Starting /dee2/code/volunteer_pipeline.sh SRR7172649 current disk space = 3058755588096 free memory = 1579720168 SRR7172649 SRAfilesize 170d510ae1cfe0ad8e7b2eb9129b8132 SRR7172649.sra SRR7172649.sra file validated SRR7172649 is paired end SRR7172649 is conventional basespace SRR7172649 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172649_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.21425 27.0 18.0 32.0 18.0 33.0 2 28.1995 29.0 27.0 33.0 18.0 33.0 3 29.9685 31.0 29.0 33.0 25.0 33.0 4 31.3705 33.0 31.0 33.0 29.0 33.0 5 32.12675 33.0 33.0 33.0 30.0 34.0 6 37.0165 38.0 37.0 38.0 36.0 38.0 7 37.33425 38.0 38.0 38.0 37.0 38.0 8 37.38325 38.0 38.0 38.0 37.0 38.0 9 37.57475 38.0 38.0 38.0 38.0 38.0 10-14 37.582499999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5269 38.0 38.0 38.0 38.0 38.0 20-24 37.45775 38.0 38.0 38.0 37.8 38.0 25-29 37.4575 38.0 38.0 38.0 38.0 38.0 30-34 37.410900000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.4129 38.0 38.0 38.0 37.6 38.0 40-44 37.311899999999994 38.0 38.0 38.0 37.2 38.0 45-49 37.1409 38.0 38.0 38.0 36.8 38.0 50-54 37.25775 38.0 38.0 38.0 37.0 38.0 55-59 37.1074 38.0 38.0 38.0 36.8 38.0 60-64 37.09310000000001 38.0 38.0 38.0 36.8 38.0 65-69 36.99065 38.0 38.0 38.0 36.2 38.0 70-74 36.986399999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.91015 38.0 38.0 38.0 36.0 38.0 80-84 36.795750000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.5757 38.0 38.0 38.0 34.6 38.0 90-94 36.61545 38.0 38.0 38.0 35.0 38.0 95-99 36.576649999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.5226 38.0 38.0 38.0 34.8 38.0 105-109 36.1659 38.0 38.0 38.0 33.6 38.0 110-114 36.09830000000001 38.0 38.0 38.0 33.6 38.0 115-119 36.0418 38.0 37.6 38.0 33.4 38.0 120-124 36.0131 38.0 37.4 38.0 33.4 38.0 125-129 35.68395 38.0 36.6 38.0 31.8 38.0 130-134 35.240300000000005 38.0 36.0 38.0 30.0 38.0 135-139 34.8442 38.0 35.8 38.0 27.8 38.0 140-144 34.78335 38.0 35.6 38.0 28.0 38.0 145-149 34.5027 38.0 35.0 38.0 27.8 38.0 150-151 30.77 35.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 4.0 8 2.0 9 0.0 10 2.0 11 0.0 12 2.0 13 3.0 14 2.0 15 1.0 16 2.0 17 1.0 18 3.0 19 6.0 20 4.0 21 4.0 22 6.0 23 6.0 24 8.0 25 9.0 26 17.0 27 13.0 28 29.0 29 27.0 30 39.0 31 42.0 32 51.0 33 108.0 34 152.0 35 287.0 36 662.0 37 2505.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.734015345268546 15.754475703324808 13.171355498721226 37.34015345268542 2 18.982880161127895 19.05840886203424 35.52366565961732 26.435045317220546 3 18.775 23.25 26.474999999999998 31.5 4 21.25 31.125000000000004 22.925 24.7 5 21.3 33.324999999999996 25.874999999999996 19.5 6 17.125 34.75 26.950000000000003 21.175 7 13.325000000000001 26.224999999999998 43.275000000000006 17.175 8 16.7 25.0 32.05 26.25 9 16.825000000000003 27.250000000000004 33.45 22.475 10-14 18.9 31.424999999999997 28.02 21.654999999999998 15-19 18.92 30.4 27.860000000000003 22.82 20-24 18.725 30.15 28.499999999999996 22.625 25-29 18.96 30.135 28.24 22.665 30-34 18.759999999999998 29.79 28.46 22.99 35-39 19.305 30.035 28.199999999999996 22.46 40-44 19.064999999999998 30.25 27.74 22.945 45-49 19.395 29.904999999999998 27.43 23.27 50-54 19.035 29.825000000000003 28.095 23.044999999999998 55-59 19.09 29.880000000000003 27.665 23.365 60-64 19.37 29.45 28.15 23.03 65-69 19.585 29.365000000000002 27.810000000000002 23.24 70-74 19.625 28.89 28.475 23.01 75-79 19.43 29.470000000000002 27.735 23.365 80-84 19.395 29.415000000000003 27.725 23.465 85-89 19.975 28.405 27.99 23.630000000000003 90-94 19.77 29.13 28.17 22.93 95-99 19.675 28.99 27.505000000000003 23.830000000000002 100-104 19.91 28.689999999999998 28.21 23.189999999999998 105-109 19.564999999999998 28.939999999999998 28.249999999999996 23.244999999999997 110-114 20.015 28.415000000000003 27.82 23.75 115-119 20.51 28.549999999999997 27.67 23.27 120-124 20.525 29.275000000000002 27.355 22.845 125-129 20.275000000000002 28.799999999999997 27.36 23.565 130-134 20.455000000000002 29.220000000000002 26.834999999999997 23.49 135-139 20.48 28.325 27.515 23.68 140-144 20.355 28.804999999999996 27.21 23.630000000000003 145-149 20.849999999999998 29.294999999999998 26.424999999999997 23.43 150-151 20.325 29.1875 25.8 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.5 16 2.0 17 2.0 18 2.0 19 1.0 20 1.5 21 3.0 22 2.5 23 2.5 24 2.0 25 7.5 26 13.0 27 16.0 28 21.0 29 28.0 30 35.5 31 36.0 32 49.5 33 74.5 34 88.5 35 105.0 36 127.0 37 131.5 38 153.0 39 193.5 40 199.5 41 217.5 42 251.5 43 256.5 44 256.5 45 263.0 46 257.0 47 235.5 48 207.5 49 167.5 50 127.0 51 112.5 52 93.0 53 61.5 54 46.0 55 37.5 56 31.0 57 17.0 58 11.5 59 12.0 60 7.0 61 8.0 62 7.0 63 3.5 64 2.0 65 1.5 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 3.0875000000000004 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.512499999999999 0.0 0.0 0.0 0.0 130-131 5.0625 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCC 10 0.0068343505 144.975 7 >>END_MODULE SRR7172649 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172649_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8905 34.0 33.0 34.0 32.0 34.0 2 32.86525 34.0 33.0 34.0 32.0 34.0 3 32.886 34.0 33.0 34.0 32.0 34.0 4 32.86075 34.0 33.0 34.0 32.0 34.0 5 32.73875 34.0 33.0 34.0 32.0 34.0 6 36.73475 38.0 38.0 38.0 36.0 38.0 7 36.6915 38.0 38.0 38.0 36.0 38.0 8 36.7505 38.0 38.0 38.0 36.0 38.0 9 36.67225 38.0 38.0 38.0 36.0 38.0 10-14 36.6796 38.0 38.0 38.0 36.2 38.0 15-19 36.710750000000004 38.0 38.0 38.0 36.6 38.0 20-24 36.6528 38.0 38.0 38.0 37.0 38.0 25-29 36.407599999999995 38.0 38.0 38.0 35.8 38.0 30-34 35.8495 38.0 38.0 38.0 34.6 38.0 35-39 36.098400000000005 38.0 38.0 38.0 34.8 38.0 40-44 36.471799999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.46305 38.0 38.0 38.0 35.8 38.0 50-54 36.392849999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.303450000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.20345 38.0 38.0 38.0 34.8 38.0 65-69 36.045849999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.10645000000001 38.0 38.0 38.0 34.2 38.0 75-79 36.03724999999999 38.0 38.0 38.0 34.0 38.0 80-84 35.9845 38.0 38.0 38.0 34.0 38.0 85-89 35.85145 38.0 38.0 38.0 33.8 38.0 90-94 35.751 38.0 38.0 38.0 33.4 38.0 95-99 35.607150000000004 38.0 38.0 38.0 32.6 38.0 100-104 35.439499999999995 38.0 38.0 38.0 31.8 38.0 105-109 35.3594 38.0 37.8 38.0 31.0 38.0 110-114 35.0499 38.0 37.0 38.0 29.2 38.0 115-119 34.7384 38.0 36.6 38.0 27.6 38.0 120-124 34.58865000000001 38.0 36.2 38.0 26.8 38.0 125-129 34.453050000000005 38.0 36.0 38.0 25.4 38.0 130-134 34.10385 38.0 35.6 38.0 23.8 38.0 135-139 33.304050000000004 38.0 33.4 38.0 17.6 38.0 140-144 32.637600000000006 38.0 33.0 38.0 13.4 38.0 145-149 31.4399 38.0 31.8 38.0 8.0 38.0 150-151 26.288375000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 15.0 4 12.0 5 5.0 6 10.0 7 8.0 8 2.0 9 3.0 10 3.0 11 8.0 12 5.0 13 10.0 14 2.0 15 9.0 16 5.0 17 4.0 18 2.0 19 4.0 20 4.0 21 8.0 22 10.0 23 16.0 24 15.0 25 17.0 26 16.0 27 19.0 28 29.0 29 20.0 30 53.0 31 65.0 32 85.0 33 102.0 34 164.0 35 318.0 36 633.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.425000000000004 15.950000000000001 19.15 27.474999999999998 2 23.125 25.8 33.225 17.849999999999998 3 21.775 26.6 30.55 21.075 4 25.374999999999996 33.050000000000004 23.075000000000003 18.5 5 24.525 36.625 22.475 16.375 6 19.575 35.825 25.8 18.8 7 19.525000000000002 19.05 40.45 20.974999999999998 8 21.625 23.825 28.15 26.400000000000002 9 22.475 26.775 27.425 23.325000000000003 10-14 23.56 29.285 26.205000000000002 20.95 15-19 23.28 28.7 27.67 20.349999999999998 20-24 23.285 28.58 28.285 19.85 25-29 23.990152733118972 28.516881028938908 27.672829581993568 19.820136655948552 30-34 23.32279771615008 28.63478792822186 27.849714518760194 20.192699836867863 35-39 23.794390637610977 28.6773607748184 27.673527037933816 19.854721549636803 40-44 23.474999999999998 28.51 27.700000000000003 20.315 45-49 23.59 28.92 27.215 20.275000000000002 50-54 23.275000000000002 28.754999999999995 27.834999999999997 20.135 55-59 23.990000000000002 27.950000000000003 27.955000000000002 20.105 60-64 24.22 28.055000000000003 27.639999999999997 20.085 65-69 23.724999999999998 28.005000000000003 28.044999999999998 20.225 70-74 23.625 28.595 27.345000000000002 20.435 75-79 24.065 28.32 27.97 19.645000000000003 80-84 23.630000000000003 27.91 28.299999999999997 20.16 85-89 23.905 27.950000000000003 28.384999999999998 19.759999999999998 90-94 23.31 28.305000000000003 28.515 19.869999999999997 95-99 23.865 28.050000000000004 28.53 19.555 100-104 23.705000000000002 27.365000000000002 29.154999999999998 19.775000000000002 105-109 23.974999999999998 28.115000000000002 28.485 19.425 110-114 23.990000000000002 27.255000000000003 29.23 19.525000000000002 115-119 23.275000000000002 28.060000000000002 28.9 19.765 120-124 24.224999999999998 27.529999999999998 28.62 19.625 125-129 24.3 27.855 28.92 18.925 130-134 24.465 28.12 28.055000000000003 19.36 135-139 24.560000000000002 28.53 27.900000000000002 19.009999999999998 140-144 24.685000000000002 28.03 28.485 18.8 145-149 25.779999999999998 27.665 27.939999999999998 18.615000000000002 150-151 27.0875 28.4 26.887499999999996 17.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.5 17 2.0 18 2.0 19 1.5 20 1.0 21 1.5 22 1.5 23 2.0 24 4.0 25 4.5 26 5.0 27 5.5 28 7.5 29 11.0 30 16.0 31 18.0 32 20.0 33 28.0 34 42.0 35 54.5 36 75.5 37 107.5 38 136.5 39 172.0 40 209.5 41 220.0 42 267.5 43 317.5 44 316.5 45 312.5 46 283.0 47 241.5 48 225.0 49 204.0 50 169.5 51 133.0 52 96.0 53 78.5 54 59.5 55 37.5 56 24.0 57 16.0 58 12.5 59 12.5 60 10.5 61 9.5 62 6.5 63 1.5 64 2.5 65 2.5 66 1.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.48 30-34 1.92 35-39 0.88 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44570420760897 98.675 2 0.45351473922902497 0.8999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02519526329050139 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.6 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.637499999999999 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.925 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTC 10 0.0068803662 144.65 6 AGCAAGT 10 0.0068803662 144.65 5 >>END_MODULE Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra Read 649829 spots for SRR7172649.sra Written 649829 spots for SRR7172649.sra Read 649815 spots for SRR7172649.sra Written 649815 spots for SRR7172649.sra SRR ids: ['SRR7172649.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o4cdnr3o SRR7172649.sra spots: 12996314 blocks: [[1, 649815], [649816, 1299630], [1299631, 1949445], [1949446, 2599260], [2599261, 3249075], [3249076, 3898890], [3898891, 4548705], [4548706, 5198520], [5198521, 5848335], [5848336, 6498150], [6498151, 7147965], [7147966, 7797780], [7797781, 8447595], [8447596, 9097410], [9097411, 9747225], [9747226, 10397040], [10397041, 11046855], [11046856, 11696670], [11696671, 12346485], [12346486, 12996314]] SRR7172649 file size 4382323 SRR7172649 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172649 SRR7172649_1.fastq SRR7172649_2.fastq Input file: SRR7172649_1.fastq Paired file: SRR7172649_2.fastq trimmed: SRR7172649-trimmed-pair1.fastq, SRR7172649-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:14:59 2025 >> started Mon Feb 10 12:15:12 2025 >> done (13.386s) 12996314 read pairs processed; of these: 52526 ( 0.40%) short read pairs filtered out after trimming by size control 35320 ( 0.27%) empty read pairs filtered out after trimming by size control 12908468 (99.32%) read pairs available; of these: 6265831 (48.54%) trimmed read pairs available after processing 6642637 (51.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 11 0.00% 21 16 0.00% 22 22 0.00% 23 20 0.00% 24 19 0.00% 25 12 0.00% 26 11 0.00% 27 11 0.00% 28 18 0.00% 29 14 0.00% 30 14 0.00% 31 17 0.00% 32 10 0.00% 33 6 0.00% 34 8 0.00% 35 12 0.00% 36 8 0.00% 37 9 0.00% 38 9 0.00% 39 6 0.00% 40 13 0.00% 41 20 0.00% 42 20 0.00% 43 14 0.00% 44 21 0.00% 45 20 0.00% 46 36 0.00% 47 16 0.00% 48 26 0.00% 49 21 0.00% 50 26 0.00% 51 36 0.00% 52 38 0.00% 53 32 0.00% 54 49 0.00% 55 49 0.00% 56 68 0.00% 57 75 0.00% 58 71 0.00% 59 75 0.00% 60 93 0.00% 61 92 0.00% 62 84 0.00% 63 130 0.00% 64 126 0.00% 65 162 0.00% 66 165 0.00% 67 178 0.00% 68 222 0.00% 69 230 0.00% 70 293 0.00% 71 356 0.00% 72 374 0.00% 73 453 0.00% 74 504 0.00% 75 620 0.00% 76 862 0.01% 77 945 0.01% 78 837 0.01% 79 968 0.01% 80 1080 0.01% 81 1294 0.01% 82 1509 0.01% 83 1786 0.01% 84 4545 0.04% 85 6302 0.05% 86 6469 0.05% 87 6934 0.05% 88 6761 0.05% 89 6463 0.05% 90 6627 0.05% 91 6526 0.05% 92 6881 0.05% 93 7033 0.05% 94 7455 0.06% 95 7910 0.06% 96 8383 0.06% 97 8743 0.07% 98 9321 0.07% 99 10201 0.08% 100 10836 0.08% 101 11682 0.09% 102 12691 0.10% 103 13697 0.11% 104 14558 0.11% 105 15531 0.12% 106 16350 0.13% 107 17209 0.13% 108 18234 0.14% 109 19498 0.15% 110 20843 0.16% 111 21881 0.17% 112 23037 0.18% 113 24527 0.19% 114 26546 0.21% 115 27210 0.21% 116 28174 0.22% 117 29303 0.23% 118 30523 0.24% 119 31359 0.24% 120 32722 0.25% 121 33964 0.26% 122 36293 0.28% 123 38398 0.30% 124 39802 0.31% 125 41466 0.32% 126 42857 0.33% 127 44450 0.34% 128 45409 0.35% 129 47355 0.37% 130 48892 0.38% 131 51017 0.40% 132 52606 0.41% 133 55792 0.43% 134 59347 0.46% 135 61300 0.47% 136 64278 0.50% 137 66840 0.52% 138 71011 0.55% 139 73345 0.57% 140 78167 0.61% 141 83693 0.65% 142 91113 0.71% 143 100374 0.78% 144 112436 0.87% 145 129634 1.00% 146 153661 1.19% 147 198476 1.54% 148 287582 2.23% 149 542081 4.20% 150 2936876 22.75% 151 6642637 51.46% 12908468 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=38 prefix-density=0.46 prefix-fanout=2.2 sequence=TCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=195.78 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.9 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=32 prefix-density=0.91 prefix-fanout=2.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=23.68 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172649 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:15:59 Started mapping on | Feb 10 12:15:59 Finished on | Feb 10 12:17:45 Mapping speed, Million of reads per hour | 438.40 Number of input reads | 12908468 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11931132 Uniquely mapped reads % | 92.43% Average mapped length | 292.69 Number of splices: Total | 10656982 Number of splices: Annotated (sjdb) | 10433859 Number of splices: GT/AG | 10472470 Number of splices: GC/AG | 139588 Number of splices: AT/AC | 9031 Number of splices: Non-canonical | 35893 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366745 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 33057 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 658587 658587 658587 N_multimapping 366745 366745 366745 N_noFeature 330006 11787595 386553 N_ambiguous 148700 768 61335 UnstrandedReadsAssigned:11452426 PositiveStrandReadsAssigned:142769 NegativeStrandReadsAssigned:11483244 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172649 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172649-trimmed-pair1.fastq SRR7172649-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,908,468 reads, 11,419,423 reads pseudoaligned [quant] estimated average fragment length: 219.231 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7172649.ke.tsv 34699 SRR7172649.se.tsv 87100 total ==> SRR7172649.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.77 1111 39.7897 Potri.005G024800.1.v4.1 1035 816.769 281 22.1759 Potri.004G059700.1.v4.1 961 742.783 92 7.98362 Potri.007G009000.2.v4.1 1416 1197.77 0 0 Potri.003G141000.2.v4.1 2943 2724.77 480.257 11.361 Potri.016G087400.1.v4.1 270 84.0374 1155.64 886.388 Potri.015G069301.1.v4.1 564 347.259 0 0 Potri.010G195200.1.v4.1 1773 1554.77 427 17.7025 Potri.012G127500.1.v4.1 977 758.783 3483 295.876 ==> SRR7172649.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 930 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 365 SRR7172649 completed mapping pipeline successfully