Starting /dee2/code/volunteer_pipeline.sh SRR7172657 current disk space = 3058339549184 free memory = 1099533096 SRR7172657 SRAfilesize 54f4399f6b67b49678bf634711832b77 SRR7172657.sra SRR7172657.sra file validated SRR7172657 is paired end SRR7172657 is conventional basespace SRR7172657 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172657_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.97225 32.0 18.0 33.0 18.0 33.0 2 31.00825 33.0 30.0 33.0 27.0 34.0 3 31.81875 33.0 32.0 33.0 28.0 34.0 4 32.3045 33.0 32.0 33.0 31.0 34.0 5 32.48 33.0 33.0 33.0 32.0 34.0 6 37.21325 38.0 37.0 38.0 36.0 38.0 7 37.537 38.0 38.0 38.0 37.0 38.0 8 37.69475 38.0 38.0 38.0 38.0 38.0 9 37.7195 38.0 38.0 38.0 38.0 38.0 10-14 37.69005 38.0 38.0 38.0 38.0 38.0 15-19 37.68995000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.657349999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.693650000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.674949999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.650349999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.592600000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.5544 38.0 38.0 38.0 38.0 38.0 50-54 37.54585 38.0 38.0 38.0 38.0 38.0 55-59 37.44475 38.0 38.0 38.0 37.6 38.0 60-64 37.44 38.0 38.0 38.0 37.6 38.0 65-69 37.31285 38.0 38.0 38.0 37.0 38.0 70-74 37.342 38.0 38.0 38.0 37.0 38.0 75-79 37.25435 38.0 38.0 38.0 37.0 38.0 80-84 37.1403 38.0 38.0 38.0 36.4 38.0 85-89 37.02315 38.0 38.0 38.0 36.0 38.0 90-94 37.097350000000006 38.0 38.0 38.0 36.2 38.0 95-99 37.087149999999994 38.0 38.0 38.0 36.0 38.0 100-104 36.94055 38.0 38.0 38.0 36.0 38.0 105-109 36.6726 38.0 38.0 38.0 34.8 38.0 110-114 36.6406 38.0 38.0 38.0 34.4 38.0 115-119 36.6383 38.0 38.0 38.0 34.6 38.0 120-124 36.492450000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.18125 38.0 37.8 38.0 33.8 38.0 130-134 35.8129 38.0 37.0 38.0 32.2 38.0 135-139 35.483450000000005 38.0 36.0 38.0 31.0 38.0 140-144 35.500949999999996 38.0 36.0 38.0 31.4 38.0 145-149 35.3375 38.0 36.0 38.0 31.0 38.0 150-151 32.5085 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 3.0 19 1.0 20 2.0 21 2.0 22 2.0 23 4.0 24 6.0 25 8.0 26 7.0 27 5.0 28 11.0 29 27.0 30 30.0 31 38.0 32 48.0 33 76.0 34 134.0 35 201.0 36 549.0 37 2842.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.06926629040534 11.441765007696254 13.596716264751155 39.892252437147256 2 20.17145738779627 20.398386283408975 38.04841149773071 21.381744831064044 3 19.275000000000002 27.725 25.95 27.05 4 21.825 33.650000000000006 22.1 22.425 5 19.575 36.925000000000004 24.85 18.65 6 15.825 37.025000000000006 26.924999999999997 20.225 7 12.725 21.925 45.375 19.975 8 17.275 21.625 30.55 30.55 9 18.275 22.25 31.85 27.625 10-14 19.15 29.92 26.845000000000002 24.085 15-19 19.685 28.415000000000003 28.139999999999997 23.76 20-24 19.125 28.87 27.98 24.025 25-29 19.74 28.79 28.325 23.145 30-34 19.6 29.075 27.560000000000002 23.765 35-39 19.36 29.095 27.725 23.82 40-44 20.025000000000002 28.68 27.975 23.32 45-49 19.665 28.449999999999996 27.87 24.015 50-54 19.845 28.585 28.26 23.31 55-59 19.455 28.675 28.42 23.45 60-64 19.744999999999997 28.37 28.000000000000004 23.885 65-69 19.580000000000002 29.145 27.295 23.98 70-74 19.509999999999998 28.645 27.92 23.925 75-79 19.41 28.17 28.255000000000003 24.165 80-84 20.25 27.439999999999998 28.71 23.599999999999998 85-89 19.564999999999998 28.02 28.694999999999997 23.72 90-94 19.950000000000003 27.845 28.189999999999998 24.015 95-99 19.77 27.62 28.655 23.955000000000002 100-104 19.564999999999998 28.205000000000002 28.51 23.72 105-109 20.29 27.365000000000002 28.189999999999998 24.154999999999998 110-114 19.56 28.49 28.075 23.875 115-119 19.975 27.785 28.065 24.175 120-124 19.869999999999997 28.42 27.845 23.865 125-129 20.61 27.67 28.255000000000003 23.465 130-134 20.294999999999998 28.09 28.205000000000002 23.41 135-139 20.735 28.23 27.825 23.21 140-144 20.45 28.715000000000003 27.21 23.625 145-149 20.275000000000002 28.965000000000003 26.875 23.885 150-151 20.075000000000003 28.962500000000002 27.450000000000003 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 3.0 25 3.5 26 2.5 27 3.0 28 7.5 29 13.5 30 13.5 31 15.5 32 24.5 33 36.5 34 48.0 35 70.0 36 98.5 37 117.5 38 164.0 39 200.0 40 207.0 41 245.5 42 275.0 43 280.5 44 300.0 45 291.5 46 272.5 47 256.5 48 225.5 49 185.5 50 151.5 51 121.5 52 89.0 53 65.5 54 49.5 55 39.0 56 28.0 57 23.0 58 19.5 59 14.5 60 8.5 61 5.0 62 3.5 63 3.0 64 2.0 65 2.5 66 3.5 67 2.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0125 0.0 102-103 0.42500000000000004 0.0 0.0 0.025 0.0 104-105 0.525 0.0 0.0 0.025 0.0 106-107 0.625 0.0 0.0 0.025 0.0 108-109 0.7875 0.0 0.0 0.025 0.0 110-111 0.9875 0.0 0.0 0.025 0.0 112-113 1.1125 0.0 0.0 0.025 0.0 114-115 1.275 0.0 0.0 0.025 0.0 116-117 1.4875 0.0 0.0 0.025 0.0 118-119 1.625 0.0 0.0 0.025 0.0 120-121 1.8875000000000002 0.0 0.0 0.025 0.0 122-123 2.175 0.0 0.0 0.025 0.0 124-125 2.3375 0.0 0.0 0.025 0.0 126-127 2.65 0.0 0.0 0.025 0.0 128-129 3.05 0.0 0.0 0.025 0.0 130-131 3.425 0.0 0.0 0.025 0.0 132-133 3.875 0.0 0.0 0.025 0.0 134-135 4.2125 0.0 0.0 0.025 0.0 136-137 4.4875 0.0 0.0 0.025 0.0 138-139 4.9 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGGGT 10 0.006582306 146.7848 2 CCATGAC 10 0.0068378756 144.95 5 TAGGGTT 10 0.0068378756 144.95 3 >>END_MODULE SRR7172657 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172657_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2105 34.0 33.0 34.0 33.0 34.0 2 33.2775 34.0 33.0 34.0 33.0 34.0 3 33.29 34.0 33.0 34.0 33.0 34.0 4 33.2765 34.0 33.0 34.0 33.0 34.0 5 33.298 34.0 33.0 34.0 33.0 34.0 6 37.3965 38.0 38.0 38.0 38.0 38.0 7 37.38 38.0 38.0 38.0 38.0 38.0 8 37.453 38.0 38.0 38.0 38.0 38.0 9 37.42575 38.0 38.0 38.0 38.0 38.0 10-14 37.3855 38.0 38.0 38.0 38.0 38.0 15-19 37.3925 38.0 38.0 38.0 38.0 38.0 20-24 37.390499999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.108850000000004 38.0 38.0 38.0 37.6 38.0 30-34 36.40545 38.0 38.0 38.0 36.8 38.0 35-39 36.750150000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.21625 38.0 38.0 38.0 37.2 38.0 45-49 37.25410000000001 38.0 38.0 38.0 37.2 38.0 50-54 37.2494 38.0 38.0 38.0 37.2 38.0 55-59 37.1549 38.0 38.0 38.0 37.2 38.0 60-64 37.01985 38.0 38.0 38.0 36.8 38.0 65-69 36.997099999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.99595000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.01174999999999 38.0 38.0 38.0 36.4 38.0 80-84 36.94375 38.0 38.0 38.0 36.4 38.0 85-89 36.8454 38.0 38.0 38.0 36.0 38.0 90-94 36.78415 38.0 38.0 38.0 36.0 38.0 95-99 36.6688 38.0 38.0 38.0 35.4 38.0 100-104 36.6613 38.0 38.0 38.0 35.4 38.0 105-109 36.55225 38.0 38.0 38.0 34.8 38.0 110-114 36.42415 38.0 38.0 38.0 34.4 38.0 115-119 36.280950000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.072050000000004 38.0 37.8 38.0 33.6 38.0 125-129 35.83725 38.0 37.6 38.0 32.6 38.0 130-134 35.6644 38.0 37.0 38.0 32.2 38.0 135-139 35.41615 38.0 36.0 38.0 31.0 38.0 140-144 35.052499999999995 38.0 36.0 38.0 30.6 38.0 145-149 34.478899999999996 38.0 35.8 38.0 27.6 38.0 150-151 30.1925 35.5 27.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 0.0 5 1.0 6 2.0 7 0.0 8 2.0 9 0.0 10 1.0 11 3.0 12 2.0 13 2.0 14 2.0 15 4.0 16 1.0 17 3.0 18 0.0 19 6.0 20 3.0 21 3.0 22 5.0 23 9.0 24 6.0 25 7.0 26 12.0 27 18.0 28 20.0 29 25.0 30 47.0 31 37.0 32 53.0 33 84.0 34 125.0 35 250.0 36 448.0 37 2809.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 13.950000000000001 17.8 32.675 2 22.925 23.200000000000003 37.625 16.25 3 20.95 26.724999999999998 32.275 20.05 4 26.75 34.025 20.75 18.475 5 24.775 36.4 22.625 16.2 6 18.3 38.925 23.474999999999998 19.3 7 17.224999999999998 17.150000000000002 44.45 21.175 8 20.5 22.55 29.549999999999997 27.400000000000002 9 23.400000000000002 23.25 27.675 25.674999999999997 10-14 22.7 29.709999999999997 26.729999999999997 20.86 15-19 23.125 27.98 28.305000000000003 20.59 20-24 22.78 28.544999999999998 27.889999999999997 20.785 25-29 22.615872376830556 28.841024608726286 27.965376679583315 20.577726334859847 30-34 22.849227927974145 28.86164264094803 28.081875545067458 20.207253886010363 35-39 23.081592392129092 28.23612726996813 27.856745409479487 20.825534928423288 40-44 23.41 28.51 27.975 20.105 45-49 23.49 28.544999999999998 27.589999999999996 20.375 50-54 23.05 28.38 28.43 20.14 55-59 23.5 28.854999999999997 28.015 19.63 60-64 23.605 28.694999999999997 27.865000000000002 19.835 65-69 23.935000000000002 28.015 28.035 20.015 70-74 23.794999999999998 28.595 27.689999999999998 19.919999999999998 75-79 24.044999999999998 28.349999999999998 27.915 19.689999999999998 80-84 23.494999999999997 28.925 27.825 19.755 85-89 23.695 27.860000000000003 28.415000000000003 20.03 90-94 23.669999999999998 28.175 27.91 20.244999999999997 95-99 23.630000000000003 28.325 28.185 19.86 100-104 23.86 27.79 28.315 20.035 105-109 24.095 28.084999999999997 27.935 19.885 110-114 24.245 28.335 28.01 19.41 115-119 23.91 28.110000000000003 28.65 19.33 120-124 23.945 27.889999999999997 28.22 19.945 125-129 24.09 28.275 27.965 19.67 130-134 23.97 27.77 28.335 19.925 135-139 24.605 28.125 27.810000000000002 19.46 140-144 25.069999999999997 28.025 27.229999999999997 19.675 145-149 25.295 28.09 27.529999999999998 19.085 150-151 25.224999999999998 27.8375 27.35 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 1.5 27 1.5 28 5.5 29 10.0 30 11.5 31 16.5 32 27.5 33 33.5 34 47.5 35 69.0 36 85.5 37 117.0 38 155.5 39 181.0 40 205.5 41 251.5 42 303.5 43 319.5 44 304.5 45 305.0 46 286.0 47 252.5 48 230.0 49 182.5 50 125.5 51 107.0 52 103.0 53 67.0 54 44.5 55 37.5 56 26.0 57 16.0 58 12.5 59 12.5 60 9.0 61 5.5 62 7.0 63 6.0 64 2.5 65 3.0 66 2.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.645 30-34 2.535 35-39 1.155 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.579199194157643 1.15 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.0875000000000004 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTT 10 0.0068874825 144.6 7 >>END_MODULE Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 724006 spots for SRR7172657.sra Written 724006 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra Read 723998 spots for SRR7172657.sra Written 723998 spots for SRR7172657.sra SRR ids: ['SRR7172657.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwnod1dw SRR7172657.sra spots: 14479968 blocks: [[1, 723998], [723999, 1447996], [1447997, 2171994], [2171995, 2895992], [2895993, 3619990], [3619991, 4343988], [4343989, 5067986], [5067987, 5791984], [5791985, 6515982], [6515983, 7239980], [7239981, 7963978], [7963979, 8687976], [8687977, 9411974], [9411975, 10135972], [10135973, 10859970], [10859971, 11583968], [11583969, 12307966], [12307967, 13031964], [13031965, 13755962], [13755963, 14479968]] SRR7172657 file size 4885085 SRR7172657 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172657 SRR7172657_1.fastq SRR7172657_2.fastq Input file: SRR7172657_1.fastq Paired file: SRR7172657_2.fastq trimmed: SRR7172657-trimmed-pair1.fastq, SRR7172657-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:46:15 2025 >> started Mon Feb 10 16:46:31 2025 >> done (15.704s) 14479968 read pairs processed; of these: 10840 ( 0.07%) short read pairs filtered out after trimming by size control 7802 ( 0.05%) empty read pairs filtered out after trimming by size control 14461326 (99.87%) read pairs available; of these: 5797458 (40.09%) trimmed read pairs available after processing 8663868 (59.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 1 0.00% 38 3 0.00% 39 5 0.00% 40 1 0.00% 41 6 0.00% 42 2 0.00% 43 2 0.00% 44 8 0.00% 45 5 0.00% 46 5 0.00% 47 13 0.00% 48 12 0.00% 49 12 0.00% 50 8 0.00% 51 14 0.00% 52 12 0.00% 53 18 0.00% 54 22 0.00% 55 20 0.00% 56 34 0.00% 57 26 0.00% 58 35 0.00% 59 32 0.00% 60 37 0.00% 61 55 0.00% 62 58 0.00% 63 78 0.00% 64 62 0.00% 65 90 0.00% 66 111 0.00% 67 111 0.00% 68 144 0.00% 69 158 0.00% 70 169 0.00% 71 200 0.00% 72 271 0.00% 73 251 0.00% 74 312 0.00% 75 359 0.00% 76 454 0.00% 77 499 0.00% 78 545 0.00% 79 604 0.00% 80 726 0.01% 81 833 0.01% 82 931 0.01% 83 1156 0.01% 84 1893 0.01% 85 2296 0.02% 86 2510 0.02% 87 2647 0.02% 88 2850 0.02% 89 2997 0.02% 90 3166 0.02% 91 3460 0.02% 92 3691 0.03% 93 4029 0.03% 94 4324 0.03% 95 4781 0.03% 96 5040 0.03% 97 5443 0.04% 98 5906 0.04% 99 6348 0.04% 100 6967 0.05% 101 7453 0.05% 102 7948 0.05% 103 8614 0.06% 104 9048 0.06% 105 9780 0.07% 106 10561 0.07% 107 11054 0.08% 108 11644 0.08% 109 12638 0.09% 110 13394 0.09% 111 14139 0.10% 112 14756 0.10% 113 15858 0.11% 114 16801 0.12% 115 17944 0.12% 116 18686 0.13% 117 19422 0.13% 118 20939 0.14% 119 21519 0.15% 120 22175 0.15% 121 23480 0.16% 122 24440 0.17% 123 25805 0.18% 124 27224 0.19% 125 28105 0.19% 126 29656 0.21% 127 31371 0.22% 128 32055 0.22% 129 33655 0.23% 130 35399 0.24% 131 36629 0.25% 132 38403 0.27% 133 40804 0.28% 134 42431 0.29% 135 44341 0.31% 136 47004 0.33% 137 49494 0.34% 138 52039 0.36% 139 55555 0.38% 140 58838 0.41% 141 63593 0.44% 142 68857 0.48% 143 75435 0.52% 144 85211 0.59% 145 99416 0.69% 146 121021 0.84% 147 159104 1.10% 148 237956 1.65% 149 579818 4.01% 150 3189059 22.05% 151 8663868 59.91% 14461326 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=36 prefix-density=0.57 prefix-fanout=2.1 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=76.57 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.9 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=5.91 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=4.3 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=101.19 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.3 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7172657 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:47:16 Started mapping on | Feb 10 16:47:16 Finished on | Feb 10 16:49:01 Mapping speed, Million of reads per hour | 495.82 Number of input reads | 14461326 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13620855 Uniquely mapped reads % | 94.19% Average mapped length | 296.03 Number of splices: Total | 13895338 Number of splices: Annotated (sjdb) | 13616933 Number of splices: GT/AG | 13678029 Number of splices: GC/AG | 173800 Number of splices: AT/AC | 9899 Number of splices: Non-canonical | 33610 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366082 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 25074 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 484819 484819 484819 N_multimapping 366082 366082 366082 N_noFeature 360157 13503551 411373 N_ambiguous 134134 572 67830 UnstrandedReadsAssigned:13126564 PositiveStrandReadsAssigned:116732 NegativeStrandReadsAssigned:13141652 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172657 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172657-trimmed-pair1.fastq SRR7172657-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,461,326 reads, 13,023,732 reads pseudoaligned [quant] estimated average fragment length: 234.836 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7172657.ke.tsv 34699 SRR7172657.se.tsv 87100 total ==> SRR7172657.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.16 1322 54.0825 Potri.005G024800.1.v4.1 1035 801.164 778 70.8791 Potri.004G059700.1.v4.1 961 727.164 20 2.00751 Potri.007G009000.2.v4.1 1416 1182.16 0 0 Potri.003G141000.2.v4.1 2943 2709.16 794.265 21.3988 Potri.016G087400.1.v4.1 270 77.9437 1084 1015.1 Potri.015G069301.1.v4.1 564 332.921 0 0 Potri.010G195200.1.v4.1 1773 1539.16 555.874 26.3604 Potri.012G127500.1.v4.1 977 743.164 1758 172.661 ==> SRR7172657.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 157 SRR7172657 completed mapping pipeline successfully