Starting /dee2/code/volunteer_pipeline.sh SRR7172653 current disk space = 3058614726656 free memory = 1054085460 SRR7172653 SRAfilesize 9e72a6cc47a974996ba959547183e626 SRR7172653.sra SRR7172653.sra file validated SRR7172653 is paired end SRR7172653 is conventional basespace SRR7172653 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172653_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.25825 18.0 18.0 31.0 18.0 32.0 2 27.699 29.0 25.0 31.0 18.0 33.0 3 30.57475 31.0 29.0 33.0 27.0 33.0 4 31.3195 33.0 31.0 33.0 29.0 33.0 5 32.22225 33.0 32.0 33.0 31.0 33.0 6 37.081 38.0 37.0 38.0 36.0 38.0 7 37.38325 38.0 38.0 38.0 37.0 38.0 8 37.59725 38.0 38.0 38.0 37.0 38.0 9 37.61475 38.0 38.0 38.0 38.0 38.0 10-14 37.54 38.0 38.0 38.0 37.8 38.0 15-19 37.539100000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.51005 38.0 38.0 38.0 38.0 38.0 25-29 37.56139999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5498 38.0 38.0 38.0 38.0 38.0 35-39 37.5288 38.0 38.0 38.0 38.0 38.0 40-44 37.414249999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.38325 38.0 38.0 38.0 37.0 38.0 50-54 37.4045 38.0 38.0 38.0 37.0 38.0 55-59 37.29115 38.0 38.0 38.0 36.8 38.0 60-64 37.26285 38.0 38.0 38.0 36.8 38.0 65-69 37.25295 38.0 38.0 38.0 36.6 38.0 70-74 37.16945 38.0 38.0 38.0 36.2 38.0 75-79 37.09745 38.0 38.0 38.0 36.2 38.0 80-84 36.9877 38.0 38.0 38.0 36.0 38.0 85-89 36.903600000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.859 38.0 38.0 38.0 35.4 38.0 95-99 36.8654 38.0 38.0 38.0 35.2 38.0 100-104 36.662 38.0 38.0 38.0 34.4 38.0 105-109 36.4469 38.0 38.0 38.0 34.0 38.0 110-114 36.266650000000006 38.0 38.0 38.0 33.6 38.0 115-119 36.287699999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.1424 38.0 37.6 38.0 33.4 38.0 125-129 35.779050000000005 38.0 36.8 38.0 32.0 38.0 130-134 35.092349999999996 38.0 35.4 38.0 28.6 38.0 135-139 35.0165 38.0 35.6 38.0 27.8 38.0 140-144 34.95305 38.0 35.2 38.0 28.2 38.0 145-149 34.34755 38.0 35.2 38.0 26.0 38.0 150-151 30.98075 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 0.0 19 0.0 20 3.0 21 5.0 22 6.0 23 5.0 24 6.0 25 10.0 26 6.0 27 15.0 28 27.0 29 29.0 30 37.0 31 58.0 32 63.0 33 107.0 34 158.0 35 293.0 36 702.0 37 2465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.47959183673469 17.551020408163264 11.83673469387755 34.13265306122449 2 20.24108488196886 20.24108488196886 35.635359116022094 23.88247112004018 3 18.525 25.374999999999996 28.549999999999997 27.55 4 22.075 33.75 22.625 21.55 5 20.599999999999998 36.125 24.45 18.825 6 16.950000000000003 37.65 24.45 20.95 7 13.925 21.575 45.5 19.0 8 17.175 21.725 29.975 31.125000000000004 9 17.75 22.900000000000002 32.775 26.575 10-14 19.52 29.830000000000002 26.655 23.995 15-19 19.495 28.725 27.83 23.95 20-24 19.81 28.27 28.4 23.52 25-29 20.005 28.475 27.91 23.61 30-34 19.755 28.754999999999995 27.800000000000004 23.69 35-39 19.84 28.165000000000003 28.115000000000002 23.880000000000003 40-44 20.1 28.58 28.03 23.29 45-49 20.26 28.384999999999998 27.79 23.565 50-54 19.675 28.610000000000003 28.24 23.474999999999998 55-59 19.62 28.494999999999997 28.57 23.315 60-64 20.24 28.17 27.825 23.765 65-69 20.03 27.975 28.035 23.96 70-74 19.965 28.21 28.23 23.595 75-79 19.42 28.660000000000004 28.275 23.645 80-84 19.759999999999998 28.265 27.644999999999996 24.33 85-89 19.685 28.17 28.27 23.875 90-94 19.735 28.065 28.23 23.97 95-99 20.585 28.065 27.98 23.369999999999997 100-104 20.724999999999998 27.675 27.93 23.669999999999998 105-109 20.25 28.035 28.575 23.14 110-114 20.775 28.115000000000002 27.55 23.56 115-119 20.51 28.1 27.865000000000002 23.525 120-124 20.62 28.075 27.74 23.565 125-129 20.105 27.97 28.315 23.61 130-134 21.135 27.6 27.700000000000003 23.565 135-139 20.465 28.249999999999996 27.715 23.57 140-144 20.990000000000002 28.27 27.255000000000003 23.485 145-149 21.335 28.035 27.54 23.09 150-151 21.05 28.287499999999998 26.8125 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 2.5 25 3.0 26 5.5 27 9.5 28 12.0 29 13.0 30 20.5 31 28.0 32 29.5 33 34.5 34 46.0 35 64.5 36 90.0 37 105.5 38 151.5 39 196.0 40 206.0 41 235.5 42 264.0 43 275.0 44 273.0 45 269.0 46 271.5 47 268.0 48 228.0 49 183.5 50 157.0 51 128.0 52 101.5 53 79.5 54 58.0 55 44.0 56 39.5 57 28.0 58 17.5 59 16.5 60 14.5 61 8.0 62 3.5 63 2.0 64 1.5 65 2.0 66 2.5 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAGT 10 0.006830828 145.0 2 >>END_MODULE SRR7172653 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172653_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94175 34.0 33.0 34.0 32.0 34.0 2 32.9705 34.0 33.0 34.0 32.0 34.0 3 33.02 34.0 33.0 34.0 32.0 34.0 4 33.01675 34.0 33.0 34.0 33.0 34.0 5 32.97125 34.0 33.0 34.0 32.0 34.0 6 37.1065 38.0 38.0 38.0 37.0 38.0 7 37.13475 38.0 38.0 38.0 37.0 38.0 8 37.10925 38.0 38.0 38.0 37.0 38.0 9 37.0785 38.0 38.0 38.0 37.0 38.0 10-14 36.97885 38.0 38.0 38.0 36.6 38.0 15-19 37.0209 38.0 38.0 38.0 37.0 38.0 20-24 37.01950000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.776349999999994 38.0 38.0 38.0 36.4 38.0 30-34 36.305899999999994 38.0 38.0 38.0 35.8 38.0 35-39 36.455600000000004 38.0 38.0 38.0 35.4 38.0 40-44 36.773900000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.84425 38.0 38.0 38.0 36.4 38.0 50-54 36.795849999999994 38.0 38.0 38.0 36.6 38.0 55-59 36.7552 38.0 38.0 38.0 36.0 38.0 60-64 36.5124 38.0 38.0 38.0 35.4 38.0 65-69 36.43205 38.0 38.0 38.0 34.8 38.0 70-74 36.3729 38.0 38.0 38.0 34.2 38.0 75-79 36.26345 38.0 38.0 38.0 33.8 38.0 80-84 36.202000000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.10225 38.0 38.0 38.0 33.8 38.0 90-94 36.0723 38.0 38.0 38.0 33.8 38.0 95-99 36.0987 38.0 38.0 38.0 33.8 38.0 100-104 35.940599999999996 38.0 38.0 38.0 33.4 38.0 105-109 35.85 38.0 38.0 38.0 33.0 38.0 110-114 35.68705 38.0 37.6 38.0 32.0 38.0 115-119 35.36685 38.0 37.0 38.0 30.6 38.0 120-124 35.14155 38.0 36.6 38.0 29.4 38.0 125-129 34.77055 38.0 35.8 38.0 27.2 38.0 130-134 34.4062 38.0 35.2 38.0 24.8 38.0 135-139 33.87015000000001 38.0 33.6 38.0 22.6 38.0 140-144 33.377250000000004 38.0 33.0 38.0 18.6 38.0 145-149 32.277499999999996 38.0 33.0 38.0 10.8 38.0 150-151 28.0885 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 6.0 5 2.0 6 4.0 7 4.0 8 2.0 9 3.0 10 1.0 11 2.0 12 3.0 13 3.0 14 2.0 15 2.0 16 2.0 17 5.0 18 8.0 19 6.0 20 3.0 21 8.0 22 15.0 23 9.0 24 17.0 25 21.0 26 27.0 27 28.0 28 31.0 29 28.0 30 50.0 31 63.0 32 79.0 33 103.0 34 189.0 35 260.0 36 575.0 37 2418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15 17.599999999999998 16.3 26.950000000000003 2 26.0 23.674999999999997 33.550000000000004 16.775000000000002 3 21.175 26.724999999999998 31.1 21.0 4 23.7 36.125 21.975 18.2 5 24.525 37.425000000000004 20.7 17.349999999999998 6 19.6 37.05 24.474999999999998 18.875 7 18.8 16.75 43.025000000000006 21.425 8 20.724999999999998 22.725 29.049999999999997 27.500000000000004 9 22.8 25.374999999999996 28.15 23.674999999999997 10-14 23.27 28.375 27.025 21.33 15-19 23.11 28.544999999999998 27.685 20.66 20-24 23.135 28.28 28.605000000000004 19.98 25-29 23.12710120929299 28.11982538009935 28.230217271313162 20.522856139294497 30-34 23.15478915509436 28.216084236227683 27.6921511775777 20.93697543110026 35-39 23.03472571716155 28.47508807247106 27.946653246099647 20.54353296426774 40-44 22.994999999999997 28.22 28.095 20.69 45-49 23.385 28.185 28.27 20.16 50-54 22.835 27.735 28.139999999999997 21.29 55-59 23.285 28.244999999999997 27.705000000000002 20.765 60-64 22.98 28.7 27.865000000000002 20.455000000000002 65-69 23.189999999999998 28.485 27.555000000000003 20.77 70-74 23.56 27.944999999999997 27.975 20.52 75-79 22.939999999999998 27.755000000000003 28.439999999999998 20.865000000000002 80-84 23.41 28.555000000000003 27.52 20.515 85-89 23.315 28.395 27.755000000000003 20.535 90-94 23.73 28.02 27.98 20.27 95-99 23.474999999999998 27.925 27.77 20.830000000000002 100-104 23.369999999999997 28.694999999999997 28.075 19.86 105-109 23.369999999999997 28.715000000000003 27.634999999999998 20.28 110-114 23.61 28.470000000000002 27.855 20.064999999999998 115-119 23.375 27.889999999999997 28.105000000000004 20.630000000000003 120-124 23.41 28.265 28.000000000000004 20.325 125-129 23.849999999999998 29.18 27.63 19.34 130-134 23.96 27.985 27.855 20.200000000000003 135-139 24.455 28.02 27.265 20.26 140-144 24.685000000000002 28.54 27.18 19.595000000000002 145-149 24.9 28.1 27.395000000000003 19.605 150-151 25.525 28.375 27.1375 18.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 4.0 26 2.5 27 3.0 28 4.0 29 7.0 30 12.5 31 16.5 32 20.5 33 26.0 34 47.5 35 67.0 36 83.0 37 111.0 38 142.0 39 185.5 40 215.0 41 250.5 42 295.0 43 306.5 44 287.0 45 257.5 46 252.0 47 253.5 48 229.5 49 209.0 50 163.5 51 108.5 52 99.5 53 85.5 54 59.5 55 39.5 56 30.5 57 29.0 58 22.5 59 15.5 60 11.5 61 9.5 62 8.5 63 6.0 64 4.0 65 2.5 66 2.0 67 2.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.35500000000000004 30-34 1.7049999999999998 35-39 0.65 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.9124999999999996 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8499999999999996 0.0 0.0 0.0 0.0 138-139 4.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGACC 10 0.006830828 145.0 2 >>END_MODULE Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706065 spots for SRR7172653.sra Written 706065 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra Read 706050 spots for SRR7172653.sra Written 706050 spots for SRR7172653.sra SRR ids: ['SRR7172653.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l2ikro1k SRR7172653.sra spots: 14121015 blocks: [[1, 706050], [706051, 1412100], [1412101, 2118150], [2118151, 2824200], [2824201, 3530250], [3530251, 4236300], [4236301, 4942350], [4942351, 5648400], [5648401, 6354450], [6354451, 7060500], [7060501, 7766550], [7766551, 8472600], [8472601, 9178650], [9178651, 9884700], [9884701, 10590750], [10590751, 11296800], [11296801, 12002850], [12002851, 12708900], [12708901, 13414950], [13414951, 14121015]] SRR7172653 file size 4763448 SRR7172653 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172653 SRR7172653_1.fastq SRR7172653_2.fastq Input file: SRR7172653_1.fastq Paired file: SRR7172653_2.fastq trimmed: SRR7172653-trimmed-pair1.fastq, SRR7172653-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:01:01 2025 >> started Mon Feb 10 16:01:15 2025 >> done (14.525s) 14121015 read pairs processed; of these: 18029 ( 0.13%) short read pairs filtered out after trimming by size control 10460 ( 0.07%) empty read pairs filtered out after trimming by size control 14092526 (99.80%) read pairs available; of these: 5697182 (40.43%) trimmed read pairs available after processing 8395344 (59.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 2 0.00% 28 5 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 2 0.00% 34 2 0.00% 35 6 0.00% 36 2 0.00% 37 5 0.00% 38 1 0.00% 39 4 0.00% 40 5 0.00% 41 6 0.00% 42 7 0.00% 43 10 0.00% 44 7 0.00% 45 5 0.00% 46 11 0.00% 47 8 0.00% 48 15 0.00% 49 10 0.00% 50 15 0.00% 51 14 0.00% 52 17 0.00% 53 13 0.00% 54 24 0.00% 55 17 0.00% 56 30 0.00% 57 43 0.00% 58 38 0.00% 59 40 0.00% 60 52 0.00% 61 44 0.00% 62 51 0.00% 63 80 0.00% 64 82 0.00% 65 100 0.00% 66 99 0.00% 67 128 0.00% 68 126 0.00% 69 135 0.00% 70 170 0.00% 71 209 0.00% 72 251 0.00% 73 232 0.00% 74 306 0.00% 75 363 0.00% 76 428 0.00% 77 467 0.00% 78 504 0.00% 79 581 0.00% 80 699 0.00% 81 733 0.01% 82 897 0.01% 83 1017 0.01% 84 1903 0.01% 85 2562 0.02% 86 2592 0.02% 87 2837 0.02% 88 3104 0.02% 89 3030 0.02% 90 3293 0.02% 91 3565 0.03% 92 3852 0.03% 93 4069 0.03% 94 4495 0.03% 95 4670 0.03% 96 5132 0.04% 97 5311 0.04% 98 5734 0.04% 99 6025 0.04% 100 6684 0.05% 101 7162 0.05% 102 7839 0.06% 103 8307 0.06% 104 8865 0.06% 105 9578 0.07% 106 10234 0.07% 107 10797 0.08% 108 11324 0.08% 109 12139 0.09% 110 12959 0.09% 111 13583 0.10% 112 14750 0.10% 113 15769 0.11% 114 16506 0.12% 115 17573 0.12% 116 18570 0.13% 117 19502 0.14% 118 20073 0.14% 119 20908 0.15% 120 21917 0.16% 121 23216 0.16% 122 24358 0.17% 123 25782 0.18% 124 27379 0.19% 125 28428 0.20% 126 29951 0.21% 127 31215 0.22% 128 32709 0.23% 129 34128 0.24% 130 35983 0.26% 131 37202 0.26% 132 39969 0.28% 133 42261 0.30% 134 44675 0.32% 135 47094 0.33% 136 50010 0.35% 137 52508 0.37% 138 55493 0.39% 139 59301 0.42% 140 64108 0.45% 141 70436 0.50% 142 76756 0.54% 143 85416 0.61% 144 98395 0.70% 145 114878 0.82% 146 140053 0.99% 147 185404 1.32% 148 272835 1.94% 149 536192 3.80% 150 2975682 21.12% 151 8395344 59.57% 14092526 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.96 fanout-score-rank=12 prefix-density=0.46 prefix-fanout=4.0 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=41.43 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.7 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=31 prefix-density=0.29 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=85.90 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.8 sequence=AGGAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCC SRR7172653 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:02:13 Started mapping on | Feb 10 16:02:13 Finished on | Feb 10 16:04:27 Mapping speed, Million of reads per hour | 378.61 Number of input reads | 14092526 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13017242 Uniquely mapped reads % | 92.37% Average mapped length | 295.81 Number of splices: Total | 13046571 Number of splices: Annotated (sjdb) | 12802058 Number of splices: GT/AG | 12833002 Number of splices: GC/AG | 170402 Number of splices: AT/AC | 9853 Number of splices: Non-canonical | 33314 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317865 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 55589 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.88% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 774096 774096 774096 N_multimapping 317865 317865 317865 N_noFeature 360258 12912515 404616 N_ambiguous 133436 559 72802 UnstrandedReadsAssigned:12523548 PositiveStrandReadsAssigned:104168 NegativeStrandReadsAssigned:12539824 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172653 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172653-trimmed-pair1.fastq SRR7172653-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,092,526 reads, 12,509,592 reads pseudoaligned [quant] estimated average fragment length: 244.94 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7172653.ke.tsv 34699 SRR7172653.se.tsv 87100 total ==> SRR7172653.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.06 1461 68.9907 Potri.005G024800.1.v4.1 1035 791.06 410 43.4193 Potri.004G059700.1.v4.1 961 717.086 32 3.73841 Potri.007G009000.2.v4.1 1416 1172.06 0 0 Potri.003G141000.2.v4.1 2943 2699.06 417.14 12.9473 Potri.016G087400.1.v4.1 270 77.139 528 573.414 Potri.015G069301.1.v4.1 564 324.809 0 0 Potri.010G195200.1.v4.1 1773 1529.06 390 21.3673 Potri.012G127500.1.v4.1 977 733.076 9467 1081.86 ==> SRR7172653.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 348 SRR7172653 completed mapping pipeline successfully