Starting /dee2/code/volunteer_pipeline.sh SRR7172651 current disk space = 3058656624640 free memory = 1158498808 SRR7172651 SRAfilesize fd1227c2fa491ded8c75449c664484e6 SRR7172651.sra SRR7172651.sra file validated SRR7172651 is paired end SRR7172651 is conventional basespace SRR7172651 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.632 28.0 18.0 32.0 18.0 33.0 2 28.0115 29.0 27.0 33.0 18.0 33.0 3 30.23725 31.0 29.0 33.0 27.0 33.0 4 31.38125 33.0 31.0 33.0 29.0 33.0 5 32.26 33.0 33.0 33.0 32.0 34.0 6 36.79925 38.0 37.0 38.0 34.0 38.0 7 37.31825 38.0 38.0 38.0 37.0 38.0 8 37.57625 38.0 38.0 38.0 37.0 38.0 9 37.5925 38.0 38.0 38.0 38.0 38.0 10-14 37.5742 38.0 38.0 38.0 38.0 38.0 15-19 37.5413 38.0 38.0 38.0 38.0 38.0 20-24 37.55095 38.0 38.0 38.0 38.0 38.0 25-29 37.544000000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.52204999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.5078 38.0 38.0 38.0 38.0 38.0 40-44 37.397200000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.36125 38.0 38.0 38.0 37.0 38.0 50-54 37.3349 38.0 38.0 38.0 37.0 38.0 55-59 37.289 38.0 38.0 38.0 37.0 38.0 60-64 37.2268 38.0 38.0 38.0 37.0 38.0 65-69 37.19285 38.0 38.0 38.0 36.8 38.0 70-74 37.1673 38.0 38.0 38.0 36.4 38.0 75-79 37.098 38.0 38.0 38.0 36.0 38.0 80-84 36.948750000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.857749999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.83395 38.0 38.0 38.0 35.0 38.0 95-99 36.82335 38.0 38.0 38.0 35.2 38.0 100-104 36.6167 38.0 38.0 38.0 34.2 38.0 105-109 36.47234999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.31855 38.0 38.0 38.0 33.8 38.0 115-119 36.3617 38.0 38.0 38.0 34.0 38.0 120-124 36.2269 38.0 37.6 38.0 33.8 38.0 125-129 35.76125 38.0 36.8 38.0 31.2 38.0 130-134 35.00555 38.0 35.4 38.0 27.4 38.0 135-139 35.0224 38.0 35.4 38.0 28.0 38.0 140-144 34.950900000000004 38.0 35.6 38.0 28.0 38.0 145-149 34.36645 38.0 35.0 38.0 26.2 38.0 150-151 30.834874999999997 36.5 29.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 1.0 20 6.0 21 2.0 22 6.0 23 8.0 24 4.0 25 12.0 26 13.0 27 15.0 28 23.0 29 30.0 30 37.0 31 60.0 32 64.0 33 80.0 34 155.0 35 292.0 36 716.0 37 2471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.73506891271057 13.91015824400204 11.485451761102604 33.86932108218479 2 21.031446540880502 19.044025157232706 38.16352201257862 21.761006289308177 3 19.175 27.3 28.000000000000004 25.525 4 22.075 34.2 22.7 21.025 5 21.3 36.475 24.875 17.349999999999998 6 15.825 36.4 26.424999999999997 21.349999999999998 7 13.225000000000001 20.3 45.725 20.75 8 19.475 21.425 30.425 28.675 9 19.175 22.175 32.175 26.474999999999998 10-14 19.72 29.29 27.125 23.865 15-19 20.06 27.994999999999997 28.139999999999997 23.805 20-24 20.1 27.665 28.060000000000002 24.175 25-29 19.53 28.68 28.050000000000004 23.74 30-34 19.900000000000002 28.46 27.644999999999996 23.995 35-39 19.17 28.549999999999997 28.194999999999997 24.085 40-44 19.84 28.194999999999997 28.555000000000003 23.41 45-49 19.5 28.005000000000003 28.57 23.925 50-54 19.655 28.384999999999998 28.035 23.925 55-59 19.7 28.155 28.244999999999997 23.9 60-64 19.405 28.335 28.360000000000003 23.9 65-69 19.96 28.134999999999998 28.615000000000002 23.29 70-74 20.115 28.645 26.995 24.245 75-79 20.03 28.325 27.634999999999998 24.01 80-84 19.835 28.98 27.855 23.330000000000002 85-89 20.330000000000002 27.955000000000002 28.355000000000004 23.36 90-94 20.32 28.465 27.485 23.73 95-99 20.015 28.225 27.889999999999997 23.87 100-104 20.31 28.310000000000002 27.700000000000003 23.68 105-109 20.150000000000002 28.660000000000004 27.26 23.93 110-114 20.45 28.405 27.375 23.77 115-119 20.435 28.050000000000004 27.805000000000003 23.71 120-124 20.4 28.494999999999997 27.525 23.580000000000002 125-129 20.919999999999998 27.67 28.144999999999996 23.265 130-134 20.385 28.835 27.36 23.419999999999998 135-139 20.419999999999998 28.560000000000002 27.77 23.25 140-144 20.57 28.365000000000002 26.955000000000002 24.11 145-149 20.735 27.935 27.034999999999997 24.295 150-151 20.3875 28.8375 27.55 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 5.0 27 7.5 28 8.5 29 11.5 30 16.5 31 25.5 32 29.5 33 27.5 34 40.5 35 63.0 36 81.0 37 108.5 38 145.0 39 178.5 40 211.0 41 246.5 42 278.0 43 302.0 44 300.5 45 284.5 46 281.0 47 262.0 48 206.0 49 169.5 50 154.5 51 127.5 52 105.0 53 79.5 54 55.0 55 38.5 56 32.5 57 31.0 58 22.5 59 12.0 60 7.5 61 7.5 62 6.0 63 3.5 64 2.5 65 1.5 66 1.5 67 2.5 68 2.0 69 3.0 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0125 0.0 0.0 0.0 110-111 0.8625 0.025 0.0 0.0 0.0 112-113 1.025 0.025 0.0 0.0 0.0 114-115 1.1625 0.025 0.0 0.0 0.0 116-117 1.2875 0.025 0.0 0.0 0.0 118-119 1.4874999999999998 0.025 0.0 0.0 0.0 120-121 1.6625 0.025 0.0 0.0 0.0 122-123 1.875 0.025 0.0 0.0 0.0 124-125 2.0250000000000004 0.025 0.0 0.0 0.0 126-127 2.3625 0.025 0.0 0.0 0.0 128-129 2.6625 0.025 0.0 0.0 0.0 130-131 3.025 0.025 0.0 0.0 0.0 132-133 3.4375 0.025 0.0 0.0 0.0 134-135 3.775 0.025 0.0 0.0 0.0 136-137 4.2375 0.025 0.0 0.0 0.0 138-139 4.5875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTT 10 0.0063298983 148.6923 1 TGCAATT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7172651 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.053 34.0 33.0 34.0 32.0 34.0 2 33.04875 34.0 33.0 34.0 32.0 34.0 3 33.113 34.0 33.0 34.0 33.0 34.0 4 33.04375 34.0 33.0 34.0 32.0 34.0 5 33.02325 34.0 33.0 34.0 33.0 34.0 6 37.237 38.0 38.0 38.0 37.0 38.0 7 37.19225 38.0 38.0 38.0 37.0 38.0 8 37.274 38.0 38.0 38.0 38.0 38.0 9 37.1635 38.0 38.0 38.0 37.0 38.0 10-14 37.13215 38.0 38.0 38.0 37.0 38.0 15-19 37.1317 38.0 38.0 38.0 37.0 38.0 20-24 37.12495 38.0 38.0 38.0 37.4 38.0 25-29 36.9305 38.0 38.0 38.0 36.8 38.0 30-34 36.42569999999999 38.0 38.0 38.0 36.2 38.0 35-39 36.64534999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.9576 38.0 38.0 38.0 37.0 38.0 45-49 36.98195 38.0 38.0 38.0 37.0 38.0 50-54 36.92345 38.0 38.0 38.0 36.8 38.0 55-59 36.883250000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.757450000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.61915 38.0 38.0 38.0 35.4 38.0 70-74 36.606300000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.57115 38.0 38.0 38.0 35.2 38.0 80-84 36.44565 38.0 38.0 38.0 34.8 38.0 85-89 36.3673 38.0 38.0 38.0 34.2 38.0 90-94 36.383300000000006 38.0 38.0 38.0 34.4 38.0 95-99 36.309749999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.2664 38.0 38.0 38.0 34.2 38.0 105-109 36.21985 38.0 38.0 38.0 34.0 38.0 110-114 36.05175 38.0 38.0 38.0 33.6 38.0 115-119 35.773250000000004 38.0 37.0 38.0 31.8 38.0 120-124 35.45890000000001 38.0 36.6 38.0 30.6 38.0 125-129 35.1268 38.0 36.0 38.0 28.6 38.0 130-134 34.7539 38.0 35.4 38.0 27.0 38.0 135-139 34.5169 38.0 35.6 38.0 26.6 38.0 140-144 34.01675 38.0 33.8 38.0 24.0 38.0 145-149 32.95465 38.0 33.0 38.0 16.2 38.0 150-151 28.717750000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 11.0 4 2.0 5 6.0 6 4.0 7 2.0 8 0.0 9 0.0 10 1.0 11 3.0 12 0.0 13 4.0 14 1.0 15 3.0 16 1.0 17 6.0 18 2.0 19 4.0 20 8.0 21 7.0 22 5.0 23 8.0 24 13.0 25 12.0 26 15.0 27 20.0 28 25.0 29 29.0 30 39.0 31 70.0 32 79.0 33 95.0 34 153.0 35 277.0 36 593.0 37 2493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 16.150000000000002 16.325 29.349999999999998 2 25.025 23.225 34.975 16.775000000000002 3 19.7 26.625 32.025 21.65 4 23.45 36.0 21.725 18.825 5 25.324999999999996 36.35 20.8 17.525 6 18.525 37.85 23.775 19.85 7 19.650000000000002 16.875 42.55 20.925 8 20.65 22.325 28.975 28.050000000000004 9 21.675 24.825 28.599999999999998 24.9 10-14 23.14 28.48 26.834999999999997 21.545 15-19 23.055 27.875 28.225 20.845 20-24 22.865 28.299999999999997 28.199999999999996 20.635 25-29 22.95295948591797 28.520508057633414 28.435162407751392 20.091370048697225 30-34 23.42700061087355 28.293626552636937 27.636937487273467 20.642435349216047 35-39 23.23578300508739 28.61532262126631 27.920213569737573 20.22868080390873 40-44 23.36 28.29 27.705000000000002 20.645 45-49 23.13 27.74 28.720000000000002 20.41 50-54 23.305 28.08 28.155 20.46 55-59 23.895 28.18 27.605 20.32 60-64 23.375 28.255000000000003 27.845 20.525 65-69 23.16 27.96 28.52 20.36 70-74 23.28 28.345 27.805000000000003 20.57 75-79 23.47 28.07 28.470000000000002 19.99 80-84 23.425 27.935 28.46 20.18 85-89 23.56 28.410000000000004 28.12 19.91 90-94 23.605 28.16 28.22 20.015 95-99 23.425 28.03 28.42 20.125 100-104 23.585 27.565 28.455000000000002 20.395 105-109 24.645 27.49 27.58 20.285 110-114 23.919999999999998 28.139999999999997 28.035 19.905 115-119 23.945 27.87 28.24 19.945 120-124 24.085 27.85 27.575 20.49 125-129 24.02 28.34 27.73 19.91 130-134 24.099999999999998 28.535 27.63 19.735 135-139 24.46 27.79 27.82 19.93 140-144 25.045 28.389999999999997 26.735 19.830000000000002 145-149 25.05 27.235 27.845 19.869999999999997 150-151 24.45 28.3375 27.575 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.5 26 3.0 27 4.5 28 3.5 29 5.5 30 16.0 31 17.5 32 22.5 33 35.5 34 51.5 35 67.5 36 90.5 37 117.5 38 142.0 39 184.0 40 221.0 41 249.5 42 276.0 43 284.5 44 288.0 45 280.5 46 277.5 47 266.5 48 219.5 49 181.5 50 154.5 51 128.5 52 101.5 53 79.5 54 60.5 55 44.5 56 37.5 57 24.0 58 13.5 59 10.5 60 6.0 61 5.5 62 6.0 63 5.0 64 4.0 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.40499999999999997 30-34 1.78 35-39 0.735 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCCAT 10 0.006883923 144.625 5 >>END_MODULE Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733434 spots for SRR7172651.sra Written 733434 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra Read 733424 spots for SRR7172651.sra Written 733424 spots for SRR7172651.sra SRR ids: ['SRR7172651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2uo_8syv SRR7172651.sra spots: 14668490 blocks: [[1, 733424], [733425, 1466848], [1466849, 2200272], [2200273, 2933696], [2933697, 3667120], [3667121, 4400544], [4400545, 5133968], [5133969, 5867392], [5867393, 6600816], [6600817, 7334240], [7334241, 8067664], [8067665, 8801088], [8801089, 9534512], [9534513, 10267936], [10267937, 11001360], [11001361, 11734784], [11734785, 12468208], [12468209, 13201632], [13201633, 13935056], [13935057, 14668490]] SRR7172651 file size 4948969 SRR7172651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172651 SRR7172651_1.fastq SRR7172651_2.fastq Input file: SRR7172651_1.fastq Paired file: SRR7172651_2.fastq trimmed: SRR7172651-trimmed-pair1.fastq, SRR7172651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:09:27 2025 >> started Mon Feb 10 16:09:43 2025 >> done (15.942s) 14668490 read pairs processed; of these: 17897 ( 0.12%) short read pairs filtered out after trimming by size control 12129 ( 0.08%) empty read pairs filtered out after trimming by size control 14638464 (99.80%) read pairs available; of these: 5751548 (39.29%) trimmed read pairs available after processing 8886916 (60.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 4 0.00% 31 0 0.00% 32 2 0.00% 33 1 0.00% 34 3 0.00% 35 0 0.00% 36 4 0.00% 37 3 0.00% 38 2 0.00% 39 5 0.00% 40 5 0.00% 41 5 0.00% 42 3 0.00% 43 7 0.00% 44 6 0.00% 45 6 0.00% 46 3 0.00% 47 5 0.00% 48 11 0.00% 49 16 0.00% 50 22 0.00% 51 22 0.00% 52 25 0.00% 53 18 0.00% 54 19 0.00% 55 28 0.00% 56 30 0.00% 57 28 0.00% 58 37 0.00% 59 38 0.00% 60 46 0.00% 61 64 0.00% 62 55 0.00% 63 69 0.00% 64 78 0.00% 65 91 0.00% 66 80 0.00% 67 111 0.00% 68 136 0.00% 69 120 0.00% 70 159 0.00% 71 176 0.00% 72 197 0.00% 73 246 0.00% 74 286 0.00% 75 363 0.00% 76 407 0.00% 77 455 0.00% 78 468 0.00% 79 554 0.00% 80 646 0.00% 81 736 0.01% 82 874 0.01% 83 985 0.01% 84 1901 0.01% 85 2463 0.02% 86 2634 0.02% 87 2788 0.02% 88 2923 0.02% 89 3007 0.02% 90 3163 0.02% 91 3347 0.02% 92 3575 0.02% 93 3949 0.03% 94 4327 0.03% 95 4501 0.03% 96 4736 0.03% 97 5094 0.03% 98 5476 0.04% 99 5959 0.04% 100 6456 0.04% 101 6982 0.05% 102 7746 0.05% 103 8028 0.05% 104 8638 0.06% 105 9327 0.06% 106 9959 0.07% 107 10632 0.07% 108 11487 0.08% 109 11927 0.08% 110 12890 0.09% 111 13451 0.09% 112 14346 0.10% 113 15349 0.10% 114 16439 0.11% 115 17284 0.12% 116 18247 0.12% 117 19427 0.13% 118 20425 0.14% 119 21351 0.15% 120 22152 0.15% 121 23335 0.16% 122 24511 0.17% 123 26019 0.18% 124 27209 0.19% 125 28353 0.19% 126 29994 0.20% 127 31723 0.22% 128 32841 0.22% 129 34038 0.23% 130 36061 0.25% 131 37874 0.26% 132 40150 0.27% 133 42509 0.29% 134 44138 0.30% 135 46387 0.32% 136 49063 0.34% 137 52392 0.36% 138 55351 0.38% 139 59090 0.40% 140 63514 0.43% 141 69122 0.47% 142 75698 0.52% 143 84441 0.58% 144 96697 0.66% 145 113111 0.77% 146 137572 0.94% 147 182870 1.25% 148 269305 1.84% 149 536190 3.66% 150 3051817 20.85% 151 8886916 60.71% 14638464 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=21.34 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=7.8 sequence=CACCATCATTGTAAAGGAACAACTGAG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=21 prefix-density=0.36 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=32.11 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.6 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR7172651 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:10:48 Started mapping on | Feb 10 16:10:49 Finished on | Feb 10 16:12:19 Mapping speed, Million of reads per hour | 585.54 Number of input reads | 14638464 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13821648 Uniquely mapped reads % | 94.42% Average mapped length | 296.00 Number of splices: Total | 14405373 Number of splices: Annotated (sjdb) | 14147922 Number of splices: GT/AG | 14179904 Number of splices: GC/AG | 182307 Number of splices: AT/AC | 9678 Number of splices: Non-canonical | 33484 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320941 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 39157 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 511801 511801 511801 N_multimapping 320941 320941 320941 N_noFeature 369121 13720321 408217 N_ambiguous 129387 639 66805 UnstrandedReadsAssigned:13323140 PositiveStrandReadsAssigned:100688 NegativeStrandReadsAssigned:13346626 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172651-trimmed-pair1.fastq SRR7172651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,638,464 reads, 13,251,251 reads pseudoaligned [quant] estimated average fragment length: 237.69 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7172651.ke.tsv 34699 SRR7172651.se.tsv 87100 total ==> SRR7172651.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.31 1097 48.9767 Potri.005G024800.1.v4.1 1035 798.31 422 42.04 Potri.004G059700.1.v4.1 961 724.316 11 1.20778 Potri.007G009000.2.v4.1 1416 1179.31 0 0 Potri.003G141000.2.v4.1 2943 2706.31 798 23.4503 Potri.016G087400.1.v4.1 270 77.4478 938 963.199 Potri.015G069301.1.v4.1 564 330.703 0 0 Potri.010G195200.1.v4.1 1773 1536.31 279 14.4427 Potri.012G127500.1.v4.1 977 740.316 3142 337.529 ==> SRR7172651.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 156 SRR7172651 completed mapping pipeline successfully