8 5.0 9 3.0 10 2.0 11 6.0 12 6.0 13 3.0 14 1.0 15 7.0 16 5.0 17 4.0 18 3.0 19 11.0 20 4.0 21 6.0 22 8.0 23 9.0 24 9.0 25 11.0 26 13.0 27 10.0 28 20.0 29 25.0 30 22.0 31 51.0 32 65.0 33 72.0 34 112.0 35 217.0 36 428.0 37 2804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.074999999999996 17.875 18.325 25.724999999999998 2 24.85 23.799999999999997 34.675 16.675 3 21.8 27.6 29.849999999999998 20.75 4 25.874999999999996 32.2 23.575 18.35 5 24.125 34.675 23.549999999999997 17.65 6 19.675 37.05 25.724999999999998 17.549999999999997 7 20.075000000000003 18.075 40.525 21.325 8 22.45 22.7 28.499999999999996 26.35 9 22.175 25.75 29.675 22.400000000000002 10-14 23.635 29.154999999999998 26.25 20.96 15-19 23.75 28.775000000000002 27.51 19.965 20-24 23.48 28.799999999999997 27.365000000000002 20.355 25-29 23.212404034321843 28.656731396457424 27.36715339455065 20.763711174670078 30-34 23.570014718570775 27.975435212911737 27.79779728975283 20.656752778764655 35-39 23.378453177678256 28.03804156393096 27.65561314346098 20.927892114929804 40-44 23.885 28.645 27.55 19.919999999999998 45-49 23.555 28.65 27.38 20.415 50-54 23.674999999999997 28.439999999999998 27.48 20.405 55-59 23.544999999999998 28.060000000000002 27.834999999999997 20.560000000000002 60-64 23.27 28.15 27.894999999999996 20.685000000000002 65-69 23.66 27.900000000000002 27.700000000000003 20.74 70-74 23.735 28.355000000000004 27.595 20.315 75-79 23.455000000000002 27.810000000000002 28.349999999999998 20.385 80-84 24.025 27.584999999999997 27.73 20.66 85-89 24.005000000000003 28.194999999999997 27.935 19.865 90-94 23.455000000000002 28.199999999999996 28.325 20.02 95-99 23.855 28.21 27.944999999999997 19.99 100-104 23.655 28.375 28.04 19.93 105-109 23.57 28.199999999999996 28.33 19.900000000000002 110-114 22.96 28.425 28.365000000000002 20.25 115-119 23.65 28.49 28.07 19.79 120-124 23.98 28.299999999999997 28.395 19.325 125-129 24.255 27.834999999999997 28.22 19.689999999999998 130-134 24.34 28.754999999999995 27.82 19.085 135-139 24.305 28.07 28.294999999999998 19.33 140-144 25.025 28.89 27.200000000000003 18.884999999999998 145-149 24.675 28.4 27.310000000000002 19.615 150-151 25.5625 28.512500000000003 27.275 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 0.5 23 2.0 24 3.0 25 4.0 26 4.0 27 3.5 28 3.5 29 7.5 30 15.0 31 22.5 32 29.0 33 34.5 34 44.0 35 58.5 36 68.5 37 101.0 38 139.0 39 166.0 40 194.0 41 218.5 42 249.5 43 280.0 44 304.0 45 310.0 46 294.0 47 258.5 48 226.5 49 199.0 50 165.0 51 143.0 52 116.5 53 84.0 54 63.0 55 44.5 56 32.5 57 30.5 58 23.5 59 13.0 60 7.0 61 6.0 62 6.0 63 2.0 64 2.0 65 3.0 66 2.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.35500000000000004 30-34 1.485 35-39 0.635 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86104783599089 97.65 2 1.037711971652746 2.0500000000000003 3 0.10124019235636549 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0375 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.2375 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCGT 20 0.0059652044 28.970001 140-144 >>END_MODULE Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513259 spots for SRR7172648.sra Written 513259 spots for SRR7172648.sra Read 513277 spots for SRR7172648.sra Written 513277 spots for SRR7172648.sra SRR ids: ['SRR7172648.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sqb8orxd SRR7172648.sra spots: 10265198 blocks: [[1, 513259], [513260, 1026518], [1026519, 1539777], [1539778, 2053036], [2053037, 2566295], [2566296, 3079554], [3079555, 3592813], [3592814, 4106072], [4106073, 4619331], [4619332, 5132590], [5132591, 5645849], [5645850, 6159108], [6159109, 6672367], [6672368, 7185626], [7185627, 7698885], [7698886, 8212144], [8212145, 8725403], [8725404, 9238662], [9238663, 9751921], [9751922, 10265198]] SRR7172648 file size 3456838 SRR7172648 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172648 SRR7172648_1.fastq SRR7172648_2.fastq Input file: SRR7172648_1.fastq Paired file: SRR7172648_2.fastq trimmed: SRR7172648-trimmed-pair1.fastq, SRR7172648-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:59:48 2025 >> started Mon Feb 10 11:00:05 2025 >> done (16.612s) 10265198 read pairs processed; of these: 33018 ( 0.32%) short read pairs filtered out after trimming by size control 23768 ( 0.23%) empty read pairs filtered out after trimming by size control 10208412 (99.45%) read pairs available; of these: 4418673 (43.28%) trimmed read pairs available after processing 5789739 (56.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 12 0.00% 21 12 0.00% 22 18 0.00% 23 20 0.00% 24 16 0.00% 25 17 0.00% 26 18 0.00% 27 18 0.00% 28 12 0.00% 29 9 0.00% 30 6 0.00% 31 10 0.00% 32 2 0.00% 33 8 0.00% 34 5 0.00% 35 5 0.00% 36 15 0.00% 37 6 0.00% 38 7 0.00% 39 16 0.00% 40 18 0.00% 41 8 0.00% 42 7 0.00% 43 16 0.00% 44 13 0.00% 45 14 0.00% 46 25 0.00% 47 25 0.00% 48 27 0.00% 49 31 0.00% 50 27 0.00% 51 38 0.00% 52 47 0.00% 53 43 0.00% 54 32 0.00% 55 50 0.00% 56 47 0.00% 57 60 0.00% 58 70 0.00% 59 76 0.00% 60 72 0.00% 61 79 0.00% 62 86 0.00% 63 104 0.00% 64 112 0.00% 65 137 0.00% 66 157 0.00% 67 157 0.00% 68 185 0.00% 69 215 0.00% 70 237 0.00% 71 257 0.00% 72 308 0.00% 73 389 0.00% 74 432 0.00% 75 487 0.00% 76 616 0.01% 77 769 0.01% 78 713 0.01% 79 756 0.01% 80 883 0.01% 81 1008 0.01% 82 1195 0.01% 83 1380 0.01% 84 3465 0.03% 85 4681 0.05% 86 5251 0.05% 87 6007 0.06% 88 5802 0.06% 89 5532 0.05% 90 5194 0.05% 91 5169 0.05% 92 5522 0.05% 93 5535 0.05% 94 5773 0.06% 95 5780 0.06% 96 6137 0.06% 97 6217 0.06% 98 6879 0.07% 99 7218 0.07% 100 7715 0.08% 101 8454 0.08% 102 9055 0.09% 103 9629 0.09% 104 10368 0.10% 105 11005 0.11% 106 11580 0.11% 107 12467 0.12% 108 12982 0.13% 109 13691 0.13% 110 14660 0.14% 111 15866 0.16% 112 16644 0.16% 113 17588 0.17% 114 19014 0.19% 115 20460 0.20% 116 21234 0.21% 117 21460 0.21% 118 22118 0.22% 119 22935 0.22% 120 23789 0.23% 121 24711 0.24% 122 25589 0.25% 123 26597 0.26% 124 28151 0.28% 125 28918 0.28% 126 30148 0.30% 127 31355 0.31% 128 31889 0.31% 129 33367 0.33% 130 34090 0.33% 131 35632 0.35% 132 37445 0.37% 133 38964 0.38% 134 40724 0.40% 135 42418 0.42% 136 43745 0.43% 137 45587 0.45% 138 47895 0.47% 139 49752 0.49% 140 52163 0.51% 141 55656 0.55% 142 59093 0.58% 143 64218 0.63% 144 70540 0.69% 145 80600 0.79% 146 95799 0.94% 147 121041 1.19% 148 173468 1.70% 149 400154 3.92% 150 2144434 21.01% 151 5789739 56.72% 10208412 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=32 prefix-density=0.72 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=52.16 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=TTTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=29 prefix-density=0.79 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=75.54 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=1.6 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172648 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:01:11 Started mapping on | Feb 10 11:01:11 Finished on | Feb 10 11:04:17 Mapping speed, Million of reads per hour | 197.58 Number of input reads | 10208412 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 8253653 Uniquely mapped reads % | 80.85% Average mapped length | 286.25 Number of splices: Total | 7422930 Number of splices: Annotated (sjdb) | 7268010 Number of splices: GT/AG | 7296502 Number of splices: GC/AG | 94315 Number of splices: AT/AC | 6349 Number of splices: Non-canonical | 25764 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243647 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 42731 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.27% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1736921 1736921 1736921 N_multimapping 243647 243647 243647 N_noFeature 190904 8156731 224459 N_ambiguous 161494 1260 97442 UnstrandedReadsAssigned:7901255 PositiveStrandReadsAssigned:95662 NegativeStrandReadsAssigned:7931752 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172648 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172648-trimmed-pair1.fastq SRR7172648-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,208,412 reads, 8,757,031 reads pseudoaligned [quant] estimated average fragment length: 213.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR7172648.ke.tsv 34699 SRR7172648.se.tsv 87100 total ==> SRR7172648.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.1 892 44.5121 Potri.005G024800.1.v4.1 1035 822.102 348 38.1301 Potri.004G059700.1.v4.1 961 748.107 43 5.1775 Potri.007G009000.2.v4.1 1416 1203.1 0 0 Potri.003G141000.2.v4.1 2943 2730.1 366 12.0758 Potri.016G087400.1.v4.1 270 88.2284 987 1007.68 Potri.015G069301.1.v4.1 564 352.48 0 0 Potri.010G195200.1.v4.1 1773 1560.1 695 40.1279 Potri.012G127500.1.v4.1 977 764.102 3265 384.899 ==> SRR7172648.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 653 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 110 SRR7172648 completed mapping pipeline successfully