Starting /dee2/code/volunteer_pipeline.sh SRR7172650 current disk space = 3058311860224 free memory = 1579903428 SRR7172650 SRAfilesize 3ee4766d19b8df229e1356789396d8b4 SRR7172650.sra SRR7172650.sra file validated SRR7172650 is paired end SRR7172650 is conventional basespace SRR7172650 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172650_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.83325 18.0 18.0 30.0 18.0 32.0 2 27.622 29.0 25.0 31.0 18.0 33.0 3 30.51175 31.0 29.0 33.0 27.0 33.0 4 31.81475 33.0 31.0 33.0 29.0 33.0 5 32.30925 33.0 33.0 33.0 32.0 34.0 6 37.12075 38.0 37.0 38.0 36.0 38.0 7 37.4155 38.0 38.0 38.0 37.0 38.0 8 37.57325 38.0 38.0 38.0 38.0 38.0 9 37.64475 38.0 38.0 38.0 38.0 38.0 10-14 37.61315 38.0 38.0 38.0 38.0 38.0 15-19 37.549400000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.5875 38.0 38.0 38.0 38.0 38.0 25-29 37.582899999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.544 38.0 38.0 38.0 38.0 38.0 35-39 37.515299999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.45095 38.0 38.0 38.0 37.6 38.0 45-49 37.4379 38.0 38.0 38.0 37.6 38.0 50-54 37.404399999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.32225 38.0 38.0 38.0 37.0 38.0 60-64 37.309000000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2774 38.0 38.0 38.0 37.0 38.0 70-74 37.22825 38.0 38.0 38.0 36.8 38.0 75-79 37.146249999999995 38.0 38.0 38.0 36.4 38.0 80-84 37.04684999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.8987 38.0 38.0 38.0 36.0 38.0 90-94 36.838 38.0 38.0 38.0 35.2 38.0 95-99 36.8635 38.0 38.0 38.0 35.2 38.0 100-104 36.7247 38.0 38.0 38.0 34.8 38.0 105-109 36.5945 38.0 38.0 38.0 34.4 38.0 110-114 36.3323 38.0 38.0 38.0 34.0 38.0 115-119 36.3157 38.0 38.0 38.0 34.0 38.0 120-124 36.1832 38.0 37.8 38.0 33.8 38.0 125-129 35.91765 38.0 36.8 38.0 32.6 38.0 130-134 35.33155 38.0 36.2 38.0 29.2 38.0 135-139 35.30045 38.0 36.0 38.0 30.4 38.0 140-144 34.9462 38.0 35.8 38.0 28.2 38.0 145-149 34.40565 38.0 35.2 38.0 27.0 38.0 150-151 31.043124999999996 36.5 29.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 3.0 20 2.0 21 3.0 22 4.0 23 7.0 24 7.0 25 6.0 26 13.0 27 17.0 28 17.0 29 31.0 30 46.0 31 43.0 32 68.0 33 104.0 34 116.0 35 262.0 36 688.0 37 2556.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.7807351077313 17.896070975918885 11.837769328263626 33.48542458808618 2 20.055151667084484 17.598395587866634 37.02682376535473 25.31962897969416 3 18.575 26.05 28.299999999999997 27.075 4 21.7 34.125 21.625 22.55 5 21.075 34.825 25.3 18.8 6 18.175 35.725 26.05 20.05 7 15.15 23.525 43.175000000000004 18.15 8 18.375 23.400000000000002 30.975 27.250000000000004 9 18.2 23.400000000000002 31.900000000000002 26.5 10-14 19.095000000000002 30.505 27.1 23.3 15-19 19.52 29.53 27.47 23.48 20-24 18.9 29.294999999999998 28.194999999999997 23.61 25-29 19.580000000000002 29.294999999999998 27.625 23.5 30-34 19.075 29.294999999999998 28.1 23.53 35-39 19.814999999999998 29.270000000000003 27.42 23.494999999999997 40-44 19.78 28.88 28.055000000000003 23.285 45-49 19.400000000000002 29.485 27.560000000000002 23.555 50-54 19.63 28.735 28.16 23.474999999999998 55-59 19.5 28.835 27.900000000000002 23.765 60-64 19.439999999999998 28.89 27.785 23.885 65-69 19.62 28.51 27.694999999999997 24.175 70-74 19.705000000000002 28.884999999999998 27.51 23.9 75-79 20.13 27.994999999999997 27.589999999999996 24.285 80-84 19.925 28.194999999999997 27.775 24.104999999999997 85-89 20.46 28.499999999999996 27.355 23.685000000000002 90-94 19.615 28.799999999999997 28.03 23.555 95-99 19.685 28.555000000000003 27.965 23.794999999999998 100-104 20.25 28.494999999999997 27.395000000000003 23.86 105-109 20.18 28.03 27.595 24.195 110-114 20.585 28.4 27.77 23.244999999999997 115-119 20.645 28.185 27.595 23.575 120-124 20.995 27.91 27.48 23.615 125-129 21.13 28.044999999999998 27.015 23.810000000000002 130-134 20.36 28.565 27.235 23.84 135-139 21.224999999999998 28.16 26.955000000000002 23.66 140-144 20.705000000000002 27.905 27.169999999999998 24.22 145-149 21.27 28.535 26.11 24.085 150-151 21.1375 28.0625 26.625 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 3.5 22 3.5 23 1.0 24 2.5 25 3.5 26 5.0 27 7.0 28 15.5 29 19.5 30 22.5 31 32.0 32 36.5 33 54.5 34 74.5 35 84.0 36 89.0 37 110.5 38 147.0 39 183.5 40 212.5 41 225.5 42 243.5 43 254.0 44 259.0 45 269.0 46 263.5 47 243.0 48 217.0 49 190.5 50 169.0 51 131.0 52 101.5 53 90.5 54 59.0 55 39.0 56 32.0 57 24.5 58 19.5 59 10.5 60 7.0 61 8.5 62 5.0 63 4.0 64 6.5 65 4.5 66 2.5 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.699999999999999 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCG 10 0.006832588 144.9875 7 >>END_MODULE SRR7172650 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172650_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86175 33.0 33.0 34.0 32.0 34.0 2 32.927 34.0 33.0 34.0 32.0 34.0 3 32.9315 34.0 33.0 34.0 32.0 34.0 4 32.89125 34.0 33.0 34.0 32.0 34.0 5 32.877 34.0 33.0 34.0 33.0 34.0 6 36.98375 38.0 38.0 38.0 37.0 38.0 7 36.9845 38.0 38.0 38.0 37.0 38.0 8 36.95425 38.0 38.0 38.0 37.0 38.0 9 36.9355 38.0 38.0 38.0 37.0 38.0 10-14 36.8721 38.0 38.0 38.0 36.8 38.0 15-19 36.88325 38.0 38.0 38.0 37.0 38.0 20-24 36.853699999999996 38.0 38.0 38.0 37.0 38.0 25-29 36.63375 38.0 38.0 38.0 36.4 38.0 30-34 36.3396 38.0 38.0 38.0 35.8 38.0 35-39 36.43445 38.0 38.0 38.0 35.2 38.0 40-44 36.599149999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.6522 38.0 38.0 38.0 36.2 38.0 50-54 36.614250000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.529849999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.45649999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.35105 38.0 38.0 38.0 35.0 38.0 70-74 36.2562 38.0 38.0 38.0 34.4 38.0 75-79 36.119600000000005 38.0 38.0 38.0 33.8 38.0 80-84 36.06015 38.0 38.0 38.0 34.0 38.0 85-89 36.02255 38.0 38.0 38.0 34.0 38.0 90-94 35.98225 38.0 38.0 38.0 33.8 38.0 95-99 35.94255 38.0 38.0 38.0 33.8 38.0 100-104 35.76175 38.0 38.0 38.0 33.0 38.0 105-109 35.6986 38.0 38.0 38.0 33.0 38.0 110-114 35.570499999999996 38.0 37.6 38.0 31.8 38.0 115-119 35.299400000000006 38.0 37.0 38.0 30.6 38.0 120-124 35.099450000000004 38.0 36.6 38.0 29.8 38.0 125-129 34.670950000000005 38.0 36.0 38.0 26.6 38.0 130-134 34.2632 38.0 35.4 38.0 24.0 38.0 135-139 33.85905 38.0 33.8 38.0 22.6 38.0 140-144 33.43335 38.0 33.4 38.0 19.0 38.0 145-149 32.32685 38.0 33.0 38.0 10.8 38.0 150-151 27.925375000000003 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 9.0 4 9.0 5 5.0 6 5.0 7 4.0 8 3.0 9 3.0 10 2.0 11 2.0 12 1.0 13 4.0 14 2.0 15 3.0 16 2.0 17 6.0 18 6.0 19 3.0 20 11.0 21 10.0 22 14.0 23 16.0 24 18.0 25 12.0 26 27.0 27 28.0 28 28.0 29 27.0 30 37.0 31 55.0 32 76.0 33 91.0 34 154.0 35 248.0 36 525.0 37 2529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.925 16.55 17.474999999999998 26.05 2 24.675 24.474999999999998 32.25 18.6 3 21.7 27.0 32.0 19.3 4 25.174999999999997 34.025 22.1 18.7 5 24.725 36.375 21.475 17.424999999999997 6 19.400000000000002 35.3 25.4 19.900000000000002 7 19.900000000000002 17.974999999999998 40.375 21.75 8 21.224999999999998 23.599999999999998 27.650000000000002 27.525 9 22.05 25.974999999999998 27.35 24.625 10-14 23.395 28.64 26.415 21.55 15-19 23.080000000000002 28.32 27.845 20.755000000000003 20-24 23.135 28.665000000000003 27.54 20.66 25-29 23.521747845259572 28.693124874724397 26.97935458007617 20.80577269993987 30-34 23.5082928802589 28.5497572815534 27.57382686084142 20.368122977346278 35-39 23.631890752083542 27.969675670248016 27.68852294407069 20.70991063359775 40-44 23.93 27.85 27.500000000000004 20.72 45-49 23.73 27.775 28.24 20.255000000000003 50-54 23.43 27.91 27.685 20.974999999999998 55-59 23.865 27.834999999999997 27.62 20.68 60-64 23.66 28.355000000000004 27.544999999999998 20.44 65-69 23.9 28.455000000000002 27.61 20.035 70-74 24.555 28.199999999999996 27.345000000000002 19.900000000000002 75-79 23.724999999999998 28.28 27.47 20.525 80-84 23.96 27.800000000000004 27.474999999999998 20.765 85-89 23.7 28.310000000000002 27.77 20.22 90-94 24.085 27.24 27.565 21.11 95-99 23.565 27.43 28.265 20.74 100-104 23.94 28.34 27.944999999999997 19.775000000000002 105-109 24.33 27.560000000000002 27.855 20.255000000000003 110-114 24.285 27.73 27.900000000000002 20.085 115-119 24.385 27.955000000000002 27.61 20.05 120-124 24.07 27.955000000000002 27.865000000000002 20.11 125-129 25.0 27.72 27.639999999999997 19.64 130-134 25.035 27.935 26.955000000000002 20.075000000000003 135-139 24.425 28.134999999999998 27.82 19.62 140-144 25.185000000000002 27.284999999999997 27.62 19.91 145-149 25.095 28.24 27.37 19.295 150-151 26.174999999999997 27.275 26.887499999999996 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.5 25 2.5 26 2.5 27 4.5 28 7.0 29 7.0 30 9.0 31 12.5 32 18.0 33 27.5 34 37.5 35 53.5 36 69.0 37 101.0 38 143.0 39 153.0 40 185.5 41 225.5 42 252.0 43 279.5 44 288.0 45 300.0 46 302.5 47 282.0 48 250.5 49 211.5 50 177.5 51 140.5 52 106.5 53 84.5 54 62.0 55 46.0 56 37.5 57 30.0 58 19.5 59 12.5 60 10.5 61 7.5 62 9.0 63 8.5 64 3.5 65 2.0 66 2.5 67 2.5 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.22 30-34 1.1199999999999999 35-39 0.41000000000000003 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31904161412358 98.45 2 0.5800756620428752 1.15 3 0.025220680958385876 0.075 4 0.05044136191677175 0.2 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.3375000000000004 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.4875 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615111 spots for SRR7172650.sra Written 615111 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra Read 615107 spots for SRR7172650.sra Written 615107 spots for SRR7172650.sra SRR ids: ['SRR7172650.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uxqead6y SRR7172650.sra spots: 12302144 blocks: [[1, 615107], [615108, 1230214], [1230215, 1845321], [1845322, 2460428], [2460429, 3075535], [3075536, 3690642], [3690643, 4305749], [4305750, 4920856], [4920857, 5535963], [5535964, 6151070], [6151071, 6766177], [6766178, 7381284], [7381285, 7996391], [7996392, 8611498], [8611499, 9226605], [9226606, 9841712], [9841713, 10456819], [10456820, 11071926], [11071927, 11687033], [11687034, 12302144]] SRR7172650 file size 4147092 SRR7172650 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172650 SRR7172650_1.fastq SRR7172650_2.fastq Input file: SRR7172650_1.fastq Paired file: SRR7172650_2.fastq trimmed: SRR7172650-trimmed-pair1.fastq, SRR7172650-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:48:47 2025 >> started Mon Feb 10 16:49:01 2025 >> done (13.490s) 12302144 read pairs processed; of these: 34325 ( 0.28%) short read pairs filtered out after trimming by size control 23511 ( 0.19%) empty read pairs filtered out after trimming by size control 12244308 (99.53%) read pairs available; of these: 5100064 (41.65%) trimmed read pairs available after processing 7144244 (58.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 3 0.00% 22 5 0.00% 23 7 0.00% 24 9 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 4 0.00% 36 5 0.00% 37 1 0.00% 38 1 0.00% 39 11 0.00% 40 8 0.00% 41 10 0.00% 42 5 0.00% 43 11 0.00% 44 9 0.00% 45 7 0.00% 46 10 0.00% 47 15 0.00% 48 10 0.00% 49 15 0.00% 50 19 0.00% 51 22 0.00% 52 20 0.00% 53 20 0.00% 54 27 0.00% 55 32 0.00% 56 45 0.00% 57 49 0.00% 58 43 0.00% 59 54 0.00% 60 66 0.00% 61 68 0.00% 62 79 0.00% 63 90 0.00% 64 118 0.00% 65 105 0.00% 66 134 0.00% 67 124 0.00% 68 137 0.00% 69 222 0.00% 70 226 0.00% 71 236 0.00% 72 310 0.00% 73 319 0.00% 74 362 0.00% 75 427 0.00% 76 554 0.00% 77 627 0.01% 78 669 0.01% 79 762 0.01% 80 861 0.01% 81 1006 0.01% 82 1174 0.01% 83 1343 0.01% 84 3036 0.02% 85 3991 0.03% 86 4016 0.03% 87 4263 0.03% 88 4504 0.04% 89 4421 0.04% 90 4582 0.04% 91 4820 0.04% 92 5132 0.04% 93 5345 0.04% 94 5911 0.05% 95 5930 0.05% 96 6461 0.05% 97 6858 0.06% 98 7124 0.06% 99 7612 0.06% 100 8019 0.07% 101 8828 0.07% 102 9529 0.08% 103 10188 0.08% 104 11004 0.09% 105 11812 0.10% 106 12228 0.10% 107 13137 0.11% 108 14181 0.12% 109 14672 0.12% 110 15626 0.13% 111 16429 0.13% 112 17569 0.14% 113 18575 0.15% 114 19670 0.16% 115 20847 0.17% 116 21671 0.18% 117 22556 0.18% 118 23562 0.19% 119 24443 0.20% 120 25512 0.21% 121 26492 0.22% 122 27961 0.23% 123 29356 0.24% 124 31574 0.26% 125 32258 0.26% 126 33858 0.28% 127 34822 0.28% 128 36083 0.29% 129 37164 0.30% 130 39252 0.32% 131 40447 0.33% 132 42585 0.35% 133 44673 0.36% 134 46366 0.38% 135 49101 0.40% 136 50927 0.42% 137 53521 0.44% 138 55956 0.46% 139 58585 0.48% 140 62413 0.51% 141 67010 0.55% 142 72116 0.59% 143 79367 0.65% 144 89777 0.73% 145 102893 0.84% 146 123751 1.01% 147 159236 1.30% 148 227255 1.86% 149 438005 3.58% 150 2472662 20.19% 151 7144244 58.35% 12244308 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=24 prefix-density=0.95 prefix-fanout=2.1 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=121.27 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=15.5 sequence=TCCTTCTTCTCAACACTCTTAATGACACCAACCGCCACGGTCTGACGCATGTCCCTCACTGCAAAACGACCAAGAGGAGGATAGGCAGAAAAGGTCTCAACAACCATAGGCTTGGTGGGAATCATCTTCACAAACCCAGCATCACCATTCTTCAAGAACTTGGGCTCCTTCTCGAGCTCTTTGCCAGATCGCCTGTCAATCTTGGT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=28 prefix-density=0.78 prefix-fanout=3.4 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=122.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.7 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACCATGAACTGTGCTCGCCCTGTAAAGTACTTTCTATCAACCTGCTGGAGTT SRR7172650 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:49:43 Started mapping on | Feb 10 16:49:43 Finished on | Feb 10 16:51:05 Mapping speed, Million of reads per hour | 537.55 Number of input reads | 12244308 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11452512 Uniquely mapped reads % | 93.53% Average mapped length | 294.14 Number of splices: Total | 10890104 Number of splices: Annotated (sjdb) | 10653117 Number of splices: GT/AG | 10710911 Number of splices: GC/AG | 132882 Number of splices: AT/AC | 11107 Number of splices: Non-canonical | 35204 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304474 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 38379 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515634 515634 515634 N_multimapping 304474 304474 304474 N_noFeature 314846 11337218 361809 N_ambiguous 127507 635 58905 UnstrandedReadsAssigned:11010159 PositiveStrandReadsAssigned:114659 NegativeStrandReadsAssigned:11031798 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172650 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172650-trimmed-pair1.fastq SRR7172650-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,244,308 reads, 10,908,319 reads pseudoaligned [quant] estimated average fragment length: 226.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR7172650.ke.tsv 34699 SRR7172650.se.tsv 87100 total ==> SRR7172650.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.97 930 34.2689 Potri.005G024800.1.v4.1 1035 809.969 377 30.7513 Potri.004G059700.1.v4.1 961 735.985 51 4.57817 Potri.007G009000.2.v4.1 1416 1190.97 0 0 Potri.003G141000.2.v4.1 2943 2717.97 317 7.70557 Potri.016G087400.1.v4.1 270 81.8111 1265.66 1022.1 Potri.015G069301.1.v4.1 564 340.994 0 0 Potri.010G195200.1.v4.1 1773 1547.97 244 10.414 Potri.012G127500.1.v4.1 977 751.974 7007 615.629 ==> SRR7172650.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 574 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 911 SRR7172650 completed mapping pipeline successfully