Starting /dee2/code/volunteer_pipeline.sh SRR7172654 current disk space = 3058434723840 free memory = 1485067200 SRR7172654 SRAfilesize f3b86cad564e81cecc6ba765ddaa7b89 SRR7172654.sra SRR7172654.sra file validated SRR7172654 is paired end SRR7172654 is conventional basespace SRR7172654 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172654_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.68725 25.0 18.0 32.0 18.0 33.0 2 28.2655 29.0 27.0 33.0 18.0 33.0 3 30.9045 33.0 30.0 33.0 27.0 33.0 4 31.229 33.0 31.0 33.0 29.0 33.0 5 32.3785 33.0 33.0 33.0 32.0 34.0 6 36.734 38.0 37.0 38.0 35.0 38.0 7 37.18725 38.0 38.0 38.0 36.0 38.0 8 37.47075 38.0 38.0 38.0 37.0 38.0 9 37.578 38.0 38.0 38.0 38.0 38.0 10-14 37.533300000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.521249999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.562200000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.586 38.0 38.0 38.0 38.0 38.0 30-34 37.577000000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4808 38.0 38.0 38.0 38.0 38.0 40-44 37.373200000000004 38.0 38.0 38.0 37.4 38.0 45-49 37.366200000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.3455 38.0 38.0 38.0 37.0 38.0 55-59 37.307849999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.29115 38.0 38.0 38.0 37.0 38.0 65-69 37.2473 38.0 38.0 38.0 37.0 38.0 70-74 37.162099999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.05905 38.0 38.0 38.0 36.0 38.0 80-84 36.9985 38.0 38.0 38.0 36.0 38.0 85-89 36.84845 38.0 38.0 38.0 35.4 38.0 90-94 36.84255 38.0 38.0 38.0 35.4 38.0 95-99 36.7794 38.0 38.0 38.0 35.2 38.0 100-104 36.643950000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.474650000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.25405000000001 38.0 38.0 38.0 33.8 38.0 115-119 36.314299999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.162850000000006 38.0 37.8 38.0 33.6 38.0 125-129 35.8601 38.0 36.8 38.0 32.2 38.0 130-134 35.1237 38.0 35.6 38.0 28.4 38.0 135-139 35.09715 38.0 35.8 38.0 28.2 38.0 140-144 34.84985 38.0 35.0 38.0 28.0 38.0 145-149 34.464600000000004 38.0 35.2 38.0 28.0 38.0 150-151 30.758 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 3.0 21 1.0 22 4.0 23 6.0 24 9.0 25 11.0 26 16.0 27 16.0 28 27.0 29 31.0 30 32.0 31 55.0 32 75.0 33 91.0 34 133.0 35 272.0 36 681.0 37 2528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.55564043799338 15.406162464985995 12.936083524318818 37.1021135727018 2 20.186023127199597 19.40673705379588 36.450477626948214 23.95676219205631 3 19.975 24.725 26.474999999999998 28.825 4 22.95 33.275 21.2 22.575 5 20.125 35.6 25.624999999999996 18.65 6 17.175 35.175 26.875 20.775 7 12.775 22.55 44.975 19.7 8 18.125 23.0 31.55 27.325 9 17.8 23.575 33.45 25.174999999999997 10-14 19.285 30.104999999999997 27.27 23.34 15-19 20.035 28.29 28.48 23.195 20-24 19.23 28.685 27.839999999999996 24.245 25-29 19.465 29.085 27.939999999999998 23.51 30-34 19.85 28.375 28.560000000000002 23.215 35-39 19.605 28.52 27.800000000000004 24.075 40-44 19.97 28.754999999999995 27.415 23.86 45-49 20.05 28.335 28.575 23.04 50-54 19.814999999999998 28.499999999999996 27.894999999999996 23.79 55-59 20.09 28.749999999999996 27.515 23.645 60-64 19.81 29.095 27.505000000000003 23.59 65-69 20.175 28.705000000000002 27.750000000000004 23.369999999999997 70-74 20.365 27.634999999999998 28.225 23.775 75-79 19.965 28.485 27.555000000000003 23.995 80-84 19.77 28.645 27.779999999999998 23.805 85-89 20.05 28.110000000000003 28.060000000000002 23.78 90-94 20.064999999999998 28.299999999999997 27.715 23.919999999999998 95-99 20.005 28.315 27.72 23.96 100-104 20.75 27.944999999999997 28.244999999999997 23.06 105-109 20.39 27.655 28.09 23.865 110-114 20.665 28.49 27.355 23.49 115-119 20.345 28.565 27.38 23.71 120-124 21.005 28.025 27.250000000000004 23.72 125-129 20.175 28.194999999999997 28.060000000000002 23.57 130-134 20.94 28.055000000000003 27.834999999999997 23.169999999999998 135-139 20.86 28.155 27.615000000000002 23.369999999999997 140-144 21.075 27.584999999999997 27.22 24.12 145-149 21.02 28.43 26.77 23.78 150-151 21.15 28.975 26.674999999999997 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 1.0 25 3.0 26 4.5 27 4.5 28 6.5 29 12.0 30 16.0 31 18.0 32 26.5 33 45.0 34 57.5 35 74.0 36 97.5 37 117.5 38 150.5 39 171.5 40 208.0 41 242.5 42 261.5 43 281.5 44 274.5 45 285.5 46 274.0 47 243.0 48 229.5 49 197.5 50 164.0 51 128.0 52 102.5 53 79.5 54 57.0 55 44.5 56 30.0 57 25.0 58 15.5 59 8.0 60 6.0 61 6.0 62 7.0 63 4.5 64 3.0 65 2.0 66 0.5 67 0.0 68 1.5 69 2.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.512499999999999 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172654 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172654_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.125 34.0 33.0 34.0 32.0 34.0 2 33.1225 34.0 33.0 34.0 32.0 34.0 3 33.1555 34.0 33.0 34.0 33.0 34.0 4 33.146 34.0 33.0 34.0 33.0 34.0 5 33.08325 34.0 33.0 34.0 33.0 34.0 6 37.23675 38.0 38.0 38.0 37.0 38.0 7 37.23075 38.0 38.0 38.0 37.0 38.0 8 37.21775 38.0 38.0 38.0 37.0 38.0 9 37.2315 38.0 38.0 38.0 37.0 38.0 10-14 37.12055 38.0 38.0 38.0 37.0 38.0 15-19 37.22585 38.0 38.0 38.0 37.2 38.0 20-24 37.2015 38.0 38.0 38.0 37.2 38.0 25-29 37.027699999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.5653 38.0 38.0 38.0 36.2 38.0 35-39 36.7027 38.0 38.0 38.0 36.0 38.0 40-44 37.02909999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.060050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.039100000000005 38.0 38.0 38.0 37.0 38.0 55-59 36.9319 38.0 38.0 38.0 36.4 38.0 60-64 36.7736 38.0 38.0 38.0 36.0 38.0 65-69 36.6541 38.0 38.0 38.0 35.2 38.0 70-74 36.6888 38.0 38.0 38.0 35.4 38.0 75-79 36.5725 38.0 38.0 38.0 34.6 38.0 80-84 36.50765 38.0 38.0 38.0 34.4 38.0 85-89 36.402249999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.30055 38.0 38.0 38.0 34.0 38.0 95-99 36.3173 38.0 38.0 38.0 34.0 38.0 100-104 36.1978 38.0 38.0 38.0 33.8 38.0 105-109 36.1853 38.0 38.0 38.0 34.0 38.0 110-114 35.98465 38.0 37.6 38.0 33.6 38.0 115-119 35.669650000000004 38.0 37.0 38.0 31.2 38.0 120-124 35.5025 38.0 36.8 38.0 30.6 38.0 125-129 35.18769999999999 38.0 36.0 38.0 29.0 38.0 130-134 34.7402 38.0 35.4 38.0 27.0 38.0 135-139 34.3989 38.0 34.6 38.0 25.8 38.0 140-144 33.78645 38.0 33.4 38.0 22.8 38.0 145-149 32.7393 38.0 33.0 38.0 13.2 38.0 150-151 28.389249999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 3.0 6 3.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 2.0 13 3.0 14 0.0 15 1.0 16 5.0 17 4.0 18 4.0 19 3.0 20 7.0 21 5.0 22 3.0 23 7.0 24 13.0 25 18.0 26 16.0 27 35.0 28 27.0 29 40.0 30 48.0 31 55.0 32 84.0 33 123.0 34 154.0 35 251.0 36 610.0 37 2456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.975 16.650000000000002 16.825000000000003 27.55 2 24.525 23.75 34.35 17.375 3 20.525 28.375 30.625000000000004 20.474999999999998 4 24.15 33.75 22.175 19.925 5 23.65 36.8 22.75 16.8 6 19.025 37.525 24.75 18.7 7 18.375 18.25 41.699999999999996 21.675 8 20.75 22.7 27.700000000000003 28.849999999999998 9 22.875 26.075 27.175 23.875 10-14 22.825 28.625 26.6 21.95 15-19 23.580000000000002 28.355000000000004 28.015 20.05 20-24 23.22 28.87 27.229999999999997 20.68 25-29 22.699232659611816 28.717588645368373 28.000401223732386 20.58277747128743 30-34 23.39798923530009 28.612775464608507 27.16055651467452 20.82867878541688 35-39 22.996428032399255 28.520400462846506 27.931780449766062 20.551391054988176 40-44 22.96 28.084999999999997 28.23 20.724999999999998 45-49 22.835 28.439999999999998 28.23 20.495 50-54 23.195 28.03 28.17 20.605 55-59 23.915 27.92 27.815 20.349999999999998 60-64 23.715 27.634999999999998 28.285 20.365 65-69 23.54 28.32 27.845 20.294999999999998 70-74 23.355 27.99 27.98 20.674999999999997 75-79 23.625 27.98 27.91 20.485 80-84 24.165 28.075 27.41 20.349999999999998 85-89 23.474999999999998 28.610000000000003 27.495000000000005 20.419999999999998 90-94 24.36 28.689999999999998 26.88 20.07 95-99 23.625 28.299999999999997 27.955000000000002 20.119999999999997 100-104 23.41 28.395 27.325 20.87 105-109 23.485 28.139999999999997 28.04 20.335 110-114 23.625 27.82 28.15 20.405 115-119 23.905 28.485 27.47 20.14 120-124 24.42 28.475 27.265 19.84 125-129 24.07 28.325 27.485 20.119999999999997 130-134 24.240000000000002 27.665 27.88 20.215 135-139 24.01 28.935 27.32 19.735 140-144 24.785 27.91 27.779999999999998 19.525000000000002 145-149 25.490000000000002 27.24 28.03 19.24 150-151 25.924999999999997 27.487499999999997 26.787499999999998 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 4.0 28 5.5 29 8.0 30 7.0 31 16.0 32 28.5 33 31.0 34 39.0 35 57.0 36 67.0 37 93.5 38 139.5 39 185.5 40 232.0 41 254.5 42 279.0 43 293.5 44 287.0 45 288.0 46 282.0 47 253.0 48 217.0 49 201.0 50 179.0 51 132.0 52 100.5 53 80.0 54 62.5 55 48.0 56 31.0 57 21.5 58 16.5 59 14.0 60 11.0 61 7.0 62 4.5 63 4.5 64 3.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.305 30-34 1.53 35-39 0.615 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.025 0.0 120-121 1.95 0.0 0.0 0.025 0.0 122-123 2.175 0.0 0.0 0.025 0.0 124-125 2.3625 0.0 0.0 0.025 0.0 126-127 2.6875 0.0 0.0 0.025 0.0 128-129 3.075 0.0 0.0 0.025 0.0 130-131 3.65 0.0 0.0 0.025 0.0 132-133 4.0625 0.0 0.0 0.025 0.0 134-135 4.4 0.0 0.0 0.025 0.0 136-137 4.9 0.0 0.0 0.025 0.0 138-139 5.425000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTC 10 0.00686971 144.72499 2 >>END_MODULE Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716756 spots for SRR7172654.sra Written 716756 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra Read 716741 spots for SRR7172654.sra Written 716741 spots for SRR7172654.sra SRR ids: ['SRR7172654.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5xus6hbp SRR7172654.sra spots: 14334835 blocks: [[1, 716741], [716742, 1433482], [1433483, 2150223], [2150224, 2866964], [2866965, 3583705], [3583706, 4300446], [4300447, 5017187], [5017188, 5733928], [5733929, 6450669], [6450670, 7167410], [7167411, 7884151], [7884152, 8600892], [8600893, 9317633], [9317634, 10034374], [10034375, 10751115], [10751116, 11467856], [11467857, 12184597], [12184598, 12901338], [12901339, 13618079], [13618080, 14334835]] SRR7172654 file size 4835904 SRR7172654 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172654 SRR7172654_1.fastq SRR7172654_2.fastq Input file: SRR7172654_1.fastq Paired file: SRR7172654_2.fastq trimmed: SRR7172654-trimmed-pair1.fastq, SRR7172654-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:28:01 2025 >> started Mon Feb 10 16:28:16 2025 >> done (14.441s) 14334835 read pairs processed; of these: 19623 ( 0.14%) short read pairs filtered out after trimming by size control 14382 ( 0.10%) empty read pairs filtered out after trimming by size control 14300830 (99.76%) read pairs available; of these: 5766950 (40.33%) trimmed read pairs available after processing 8533880 (59.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 3 0.00% 28 0 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 5 0.00% 38 6 0.00% 39 3 0.00% 40 6 0.00% 41 2 0.00% 42 3 0.00% 43 5 0.00% 44 3 0.00% 45 12 0.00% 46 13 0.00% 47 4 0.00% 48 7 0.00% 49 6 0.00% 50 13 0.00% 51 14 0.00% 52 12 0.00% 53 20 0.00% 54 24 0.00% 55 18 0.00% 56 21 0.00% 57 28 0.00% 58 48 0.00% 59 31 0.00% 60 46 0.00% 61 54 0.00% 62 76 0.00% 63 63 0.00% 64 78 0.00% 65 105 0.00% 66 102 0.00% 67 126 0.00% 68 161 0.00% 69 152 0.00% 70 180 0.00% 71 210 0.00% 72 279 0.00% 73 292 0.00% 74 324 0.00% 75 353 0.00% 76 468 0.00% 77 500 0.00% 78 577 0.00% 79 627 0.00% 80 738 0.01% 81 857 0.01% 82 1098 0.01% 83 1223 0.01% 84 2187 0.02% 85 2797 0.02% 86 3022 0.02% 87 3055 0.02% 88 3307 0.02% 89 3248 0.02% 90 3640 0.03% 91 3910 0.03% 92 4194 0.03% 93 4333 0.03% 94 4692 0.03% 95 5148 0.04% 96 5678 0.04% 97 5905 0.04% 98 6302 0.04% 99 6963 0.05% 100 7373 0.05% 101 7723 0.05% 102 8560 0.06% 103 9110 0.06% 104 9842 0.07% 105 10463 0.07% 106 11329 0.08% 107 11930 0.08% 108 12610 0.09% 109 13343 0.09% 110 14069 0.10% 111 15103 0.11% 112 16109 0.11% 113 16842 0.12% 114 18065 0.13% 115 19154 0.13% 116 20228 0.14% 117 21334 0.15% 118 22008 0.15% 119 22610 0.16% 120 23791 0.17% 121 25051 0.18% 122 26470 0.19% 123 27652 0.19% 124 29228 0.20% 125 30755 0.22% 126 32043 0.22% 127 33408 0.23% 128 34640 0.24% 129 36143 0.25% 130 37921 0.27% 131 39267 0.27% 132 41518 0.29% 133 43686 0.31% 134 45921 0.32% 135 48809 0.34% 136 51074 0.36% 137 53908 0.38% 138 57022 0.40% 139 60350 0.42% 140 64513 0.45% 141 70029 0.49% 142 76672 0.54% 143 85161 0.60% 144 96890 0.68% 145 112893 0.79% 146 137920 0.96% 147 182605 1.28% 148 267613 1.87% 149 530318 3.71% 150 2998475 20.97% 151 8533880 59.67% 14300830 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=152.62 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.4 sequence=GAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=27 prefix-density=0.60 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=41.29 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=11.5 sequence=GAGGTTGAGTACAGGTGCTTTGTTGGTGGCCTCGCATGGGCCACTACTGACCAATCCCTTCAAGAAGCGTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTAC SRR7172654 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:29:04 Started mapping on | Feb 10 16:29:05 Finished on | Feb 10 16:30:57 Mapping speed, Million of reads per hour | 459.67 Number of input reads | 14300830 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13288539 Uniquely mapped reads % | 92.92% Average mapped length | 295.55 Number of splices: Total | 13387541 Number of splices: Annotated (sjdb) | 13119367 Number of splices: GT/AG | 13181337 Number of splices: GC/AG | 164046 Number of splices: AT/AC | 10395 Number of splices: Non-canonical | 31763 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334397 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 25695 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694513 694513 694513 N_multimapping 334397 334397 334397 N_noFeature 291925 13168133 342726 N_ambiguous 138145 647 68240 UnstrandedReadsAssigned:12858469 PositiveStrandReadsAssigned:119759 NegativeStrandReadsAssigned:12877573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172654 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172654-trimmed-pair1.fastq SRR7172654-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,300,830 reads, 12,819,768 reads pseudoaligned [quant] estimated average fragment length: 237.737 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7172654.ke.tsv 34699 SRR7172654.se.tsv 87100 total ==> SRR7172654.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.26 1238 49.1314 Potri.005G024800.1.v4.1 1035 798.263 729 64.5577 Potri.004G059700.1.v4.1 961 724.278 26 2.53767 Potri.007G009000.2.v4.1 1416 1179.26 0 0 Potri.003G141000.2.v4.1 2943 2706.26 603.582 15.7664 Potri.016G087400.1.v4.1 270 78.2319 1163 1050.9 Potri.015G069301.1.v4.1 564 330.329 0 0 Potri.010G195200.1.v4.1 1773 1536.26 205 9.43311 Potri.012G127500.1.v4.1 977 740.263 1714 163.678 ==> SRR7172654.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 403 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 123 SRR7172654 completed mapping pipeline successfully