Starting /dee2/code/volunteer_pipeline.sh SRR7172655 current disk space = 3058464247808 free memory = 1175379428 SRR7172655 SRAfilesize 368c495d71ed01ece5193e57f967c908 SRR7172655.sra SRR7172655.sra file validated SRR7172655 is paired end SRR7172655 is conventional basespace SRR7172655 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172655_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.03 33.0 33.0 34.0 32.0 34.0 2 32.68 33.0 33.0 34.0 32.0 34.0 3 32.48575 33.0 33.0 34.0 31.0 34.0 4 32.2615 33.0 33.0 33.0 31.0 34.0 5 32.8465 33.0 33.0 34.0 32.0 34.0 6 37.231 38.0 38.0 38.0 36.0 38.0 7 37.55575 38.0 38.0 38.0 37.0 38.0 8 37.65075 38.0 38.0 38.0 38.0 38.0 9 37.67975 38.0 38.0 38.0 38.0 38.0 10-14 37.6582 38.0 38.0 38.0 38.0 38.0 15-19 37.6842 38.0 38.0 38.0 38.0 38.0 20-24 37.613800000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.650999999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.65455 38.0 38.0 38.0 38.0 38.0 35-39 37.6064 38.0 38.0 38.0 38.0 38.0 40-44 37.5193 38.0 38.0 38.0 38.0 38.0 45-49 37.54885 38.0 38.0 38.0 38.0 38.0 50-54 37.49865 38.0 38.0 38.0 37.8 38.0 55-59 37.39615 38.0 38.0 38.0 37.0 38.0 60-64 37.366499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.28339999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.18825 38.0 38.0 38.0 36.6 38.0 75-79 37.15295 38.0 38.0 38.0 36.8 38.0 80-84 37.064 38.0 38.0 38.0 36.0 38.0 85-89 36.87515 38.0 38.0 38.0 35.4 38.0 90-94 37.00025000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.943799999999996 38.0 38.0 38.0 35.8 38.0 100-104 36.735350000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.39495 38.0 38.0 38.0 34.0 38.0 110-114 36.259100000000004 38.0 37.8 38.0 33.8 38.0 115-119 36.1501 38.0 37.8 38.0 33.6 38.0 120-124 36.33235 38.0 38.0 38.0 34.0 38.0 125-129 36.05544999999999 38.0 37.4 38.0 33.2 38.0 130-134 35.66005 38.0 36.4 38.0 31.0 38.0 135-139 35.311800000000005 38.0 36.0 38.0 29.0 38.0 140-144 35.39235 38.0 36.0 38.0 30.6 38.0 145-149 35.183749999999996 38.0 36.0 38.0 30.4 38.0 150-151 31.639 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 3.0 20 2.0 21 4.0 22 3.0 23 5.0 24 7.0 25 10.0 26 13.0 27 15.0 28 12.0 29 18.0 30 27.0 31 37.0 32 65.0 33 86.0 34 129.0 35 213.0 36 607.0 37 2739.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.640724674661904 11.814238326103597 14.416943097729012 42.12809390150549 2 19.085886489201407 18.935208437970868 39.85434455047715 22.124560522350578 3 19.475 25.174999999999997 25.724999999999998 29.625 4 22.675 32.125 22.5 22.7 5 20.0 36.225 25.2 18.575 6 16.6 36.5 26.275 20.625 7 13.450000000000001 20.45 45.975 20.125 8 17.775 22.825 30.099999999999998 29.299999999999997 9 17.474999999999998 21.875 34.425 26.224999999999998 10-14 19.439999999999998 29.349999999999998 27.765 23.445 15-19 19.705000000000002 27.689999999999998 28.405 24.2 20-24 19.445 28.87 27.944999999999997 23.74 25-29 19.634999999999998 28.610000000000003 28.15 23.605 30-34 20.02 28.904999999999998 27.375 23.7 35-39 20.044999999999998 28.15 28.205000000000002 23.599999999999998 40-44 19.650000000000002 28.560000000000002 27.47 24.32 45-49 20.11 28.285 27.705000000000002 23.9 50-54 19.615 28.425 27.82 24.14 55-59 20.035 28.194999999999997 28.165000000000003 23.605 60-64 19.84 28.335 27.705000000000002 24.12 65-69 19.689999999999998 28.194999999999997 28.01 24.104999999999997 70-74 19.72 27.944999999999997 28.415000000000003 23.919999999999998 75-79 19.45 27.750000000000004 28.565 24.235 80-84 20.0 28.439999999999998 27.725 23.835 85-89 19.96 27.785 28.110000000000003 24.145 90-94 20.32 27.944999999999997 27.805000000000003 23.93 95-99 19.805 28.299999999999997 27.605 24.29 100-104 20.3 27.96 27.975 23.765 105-109 20.505000000000003 27.834999999999997 27.894999999999996 23.765 110-114 20.700350175087546 27.423711855927962 28.429214607303656 23.446723361680842 115-119 20.815 28.24 27.62 23.325000000000003 120-124 20.8 27.83 27.725 23.645 125-129 20.294999999999998 28.625 27.375 23.705000000000002 130-134 20.225 28.79 27.284999999999997 23.7 135-139 21.09 28.505000000000003 26.33 24.075 140-144 20.935000000000002 27.884999999999998 27.395000000000003 23.785 145-149 20.810000000000002 27.905 26.615 24.67 150-151 19.8125 28.125 26.787499999999998 25.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 3.0 26 4.0 27 6.0 28 6.5 29 10.0 30 15.5 31 22.0 32 33.0 33 43.5 34 52.5 35 74.5 36 91.0 37 100.5 38 139.0 39 169.0 40 185.5 41 220.5 42 269.0 43 294.5 44 283.0 45 286.0 46 290.0 47 263.5 48 230.5 49 191.0 50 146.0 51 125.0 52 106.0 53 78.5 54 60.5 55 46.0 56 37.0 57 30.0 58 25.5 59 16.0 60 6.0 61 6.0 62 6.5 63 4.5 64 4.0 65 2.5 66 2.0 67 2.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.8375000000000004 0.0 0.0 0.0 0.0 124-125 3.2249999999999996 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 5.60876E-5 20.3 55-59 >>END_MODULE SRR7172655 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172655_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2035 34.0 33.0 34.0 33.0 34.0 2 33.31375 34.0 33.0 34.0 33.0 34.0 3 33.33225 34.0 33.0 34.0 33.0 34.0 4 33.27875 34.0 33.0 34.0 33.0 34.0 5 33.271 34.0 33.0 34.0 33.0 34.0 6 37.392 38.0 38.0 38.0 38.0 38.0 7 37.443 38.0 38.0 38.0 38.0 38.0 8 37.353 38.0 38.0 38.0 38.0 38.0 9 37.3145 38.0 38.0 38.0 38.0 38.0 10-14 37.38395 38.0 38.0 38.0 38.0 38.0 15-19 37.390550000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.341300000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.03835 38.0 38.0 38.0 37.4 38.0 30-34 36.2863 38.0 38.0 38.0 36.4 38.0 35-39 36.60295 38.0 38.0 38.0 36.0 38.0 40-44 37.1846 38.0 38.0 38.0 37.2 38.0 45-49 37.23845 38.0 38.0 38.0 37.4 38.0 50-54 37.191950000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.11015 38.0 38.0 38.0 37.0 38.0 60-64 37.000099999999996 38.0 38.0 38.0 36.8 38.0 65-69 36.93085000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.940099999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.8277 38.0 38.0 38.0 36.0 38.0 80-84 36.855599999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.81849999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.73309999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.66005 38.0 38.0 38.0 35.0 38.0 100-104 36.549150000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.48315 38.0 38.0 38.0 34.4 38.0 110-114 36.299600000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.067 38.0 38.0 38.0 33.4 38.0 120-124 35.88105 38.0 37.6 38.0 32.6 38.0 125-129 35.6755 38.0 36.8 38.0 31.8 38.0 130-134 35.369099999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.13805 38.0 36.0 38.0 30.2 38.0 140-144 34.5914 38.0 35.4 38.0 27.8 38.0 145-149 33.7005 38.0 33.2 38.0 21.6 38.0 150-151 29.296 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 3.0 5 5.0 6 1.0 7 2.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.0 18 3.0 19 3.0 20 8.0 21 6.0 22 10.0 23 7.0 24 9.0 25 10.0 26 10.0 27 14.0 28 21.0 29 21.0 30 38.0 31 42.0 32 65.0 33 103.0 34 161.0 35 266.0 36 529.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 13.0 18.45 33.25 2 23.525 24.275 36.75 15.45 3 21.575 27.150000000000002 30.75 20.525 4 23.825 34.55 21.4 20.225 5 24.375 34.575 24.474999999999998 16.575 6 18.0 37.125 24.9 19.975 7 19.425 17.775 42.1 20.7 8 20.200000000000003 23.674999999999997 27.500000000000004 28.625 9 21.825 25.825 29.675 22.675 10-14 23.1 29.455 25.915 21.529999999999998 15-19 22.735 28.01 28.27 20.985 20-24 23.025000000000002 28.24 27.565 21.17 25-29 23.741188318227593 28.12185297079557 27.09969788519637 21.037260825780464 30-34 22.72236781254817 28.600791326242224 27.37269410616104 21.30414675504856 35-39 23.439161476530458 28.882475062028455 27.176059547318854 20.502303914122233 40-44 23.505000000000003 28.29 27.565 20.64 45-49 23.68 28.050000000000004 28.23 20.04 50-54 23.395 28.125 28.000000000000004 20.48 55-59 23.44 28.634999999999998 27.3 20.625 60-64 23.5 28.67 26.955000000000002 20.875 65-69 23.885 28.605000000000004 26.650000000000002 20.86 70-74 23.68 28.115000000000002 28.08 20.125 75-79 23.94 28.084999999999997 27.36 20.615 80-84 23.87 28.12 27.855 20.155 85-89 24.095 28.58 27.495000000000005 19.830000000000002 90-94 23.724999999999998 28.535 27.560000000000002 20.18 95-99 23.799999999999997 28.084999999999997 28.025 20.09 100-104 24.044999999999998 28.37 27.655 19.93 105-109 23.84 28.715000000000003 27.415 20.03 110-114 24.279999999999998 28.4 26.71 20.61 115-119 24.025 27.88 27.99 20.105 120-124 23.955000000000002 28.525 27.534999999999997 19.985 125-129 23.96 28.189999999999998 27.67 20.18 130-134 24.205 27.725 27.73 20.34 135-139 24.86 28.02 27.42 19.7 140-144 25.169999999999998 28.375 27.245 19.21 145-149 25.069999999999997 27.794999999999998 27.334999999999997 19.8 150-151 25.887500000000003 27.675 27.325 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 3.0 23 3.0 24 1.0 25 1.0 26 2.0 27 3.5 28 4.5 29 5.5 30 6.0 31 10.5 32 17.0 33 30.5 34 50.5 35 69.5 36 82.0 37 100.0 38 137.5 39 173.0 40 217.0 41 235.0 42 262.5 43 286.5 44 285.5 45 299.0 46 284.5 47 250.0 48 219.5 49 209.5 50 172.0 51 132.0 52 116.0 53 86.0 54 65.5 55 49.0 56 32.0 57 28.5 58 21.5 59 13.0 60 12.5 61 8.5 62 2.0 63 3.0 64 3.0 65 0.5 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.7000000000000001 30-34 2.6950000000000003 35-39 1.2550000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.525 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCCT 10 0.006867937 144.7375 4 >>END_MODULE Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734190 spots for SRR7172655.sra Written 734190 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra Read 734186 spots for SRR7172655.sra Written 734186 spots for SRR7172655.sra SRR ids: ['SRR7172655.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kgdgh_sj SRR7172655.sra spots: 14683724 blocks: [[1, 734186], [734187, 1468372], [1468373, 2202558], [2202559, 2936744], [2936745, 3670930], [3670931, 4405116], [4405117, 5139302], [5139303, 5873488], [5873489, 6607674], [6607675, 7341860], [7341861, 8076046], [8076047, 8810232], [8810233, 9544418], [9544419, 10278604], [10278605, 11012790], [11012791, 11746976], [11746977, 12481162], [12481163, 13215348], [13215349, 13949534], [13949535, 14683724]] SRR7172655 file size 4954131 SRR7172655 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172655 SRR7172655_1.fastq SRR7172655_2.fastq Input file: SRR7172655_1.fastq Paired file: SRR7172655_2.fastq trimmed: SRR7172655-trimmed-pair1.fastq, SRR7172655-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:37:25 2025 >> started Mon Feb 10 16:37:43 2025 >> done (17.744s) 14683724 read pairs processed; of these: 12525 ( 0.09%) short read pairs filtered out after trimming by size control 10739 ( 0.07%) empty read pairs filtered out after trimming by size control 14660460 (99.84%) read pairs available; of these: 7294810 (49.76%) trimmed read pairs available after processing 7365650 (50.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 1 0.00% 38 2 0.00% 39 2 0.00% 40 5 0.00% 41 2 0.00% 42 5 0.00% 43 6 0.00% 44 6 0.00% 45 5 0.00% 46 4 0.00% 47 12 0.00% 48 7 0.00% 49 10 0.00% 50 27 0.00% 51 15 0.00% 52 23 0.00% 53 19 0.00% 54 40 0.00% 55 37 0.00% 56 26 0.00% 57 34 0.00% 58 46 0.00% 59 43 0.00% 60 56 0.00% 61 90 0.00% 62 78 0.00% 63 103 0.00% 64 86 0.00% 65 127 0.00% 66 147 0.00% 67 150 0.00% 68 149 0.00% 69 209 0.00% 70 217 0.00% 71 257 0.00% 72 320 0.00% 73 405 0.00% 74 400 0.00% 75 469 0.00% 76 556 0.00% 77 631 0.00% 78 733 0.00% 79 808 0.01% 80 930 0.01% 81 1033 0.01% 82 1173 0.01% 83 1426 0.01% 84 2218 0.02% 85 2679 0.02% 86 3005 0.02% 87 3118 0.02% 88 3338 0.02% 89 3617 0.02% 90 3762 0.03% 91 4189 0.03% 92 4600 0.03% 93 4930 0.03% 94 5414 0.04% 95 5915 0.04% 96 6318 0.04% 97 6996 0.05% 98 7444 0.05% 99 7973 0.05% 100 8700 0.06% 101 9190 0.06% 102 9796 0.07% 103 10591 0.07% 104 11327 0.08% 105 12201 0.08% 106 13106 0.09% 107 13786 0.09% 108 14590 0.10% 109 15447 0.11% 110 16337 0.11% 111 17364 0.12% 112 18136 0.12% 113 19382 0.13% 114 20814 0.14% 115 21729 0.15% 116 22687 0.15% 117 23917 0.16% 118 24890 0.17% 119 25735 0.18% 120 27156 0.19% 121 28419 0.19% 122 30044 0.20% 123 31055 0.21% 124 32687 0.22% 125 33886 0.23% 126 35375 0.24% 127 37375 0.25% 128 38541 0.26% 129 40340 0.28% 130 42515 0.29% 131 43635 0.30% 132 45691 0.31% 133 48803 0.33% 134 50518 0.34% 135 52865 0.36% 136 56114 0.38% 137 59369 0.40% 138 62884 0.43% 139 67047 0.46% 140 71674 0.49% 141 76790 0.52% 142 84429 0.58% 143 92987 0.63% 144 105499 0.72% 145 123109 0.84% 146 151921 1.04% 147 200234 1.37% 148 311977 2.13% 149 727957 4.97% 150 4067717 27.75% 151 7365650 50.24% 14660460 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=28 prefix-density=0.40 prefix-fanout=2.3 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=407.65 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=32.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=30 prefix-density=0.60 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=45.93 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=8.1 sequence=TGATTTTGATCAGTATGGCTGAGGAAAACAAGAGCCATGAGTATGAGACCAAAGTTGGTGAAGAGAGTGGT SRR7172655 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:38:34 Started mapping on | Feb 10 16:38:34 Finished on | Feb 10 16:40:40 Mapping speed, Million of reads per hour | 418.87 Number of input reads | 14660460 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13739861 Uniquely mapped reads % | 93.72% Average mapped length | 294.96 Number of splices: Total | 13986144 Number of splices: Annotated (sjdb) | 13675122 Number of splices: GT/AG | 13755996 Number of splices: GC/AG | 177129 Number of splices: AT/AC | 12214 Number of splices: Non-canonical | 40805 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354246 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 50447 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577011 577011 577011 N_multimapping 354246 354246 354246 N_noFeature 328900 13615830 380360 N_ambiguous 145537 1036 72296 UnstrandedReadsAssigned:13265424 PositiveStrandReadsAssigned:122995 NegativeStrandReadsAssigned:13287205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172655 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172655-trimmed-pair1.fastq SRR7172655-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,660,460 reads, 13,205,897 reads pseudoaligned [quant] estimated average fragment length: 233.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR7172655.ke.tsv 34699 SRR7172655.se.tsv 87100 total ==> SRR7172655.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.69 1428 53.2391 Potri.005G024800.1.v4.1 1035 802.693 1044 86.5886 Potri.004G059700.1.v4.1 961 728.693 8 0.730895 Potri.007G009000.2.v4.1 1416 1183.69 0 0 Potri.003G141000.2.v4.1 2943 2710.69 569.212 13.9799 Potri.016G087400.1.v4.1 270 80.1094 1407 1169.28 Potri.015G069301.1.v4.1 564 334.408 0 0 Potri.010G195200.1.v4.1 1773 1540.69 360 15.5559 Potri.012G127500.1.v4.1 977 744.693 8587 767.668 ==> SRR7172655.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 495 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 396 SRR7172655 completed mapping pipeline successfully