Starting /dee2/code/volunteer_pipeline.sh SRR7172656 current disk space = 3058443603968 free memory = 1033003908 SRR7172656 SRAfilesize 0d9d6c2da7b6198c767887581fa4556c SRR7172656.sra SRR7172656.sra file validated SRR7172656 is paired end SRR7172656 is conventional basespace SRR7172656 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172656_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.66725 18.0 18.0 30.0 18.0 32.0 2 27.73325 29.0 25.0 31.0 18.0 33.0 3 30.614 31.0 29.0 33.0 27.0 33.0 4 31.8085 33.0 31.0 33.0 29.0 33.0 5 32.28025 33.0 33.0 33.0 31.0 34.0 6 36.80125 38.0 37.0 38.0 35.0 38.0 7 37.55475 38.0 38.0 38.0 37.0 38.0 8 37.56675 38.0 38.0 38.0 38.0 38.0 9 37.64625 38.0 38.0 38.0 38.0 38.0 10-14 37.5988 38.0 38.0 38.0 38.0 38.0 15-19 37.60515 38.0 38.0 38.0 38.0 38.0 20-24 37.5593 38.0 38.0 38.0 38.0 38.0 25-29 37.593 38.0 38.0 38.0 38.0 38.0 30-34 37.601600000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.5345 38.0 38.0 38.0 38.0 38.0 40-44 37.419599999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.42305 38.0 38.0 38.0 37.4 38.0 50-54 37.41905 38.0 38.0 38.0 37.2 38.0 55-59 37.343 38.0 38.0 38.0 37.0 38.0 60-64 37.32165 38.0 38.0 38.0 37.0 38.0 65-69 37.275549999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.230599999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.171299999999995 38.0 38.0 38.0 36.4 38.0 80-84 37.093849999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.924099999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.9036 38.0 38.0 38.0 35.4 38.0 95-99 36.929050000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.7892 38.0 38.0 38.0 35.0 38.0 105-109 36.59685 38.0 38.0 38.0 34.2 38.0 110-114 36.41135 38.0 38.0 38.0 34.0 38.0 115-119 36.436899999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.2937 38.0 37.4 38.0 33.8 38.0 125-129 35.92059999999999 38.0 36.8 38.0 32.2 38.0 130-134 35.3387 38.0 35.8 38.0 29.4 38.0 135-139 35.23825 38.0 36.0 38.0 29.6 38.0 140-144 35.0932 38.0 35.6 38.0 28.8 38.0 145-149 34.595600000000005 38.0 35.0 38.0 27.8 38.0 150-151 31.11 36.5 31.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 4.0 22 2.0 23 2.0 24 7.0 25 7.0 26 9.0 27 12.0 28 25.0 29 30.0 30 42.0 31 41.0 32 70.0 33 86.0 34 133.0 35 283.0 36 745.0 37 2494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.255102040816325 15.841836734693878 11.811224489795919 37.09183673469388 2 19.064386317907445 18.98893360160966 37.5251509054326 24.421529175050303 3 18.525 26.275 27.250000000000004 27.950000000000003 4 23.3 33.725 21.2 21.775 5 21.275 34.125 24.3 20.3 6 15.475 36.875 26.3 21.349999999999998 7 13.275 21.5 45.7 19.525000000000002 8 17.675 23.025000000000002 29.425 29.875 9 16.575 23.7 31.424999999999997 28.299999999999997 10-14 19.37 30.025000000000002 26.6 24.005000000000003 15-19 19.42 28.425 27.715 24.44 20-24 19.42 28.67 28.405 23.505000000000003 25-29 19.29 29.23 28.035 23.445 30-34 19.62 29.404999999999998 27.800000000000004 23.175 35-39 19.875 29.215000000000003 27.589999999999996 23.32 40-44 19.825 28.875 27.839999999999996 23.46 45-49 19.31 28.595 27.950000000000003 24.145 50-54 19.695 29.065 27.694999999999997 23.544999999999998 55-59 19.465 28.395 28.15 23.990000000000002 60-64 19.33 28.535 28.044999999999998 24.09 65-69 20.055 28.715000000000003 28.07 23.16 70-74 19.835 28.349999999999998 28.78 23.035 75-79 19.575 28.04 28.265 24.12 80-84 19.84 28.43 28.185 23.544999999999998 85-89 20.005 28.83 28.000000000000004 23.165 90-94 19.885 29.049999999999997 27.62 23.445 95-99 19.52 28.065 28.24 24.175 100-104 20.01 28.189999999999998 27.915 23.885 105-109 20.32 27.894999999999996 28.055000000000003 23.73 110-114 19.895 27.805000000000003 28.189999999999998 24.11 115-119 20.24 27.875 28.12 23.765 120-124 20.57 27.925 27.88 23.625 125-129 20.19 28.89 27.265 23.655 130-134 21.115000000000002 28.03 27.250000000000004 23.605 135-139 20.974999999999998 28.315 27.13 23.580000000000002 140-144 20.66 28.22 27.33 23.79 145-149 20.64 28.485 26.5 24.375 150-151 20.674999999999997 28.8875 25.7625 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 3.0 25 3.5 26 3.5 27 4.0 28 7.0 29 12.0 30 15.5 31 22.5 32 30.0 33 42.0 34 59.0 35 73.0 36 97.5 37 123.5 38 136.5 39 186.0 40 239.5 41 242.0 42 252.0 43 282.0 44 296.5 45 275.0 46 255.0 47 255.0 48 233.0 49 196.5 50 167.0 51 131.0 52 100.0 53 74.0 54 51.0 55 35.5 56 23.5 57 16.5 58 10.0 59 8.0 60 8.0 61 6.0 62 4.5 63 4.0 64 3.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.2000000000000002 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.5250000000000004 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTTT 10 0.006577216 146.82278 1 TCCTTTA 10 0.006832588 144.9875 2 >>END_MODULE SRR7172656 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172656_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0645 34.0 33.0 34.0 32.0 34.0 2 33.08125 34.0 33.0 34.0 33.0 34.0 3 33.10875 34.0 33.0 34.0 33.0 34.0 4 33.07975 34.0 33.0 34.0 33.0 34.0 5 33.07175 34.0 33.0 34.0 33.0 34.0 6 37.143 38.0 38.0 38.0 37.0 38.0 7 37.2015 38.0 38.0 38.0 37.0 38.0 8 37.22925 38.0 38.0 38.0 38.0 38.0 9 37.19525 38.0 38.0 38.0 38.0 38.0 10-14 37.1309 38.0 38.0 38.0 37.0 38.0 15-19 37.18645 38.0 38.0 38.0 37.4 38.0 20-24 37.117549999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.95535 38.0 38.0 38.0 37.0 38.0 30-34 36.465199999999996 38.0 38.0 38.0 36.4 38.0 35-39 36.677049999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.96849999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.949400000000004 38.0 38.0 38.0 37.0 38.0 50-54 36.94415 38.0 38.0 38.0 37.0 38.0 55-59 36.888400000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.72725 38.0 38.0 38.0 36.0 38.0 65-69 36.6214 38.0 38.0 38.0 35.8 38.0 70-74 36.54175 38.0 38.0 38.0 35.2 38.0 75-79 36.4811 38.0 38.0 38.0 35.0 38.0 80-84 36.38555 38.0 38.0 38.0 34.2 38.0 85-89 36.34015000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.264599999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.23325 38.0 38.0 38.0 34.2 38.0 100-104 36.05345 38.0 38.0 38.0 34.0 38.0 105-109 36.0449 38.0 38.0 38.0 33.8 38.0 110-114 35.94665 38.0 37.8 38.0 33.0 38.0 115-119 35.62725 38.0 37.0 38.0 31.8 38.0 120-124 35.44465 38.0 36.8 38.0 30.6 38.0 125-129 35.087900000000005 38.0 36.0 38.0 29.0 38.0 130-134 34.7188 38.0 35.4 38.0 27.4 38.0 135-139 34.40845 38.0 34.8 38.0 26.2 38.0 140-144 33.92045 38.0 33.4 38.0 23.8 38.0 145-149 33.132549999999995 38.0 33.0 38.0 19.4 38.0 150-151 28.706249999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 3.0 5 2.0 6 3.0 7 5.0 8 2.0 9 5.0 10 4.0 11 1.0 12 3.0 13 1.0 14 1.0 15 1.0 16 4.0 17 4.0 18 7.0 19 4.0 20 8.0 21 5.0 22 5.0 23 14.0 24 10.0 25 14.0 26 14.0 27 19.0 28 27.0 29 28.0 30 52.0 31 46.0 32 75.0 33 101.0 34 157.0 35 263.0 36 622.0 37 2473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.95 16.925 17.0 28.125 2 24.0 24.075 35.075 16.85 3 21.025 27.250000000000004 30.55 21.175 4 24.7 34.949999999999996 21.75 18.6 5 25.324999999999996 35.675000000000004 22.8 16.2 6 19.175 37.25 24.65 18.925 7 18.575 17.45 42.15 21.825 8 20.65 23.5 27.975 27.875 9 23.225 24.55 28.725 23.5 10-14 23.5 27.939999999999998 27.055 21.505 15-19 22.965 28.299999999999997 27.915 20.82 20-24 23.474999999999998 28.79 27.169999999999998 20.565 25-29 22.912903873168773 28.291190046156935 28.24101946618503 20.554886614489263 30-34 22.86425776287036 28.78995781877319 27.7684606393251 20.577323779031357 35-39 23.090469960752742 28.66559323739559 27.397604910938917 20.84633189091275 40-44 23.875 27.79 27.88 20.455000000000002 45-49 23.580000000000002 28.794999999999998 27.075 20.549999999999997 50-54 23.415 27.71 27.92 20.955 55-59 23.915 28.549999999999997 27.6 19.935 60-64 23.535 27.705000000000002 28.675 20.085 65-69 23.799999999999997 27.74 28.244999999999997 20.215 70-74 23.715 27.785 28.165000000000003 20.335 75-79 23.305 27.495000000000005 28.37 20.830000000000002 80-84 23.285 28.22 27.915 20.580000000000002 85-89 23.29 28.04 27.92 20.75 90-94 23.885 27.439999999999998 28.015 20.66 95-99 23.724999999999998 27.67 28.32 20.285 100-104 24.16 28.050000000000004 27.62 20.169999999999998 105-109 24.395 28.134999999999998 27.55 19.919999999999998 110-114 23.57 27.985 28.139999999999997 20.305 115-119 23.52 28.265 28.410000000000004 19.805 120-124 23.9 28.389999999999997 27.845 19.865 125-129 23.66 27.93 27.955000000000002 20.455000000000002 130-134 24.94 28.105000000000004 27.455000000000002 19.5 135-139 24.58 28.110000000000003 27.310000000000002 20.0 140-144 24.39 28.215 27.845 19.55 145-149 24.455 28.78 27.46 19.305 150-151 25.15 27.8125 27.150000000000002 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 2.0 25 2.5 26 1.5 27 3.0 28 4.5 29 5.0 30 8.5 31 13.0 32 21.0 33 27.5 34 35.0 35 58.5 36 82.5 37 102.0 38 132.5 39 164.5 40 211.0 41 257.5 42 274.5 43 308.0 44 314.0 45 284.5 46 276.5 47 242.0 48 209.0 49 204.5 50 181.5 51 141.5 52 107.0 53 82.0 54 66.0 55 49.5 56 35.5 57 25.0 58 15.0 59 11.5 60 9.0 61 6.0 62 5.0 63 4.0 64 1.0 65 1.0 66 1.0 67 0.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.33999999999999997 30-34 1.6150000000000002 35-39 0.63 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49634852681945 98.775 2 0.4029211785444472 0.8 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit CTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.5250000000000004 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGCA 10 0.006843168 144.91249 3 CGGTGAC 10 0.006843168 144.91249 1 >>END_MODULE Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663502 spots for SRR7172656.sra Written 663502 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra Read 663488 spots for SRR7172656.sra Written 663488 spots for SRR7172656.sra SRR ids: ['SRR7172656.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5mwkt9tk SRR7172656.sra spots: 13269774 blocks: [[1, 663488], [663489, 1326976], [1326977, 1990464], [1990465, 2653952], [2653953, 3317440], [3317441, 3980928], [3980929, 4644416], [4644417, 5307904], [5307905, 5971392], [5971393, 6634880], [6634881, 7298368], [7298369, 7961856], [7961857, 8625344], [8625345, 9288832], [9288833, 9952320], [9952321, 10615808], [10615809, 11279296], [11279297, 11942784], [11942785, 12606272], [12606273, 13269774]] SRR7172656 file size 4474990 SRR7172656 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172656 SRR7172656_1.fastq SRR7172656_2.fastq Input file: SRR7172656_1.fastq Paired file: SRR7172656_2.fastq trimmed: SRR7172656-trimmed-pair1.fastq, SRR7172656-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:39:12 2025 >> started Mon Feb 10 16:39:28 2025 >> done (15.088s) 13269774 read pairs processed; of these: 17554 ( 0.13%) short read pairs filtered out after trimming by size control 11572 ( 0.09%) empty read pairs filtered out after trimming by size control 13240648 (99.78%) read pairs available; of these: 5232540 (39.52%) trimmed read pairs available after processing 8008108 (60.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 3 0.00% 31 2 0.00% 32 3 0.00% 33 1 0.00% 34 2 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 2 0.00% 39 3 0.00% 40 1 0.00% 41 9 0.00% 42 2 0.00% 43 3 0.00% 44 1 0.00% 45 3 0.00% 46 7 0.00% 47 6 0.00% 48 10 0.00% 49 8 0.00% 50 5 0.00% 51 9 0.00% 52 14 0.00% 53 14 0.00% 54 22 0.00% 55 23 0.00% 56 27 0.00% 57 32 0.00% 58 28 0.00% 59 41 0.00% 60 30 0.00% 61 42 0.00% 62 59 0.00% 63 53 0.00% 64 76 0.00% 65 83 0.00% 66 100 0.00% 67 103 0.00% 68 113 0.00% 69 127 0.00% 70 146 0.00% 71 201 0.00% 72 198 0.00% 73 233 0.00% 74 298 0.00% 75 330 0.00% 76 372 0.00% 77 408 0.00% 78 454 0.00% 79 533 0.00% 80 611 0.00% 81 725 0.01% 82 824 0.01% 83 983 0.01% 84 1880 0.01% 85 2516 0.02% 86 2547 0.02% 87 2782 0.02% 88 2831 0.02% 89 2985 0.02% 90 3083 0.02% 91 3307 0.02% 92 3592 0.03% 93 3641 0.03% 94 4133 0.03% 95 4465 0.03% 96 4693 0.04% 97 5043 0.04% 98 5531 0.04% 99 5797 0.04% 100 6277 0.05% 101 6820 0.05% 102 7415 0.06% 103 7759 0.06% 104 8434 0.06% 105 8786 0.07% 106 9474 0.07% 107 10187 0.08% 108 11006 0.08% 109 11630 0.09% 110 12133 0.09% 111 13313 0.10% 112 13845 0.10% 113 14555 0.11% 114 15609 0.12% 115 16421 0.12% 116 17240 0.13% 117 18140 0.14% 118 18919 0.14% 119 19661 0.15% 120 20391 0.15% 121 22077 0.17% 122 22506 0.17% 123 24252 0.18% 124 25187 0.19% 125 26116 0.20% 126 27934 0.21% 127 28808 0.22% 128 29709 0.22% 129 31016 0.23% 130 33188 0.25% 131 34133 0.26% 132 36008 0.27% 133 37940 0.29% 134 39825 0.30% 135 42224 0.32% 136 44527 0.34% 137 46780 0.35% 138 50218 0.38% 139 53633 0.41% 140 56745 0.43% 141 62640 0.47% 142 67897 0.51% 143 75322 0.57% 144 86471 0.65% 145 100764 0.76% 146 123765 0.93% 147 164457 1.24% 148 242506 1.83% 149 484281 3.66% 150 2777369 20.98% 151 8008108 60.48% 13240648 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=30 prefix-density=0.77 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=47.59 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.5 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=27 prefix-density=0.79 prefix-fanout=2.5 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=194.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.4 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATCT SRR7172656 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:40:16 Started mapping on | Feb 10 16:40:17 Finished on | Feb 10 16:41:41 Mapping speed, Million of reads per hour | 567.46 Number of input reads | 13240648 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12456397 Uniquely mapped reads % | 94.08% Average mapped length | 295.84 Number of splices: Total | 12478190 Number of splices: Annotated (sjdb) | 12226665 Number of splices: GT/AG | 12282347 Number of splices: GC/AG | 155366 Number of splices: AT/AC | 9474 Number of splices: Non-canonical | 31003 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331612 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 22259 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468236 468236 468236 N_multimapping 331612 331612 331612 N_noFeature 296559 12346815 336970 N_ambiguous 130905 752 61351 UnstrandedReadsAssigned:12028933 PositiveStrandReadsAssigned:108830 NegativeStrandReadsAssigned:12058076 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172656 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172656-trimmed-pair1.fastq SRR7172656-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,240,648 reads, 11,960,696 reads pseudoaligned [quant] estimated average fragment length: 240.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7172656.ke.tsv 34699 SRR7172656.se.tsv 87100 total ==> SRR7172656.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.69 1214 49.5289 Potri.005G024800.1.v4.1 1035 795.69 917 83.6308 Potri.004G059700.1.v4.1 961 721.704 19 1.91045 Potri.007G009000.2.v4.1 1416 1176.69 0 0 Potri.003G141000.2.v4.1 2943 2703.69 685.479 18.3983 Potri.016G087400.1.v4.1 270 77.3831 797.555 747.921 Potri.015G069301.1.v4.1 564 328.216 0 0 Potri.010G195200.1.v4.1 1773 1533.69 427 20.2037 Potri.012G127500.1.v4.1 977 737.704 3030 298.058 ==> SRR7172656.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 149 SRR7172656 completed mapping pipeline successfully