Starting /dee2/code/volunteer_pipeline.sh SRR7172652 current disk space = 3058664570880 free memory = 1408083552 SRR7172652 SRAfilesize 7710d5bb303962f60b9ad078113408e7 SRR7172652.sra SRR7172652.sra file validated SRR7172652 is paired end SRR7172652 is conventional basespace SRR7172652 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.696 25.0 18.0 32.0 18.0 33.0 2 28.605 30.0 27.0 33.0 18.0 33.0 3 31.06675 33.0 30.0 33.0 27.0 33.0 4 31.4945 33.0 31.0 33.0 29.0 33.0 5 32.0525 33.0 32.0 33.0 31.0 33.0 6 36.84525 38.0 37.0 38.0 35.0 38.0 7 37.349 38.0 38.0 38.0 37.0 38.0 8 37.53575 38.0 38.0 38.0 37.0 38.0 9 37.653 38.0 38.0 38.0 38.0 38.0 10-14 37.61195 38.0 38.0 38.0 38.0 38.0 15-19 37.5921 38.0 38.0 38.0 38.0 38.0 20-24 37.59535 38.0 38.0 38.0 38.0 38.0 25-29 37.59010000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.59695 38.0 38.0 38.0 38.0 38.0 35-39 37.533100000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.407599999999995 38.0 38.0 38.0 37.6 38.0 45-49 37.403999999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.38225 38.0 38.0 38.0 37.2 38.0 55-59 37.32435 38.0 38.0 38.0 37.0 38.0 60-64 37.29984999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.259699999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.19485 38.0 38.0 38.0 37.0 38.0 75-79 37.14765 38.0 38.0 38.0 36.6 38.0 80-84 37.010400000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.88455 38.0 38.0 38.0 35.6 38.0 90-94 36.856300000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.93025 38.0 38.0 38.0 35.8 38.0 100-104 36.738299999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.50695 38.0 38.0 38.0 34.0 38.0 110-114 36.3794 38.0 38.0 38.0 34.0 38.0 115-119 36.442499999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.323449999999994 38.0 38.0 38.0 34.0 38.0 125-129 35.951049999999995 38.0 37.2 38.0 32.8 38.0 130-134 35.33385 38.0 36.2 38.0 29.2 38.0 135-139 35.19635 38.0 36.0 38.0 29.2 38.0 140-144 35.04785 38.0 36.0 38.0 28.8 38.0 145-149 34.6415 38.0 35.6 38.0 28.2 38.0 150-151 31.249250000000004 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 3.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 3.0 19 1.0 20 4.0 21 2.0 22 5.0 23 6.0 24 6.0 25 8.0 26 9.0 27 9.0 28 20.0 29 25.0 30 25.0 31 54.0 32 62.0 33 92.0 34 141.0 35 260.0 36 637.0 37 2620.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.04306588054345 14.457831325301203 13.842604460394769 39.656498333760574 2 18.479355488418932 18.856998992950654 38.368580060422964 24.29506545820745 3 20.3 21.9 26.625 31.175000000000004 4 23.974999999999998 30.175 21.65 24.2 5 23.075000000000003 32.5 25.074999999999996 19.35 6 18.6 35.075 26.775 19.55 7 14.95 22.975 42.775 19.3 8 18.075 23.525 31.474999999999998 26.924999999999997 9 18.325 22.275 34.425 24.975 10-14 19.945 29.2 26.955000000000002 23.9 15-19 19.935 27.825 27.950000000000003 24.29 20-24 20.02 28.015 27.91 24.055 25-29 20.61 28.415000000000003 27.384999999999998 23.59 30-34 20.11 27.43 28.249999999999996 24.21 35-39 20.365 28.28 27.48 23.875 40-44 20.225 27.805000000000003 27.98 23.990000000000002 45-49 20.315 27.76 27.79 24.135 50-54 20.05 28.199999999999996 27.935 23.815 55-59 20.46 28.075 27.57 23.895 60-64 20.674999999999997 28.199999999999996 27.22 23.905 65-69 20.715 28.02 27.750000000000004 23.515 70-74 20.565 27.605 27.38 24.45 75-79 20.515 27.85 27.705000000000002 23.93 80-84 20.805 28.345 27.21 23.64 85-89 21.22 27.839999999999996 27.21 23.73 90-94 20.855 27.705000000000002 27.665 23.775 95-99 20.3 28.255000000000003 28.139999999999997 23.305 100-104 20.95 28.075 27.655 23.32 105-109 20.94 27.87 27.305 23.885 110-114 20.735 27.85 27.779999999999998 23.635 115-119 21.529999999999998 28.525 26.790000000000003 23.155 120-124 21.32 27.634999999999998 27.1 23.945 125-129 21.025 27.495000000000005 27.62 23.86 130-134 20.86 27.860000000000003 26.884999999999998 24.395 135-139 21.48 27.38 26.905 24.235 140-144 20.895 27.750000000000004 27.02 24.335 145-149 21.615000000000002 28.294999999999998 26.384999999999998 23.705000000000002 150-151 20.7625 28.287499999999998 26.724999999999998 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.5 25 1.5 26 3.0 27 7.0 28 11.0 29 17.0 30 25.5 31 30.0 32 40.5 33 49.5 34 49.0 35 65.0 36 86.5 37 108.5 38 131.5 39 153.0 40 168.0 41 186.5 42 235.0 43 253.5 44 257.5 45 275.5 46 276.5 47 250.5 48 216.0 49 188.0 50 153.0 51 137.0 52 112.5 53 89.0 54 84.0 55 61.5 56 43.0 57 40.0 58 33.5 59 28.0 60 25.5 61 21.5 62 16.0 63 11.5 64 9.5 65 5.5 66 7.0 67 8.0 68 4.0 69 3.0 70 2.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.85 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATAGTT 10 0.0068378756 144.95 5 >>END_MODULE SRR7172652 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9855 34.0 33.0 34.0 32.0 34.0 2 33.065 34.0 33.0 34.0 32.0 34.0 3 33.09125 34.0 33.0 34.0 32.0 34.0 4 33.049 34.0 33.0 34.0 33.0 34.0 5 33.009 34.0 33.0 34.0 33.0 34.0 6 37.177 38.0 38.0 38.0 37.0 38.0 7 37.1335 38.0 38.0 38.0 37.0 38.0 8 37.11675 38.0 38.0 38.0 37.0 38.0 9 37.136 38.0 38.0 38.0 37.0 38.0 10-14 37.0241 38.0 38.0 38.0 37.0 38.0 15-19 37.02230000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.00235 38.0 38.0 38.0 37.0 38.0 25-29 36.77685 38.0 38.0 38.0 36.8 38.0 30-34 36.1854 38.0 38.0 38.0 35.4 38.0 35-39 36.4094 38.0 38.0 38.0 35.4 38.0 40-44 36.8327 38.0 38.0 38.0 36.4 38.0 45-49 36.864349999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.834450000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.76925 38.0 38.0 38.0 36.0 38.0 60-64 36.64035 38.0 38.0 38.0 35.4 38.0 65-69 36.4994 38.0 38.0 38.0 34.8 38.0 70-74 36.51045 38.0 38.0 38.0 35.0 38.0 75-79 36.42975 38.0 38.0 38.0 34.6 38.0 80-84 36.32895 38.0 38.0 38.0 34.4 38.0 85-89 36.171400000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.146300000000004 38.0 38.0 38.0 33.8 38.0 95-99 36.140499999999996 38.0 38.0 38.0 33.8 38.0 100-104 35.99525 38.0 38.0 38.0 33.4 38.0 105-109 35.85705 38.0 38.0 38.0 33.0 38.0 110-114 35.7339 38.0 37.6 38.0 32.4 38.0 115-119 35.3472 38.0 37.0 38.0 30.6 38.0 120-124 35.20695 38.0 36.6 38.0 29.8 38.0 125-129 34.94235 38.0 36.0 38.0 28.2 38.0 130-134 34.393299999999996 38.0 35.2 38.0 24.2 38.0 135-139 34.1534 38.0 34.2 38.0 24.6 38.0 140-144 33.6452 38.0 33.0 38.0 22.8 38.0 145-149 32.6271 38.0 33.0 38.0 13.4 38.0 150-151 28.032625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 13.0 4 1.0 5 2.0 6 4.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 7.0 15 7.0 16 3.0 17 5.0 18 1.0 19 5.0 20 9.0 21 7.0 22 11.0 23 15.0 24 11.0 25 13.0 26 12.0 27 29.0 28 31.0 29 29.0 30 46.0 31 45.0 32 63.0 33 115.0 34 176.0 35 311.0 36 592.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.025 14.899999999999999 19.025 33.050000000000004 2 23.425 23.599999999999998 35.675000000000004 17.299999999999997 3 22.650000000000002 27.950000000000003 28.925 20.474999999999998 4 25.525 32.875 21.65 19.950000000000003 5 24.925 36.1 21.825 17.150000000000002 6 18.675 39.025 23.25 19.05 7 18.625 16.725 42.425000000000004 22.225 8 22.0 22.400000000000002 28.1 27.500000000000004 9 21.825 25.174999999999997 28.9 24.099999999999998 10-14 22.95 29.044999999999998 26.085 21.92 15-19 23.474999999999998 27.925 27.205000000000002 21.395 20-24 23.325000000000003 28.17 27.155 21.349999999999998 25-29 23.63134103465595 28.669010547463586 26.53440482169764 21.165243596182822 30-34 22.998774760057177 28.170308352052274 27.67000204206657 21.160914845823974 35-39 23.777352021780782 28.693153171321974 26.736916406171225 20.792578400726025 40-44 23.39 28.155 27.400000000000002 21.055 45-49 23.54 28.189999999999998 26.985 21.285 50-54 23.48 27.83 27.615000000000002 21.075 55-59 23.755000000000003 27.705000000000002 27.060000000000002 21.48 60-64 23.555 27.589999999999996 27.465 21.39 65-69 23.64 28.01 27.145000000000003 21.205 70-74 23.68 27.79 27.389999999999997 21.14 75-79 23.64 27.815 27.284999999999997 21.26 80-84 23.82 27.36 27.715 21.105 85-89 23.544999999999998 27.43 28.025 21.0 90-94 23.68 27.51 28.244999999999997 20.565 95-99 23.835 27.900000000000002 27.55 20.715 100-104 23.915 27.41 27.605 21.07 105-109 23.435 28.23 27.555000000000003 20.78 110-114 24.3 28.084999999999997 26.91 20.705000000000002 115-119 24.25 28.16 26.77 20.82 120-124 24.745 27.775 27.3 20.18 125-129 24.4 27.845 26.83 20.925 130-134 24.95 27.815 26.900000000000002 20.335 135-139 25.235000000000003 27.98 26.365 20.419999999999998 140-144 24.59 27.91 26.634999999999998 20.865000000000002 145-149 24.959999999999997 28.310000000000002 26.75 19.98 150-151 26.200000000000003 27.85 26.5375 19.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 5.0 27 7.0 28 4.0 29 4.0 30 11.0 31 17.0 32 19.0 33 32.0 34 44.0 35 53.0 36 70.5 37 89.0 38 129.0 39 177.5 40 214.5 41 226.0 42 242.0 43 268.5 44 258.5 45 254.5 46 266.5 47 252.5 48 231.5 49 212.0 50 166.0 51 137.5 52 121.5 53 91.0 54 72.5 55 60.5 56 48.0 57 44.0 58 40.5 59 26.0 60 18.5 61 15.5 62 10.0 63 11.0 64 9.0 65 6.5 66 5.5 67 4.5 68 4.5 69 1.5 70 1.5 71 2.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.44999999999999996 30-34 2.06 35-39 0.83 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.7750000000000004 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.2375 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.007739309 18.090624 140-144 >>END_MODULE Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732788 spots for SRR7172652.sra Written 732788 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra Read 732778 spots for SRR7172652.sra Written 732778 spots for SRR7172652.sra SRR ids: ['SRR7172652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rl6px6t SRR7172652.sra spots: 14655570 blocks: [[1, 732778], [732779, 1465556], [1465557, 2198334], [2198335, 2931112], [2931113, 3663890], [3663891, 4396668], [4396669, 5129446], [5129447, 5862224], [5862225, 6595002], [6595003, 7327780], [7327781, 8060558], [8060559, 8793336], [8793337, 9526114], [9526115, 10258892], [10258893, 10991670], [10991671, 11724448], [11724449, 12457226], [12457227, 13190004], [13190005, 13922782], [13922783, 14655570]] SRR7172652 file size 4944591 SRR7172652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172652 SRR7172652_1.fastq SRR7172652_2.fastq Input file: SRR7172652_1.fastq Paired file: SRR7172652_2.fastq trimmed: SRR7172652-trimmed-pair1.fastq, SRR7172652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:14:27 2025 >> started Mon Feb 10 16:14:42 2025 >> done (15.386s) 14655570 read pairs processed; of these: 21373 ( 0.15%) short read pairs filtered out after trimming by size control 16327 ( 0.11%) empty read pairs filtered out after trimming by size control 14617870 (99.74%) read pairs available; of these: 6016911 (41.16%) trimmed read pairs available after processing 8600959 (58.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 4 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 4 0.00% 33 2 0.00% 34 4 0.00% 35 9 0.00% 36 3 0.00% 37 7 0.00% 38 3 0.00% 39 5 0.00% 40 7 0.00% 41 5 0.00% 42 8 0.00% 43 3 0.00% 44 9 0.00% 45 7 0.00% 46 12 0.00% 47 16 0.00% 48 21 0.00% 49 23 0.00% 50 18 0.00% 51 21 0.00% 52 21 0.00% 53 27 0.00% 54 34 0.00% 55 45 0.00% 56 53 0.00% 57 37 0.00% 58 56 0.00% 59 58 0.00% 60 64 0.00% 61 79 0.00% 62 78 0.00% 63 92 0.00% 64 112 0.00% 65 123 0.00% 66 139 0.00% 67 147 0.00% 68 181 0.00% 69 192 0.00% 70 198 0.00% 71 303 0.00% 72 294 0.00% 73 374 0.00% 74 394 0.00% 75 509 0.00% 76 584 0.00% 77 668 0.00% 78 648 0.00% 79 761 0.01% 80 856 0.01% 81 996 0.01% 82 1168 0.01% 83 1424 0.01% 84 2481 0.02% 85 3271 0.02% 86 3367 0.02% 87 3882 0.03% 88 4073 0.03% 89 4058 0.03% 90 4313 0.03% 91 4524 0.03% 92 4837 0.03% 93 5317 0.04% 94 5680 0.04% 95 6212 0.04% 96 6496 0.04% 97 7081 0.05% 98 7517 0.05% 99 8151 0.06% 100 8849 0.06% 101 9658 0.07% 102 10352 0.07% 103 11246 0.08% 104 11817 0.08% 105 12791 0.09% 106 13878 0.09% 107 14621 0.10% 108 15467 0.11% 109 16511 0.11% 110 17453 0.12% 111 18512 0.13% 112 19575 0.13% 113 20846 0.14% 114 22607 0.15% 115 23881 0.16% 116 25228 0.17% 117 26368 0.18% 118 27016 0.18% 119 28335 0.19% 120 29802 0.20% 121 30899 0.21% 122 32254 0.22% 123 34301 0.23% 124 35944 0.25% 125 37003 0.25% 126 38586 0.26% 127 40839 0.28% 128 41845 0.29% 129 43806 0.30% 130 45948 0.31% 131 47761 0.33% 132 49925 0.34% 133 52365 0.36% 134 54209 0.37% 135 56398 0.39% 136 60210 0.41% 137 63363 0.43% 138 66490 0.45% 139 70351 0.48% 140 74113 0.51% 141 80022 0.55% 142 85652 0.59% 143 93452 0.64% 144 105273 0.72% 145 120240 0.82% 146 143718 0.98% 147 186066 1.27% 148 267219 1.83% 149 515171 3.52% 150 2966466 20.29% 151 8600959 58.84% 14617870 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=6.17 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=516.24 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=35.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=469.23 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=33.4 sequence=AAGAAGAAGAAA SRR7172652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:16:22 Started mapping on | Feb 10 16:16:22 Finished on | Feb 10 16:21:55 Mapping speed, Million of reads per hour | 158.03 Number of input reads | 14617870 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11704150 Uniquely mapped reads % | 80.07% Average mapped length | 294.95 Number of splices: Total | 12053249 Number of splices: Annotated (sjdb) | 11835134 Number of splices: GT/AG | 11858071 Number of splices: GC/AG | 152927 Number of splices: AT/AC | 9967 Number of splices: Non-canonical | 32284 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353130 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 42874 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.11% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2575408 2575408 2575408 N_multimapping 353130 353130 353130 N_noFeature 264707 11611231 299186 N_ambiguous 118657 642 59924 UnstrandedReadsAssigned:11320786 PositiveStrandReadsAssigned:92277 NegativeStrandReadsAssigned:11345040 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172652-trimmed-pair1.fastq SRR7172652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,617,870 reads, 11,336,231 reads pseudoaligned [quant] estimated average fragment length: 229.538 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7172652.ke.tsv 34699 SRR7172652.se.tsv 87100 total ==> SRR7172652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.46 897 41.025 Potri.005G024800.1.v4.1 1035 806.462 322 32.6776 Potri.004G059700.1.v4.1 961 732.479 55 6.14533 Potri.007G009000.2.v4.1 1416 1187.46 0 0 Potri.003G141000.2.v4.1 2943 2714.46 297 8.9547 Potri.016G087400.1.v4.1 270 80.8568 1020 1032.43 Potri.015G069301.1.v4.1 564 337.985 0 0 Potri.010G195200.1.v4.1 1773 1544.46 421.735 22.3481 Potri.012G127500.1.v4.1 977 748.468 6340 693.257 ==> SRR7172652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 362 SRR7172652 completed mapping pipeline successfully