Starting /dee2/code/volunteer_pipeline.sh SRR7172658 current disk space = 3058357940224 free memory = 1387714856 SRR7172658 SRAfilesize 05355d4d058b65a5c292f75f5b342ffd SRR7172658.sra SRR7172658.sra file validated SRR7172658 is paired end SRR7172658 is conventional basespace SRR7172658 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172658_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.30275 28.0 18.0 32.0 18.0 33.0 2 29.477 31.0 27.0 33.0 25.0 33.0 3 31.56375 33.0 31.0 33.0 28.0 33.0 4 32.29825 33.0 33.0 33.0 30.0 34.0 5 32.428 33.0 33.0 34.0 31.0 34.0 6 37.032 38.0 38.0 38.0 36.0 38.0 7 37.109 38.0 38.0 38.0 36.0 38.0 8 37.426 38.0 38.0 38.0 37.0 38.0 9 37.597 38.0 38.0 38.0 38.0 38.0 10-14 37.5978 38.0 38.0 38.0 38.0 38.0 15-19 37.54885 38.0 38.0 38.0 38.0 38.0 20-24 37.513549999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.547200000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.51485 38.0 38.0 38.0 38.0 38.0 35-39 37.48285 38.0 38.0 38.0 38.0 38.0 40-44 37.41395 38.0 38.0 38.0 37.4 38.0 45-49 37.22215 38.0 38.0 38.0 36.8 38.0 50-54 37.355900000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.2321 38.0 38.0 38.0 37.0 38.0 60-64 37.219950000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.17375 38.0 38.0 38.0 36.2 38.0 70-74 37.1097 38.0 38.0 38.0 36.0 38.0 75-79 37.04600000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.951550000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.784299999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.7851 38.0 38.0 38.0 34.6 38.0 95-99 36.79885 38.0 38.0 38.0 35.2 38.0 100-104 36.798199999999994 38.0 38.0 38.0 35.0 38.0 105-109 36.35504999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.275800000000004 38.0 38.0 38.0 33.8 38.0 115-119 36.22835 38.0 37.6 38.0 33.6 38.0 120-124 36.268449999999994 38.0 37.8 38.0 33.8 38.0 125-129 35.86125 38.0 36.8 38.0 31.8 38.0 130-134 35.3905 38.0 36.0 38.0 29.4 38.0 135-139 35.06955000000001 38.0 35.6 38.0 28.0 38.0 140-144 35.07875 38.0 35.4 38.0 28.8 38.0 145-149 34.6349 38.0 35.2 38.0 28.2 38.0 150-151 31.289125 35.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 5.0 22 7.0 23 2.0 24 6.0 25 12.0 26 12.0 27 10.0 28 24.0 29 35.0 30 37.0 31 54.0 32 78.0 33 86.0 34 183.0 35 236.0 36 664.0 37 2543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.15216833461637 14.806261226584553 12.85604311008468 41.18552732871439 2 19.662638469284996 19.259818731117825 39.249748237663646 21.827794561933533 3 18.95 25.55 25.95 29.549999999999997 4 21.8 33.675 22.275 22.25 5 21.825 36.7 23.974999999999998 17.5 6 16.975 36.25 26.275 20.5 7 13.4 21.85 45.225 19.525000000000002 8 17.474999999999998 21.575 30.9 30.049999999999997 9 18.175 22.725 32.175 26.924999999999997 10-14 19.439999999999998 29.805 27.525 23.23 15-19 19.42 28.410000000000004 28.24 23.93 20-24 20.62 27.889999999999997 27.875 23.615 25-29 19.785 29.035 27.97 23.21 30-34 19.485 28.07 28.74 23.705000000000002 35-39 19.81 27.935 28.825 23.43 40-44 20.59 28.435 27.76 23.215 45-49 20.24 27.97 27.595 24.195 50-54 19.845 29.020000000000003 27.565 23.57 55-59 19.775000000000002 28.744999999999997 27.725 23.755000000000003 60-64 19.62 28.910000000000004 27.845 23.625 65-69 19.939999999999998 27.77 28.384999999999998 23.905 70-74 19.994999999999997 28.655 28.09 23.26 75-79 19.994999999999997 28.799999999999997 27.725 23.48 80-84 19.950000000000003 27.805000000000003 28.485 23.76 85-89 20.06 28.105000000000004 28.4 23.435 90-94 20.44 27.38 28.765 23.415 95-99 20.044999999999998 28.04 28.599999999999998 23.315 100-104 20.585 27.994999999999997 28.185 23.235 105-109 20.815 27.87 28.22 23.095 110-114 20.39 28.48 27.49 23.64 115-119 20.72 28.425 27.735 23.119999999999997 120-124 20.93 28.405 27.3 23.365 125-129 20.615 28.375 27.68 23.330000000000002 130-134 20.595 28.794999999999998 27.284999999999997 23.325000000000003 135-139 20.580000000000002 28.15 27.83 23.44 140-144 20.630000000000003 27.565 28.449999999999996 23.355 145-149 20.845 27.93 28.155 23.07 150-151 20.9 27.725 27.037499999999998 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.5 25 5.0 26 5.0 27 6.5 28 9.5 29 9.0 30 16.0 31 28.5 32 35.0 33 41.0 34 50.0 35 71.5 36 101.0 37 124.5 38 145.5 39 185.0 40 212.5 41 231.5 42 254.5 43 268.5 44 281.5 45 290.5 46 274.5 47 253.0 48 225.0 49 183.0 50 152.0 51 118.5 52 90.5 53 73.0 54 62.0 55 48.5 56 36.0 57 25.5 58 17.0 59 15.5 60 13.5 61 7.5 62 6.0 63 5.0 64 2.0 65 2.0 66 3.0 67 3.5 68 2.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGAAA 10 0.0063298983 148.6923 1 GGCAGGT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7172658 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172658_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13725 34.0 33.0 34.0 33.0 34.0 2 33.189 34.0 33.0 34.0 33.0 34.0 3 33.2285 34.0 33.0 34.0 33.0 34.0 4 33.16475 34.0 33.0 34.0 33.0 34.0 5 33.1605 34.0 33.0 34.0 33.0 34.0 6 37.38075 38.0 38.0 38.0 37.0 38.0 7 37.31125 38.0 38.0 38.0 38.0 38.0 8 37.29275 38.0 38.0 38.0 38.0 38.0 9 37.277 38.0 38.0 38.0 37.0 38.0 10-14 37.288850000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.3154 38.0 38.0 38.0 37.4 38.0 20-24 37.28574999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.08275 38.0 38.0 38.0 37.2 38.0 30-34 36.46935 38.0 38.0 38.0 36.8 38.0 35-39 36.72865 38.0 38.0 38.0 36.2 38.0 40-44 37.1514 38.0 38.0 38.0 37.0 38.0 45-49 37.16459999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.14705 38.0 38.0 38.0 37.0 38.0 55-59 37.07529999999999 38.0 38.0 38.0 36.8 38.0 60-64 36.8993 38.0 38.0 38.0 36.2 38.0 65-69 36.70715 38.0 38.0 38.0 35.8 38.0 70-74 36.8247 38.0 38.0 38.0 36.0 38.0 75-79 36.841300000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.7523 38.0 38.0 38.0 35.8 38.0 85-89 36.5806 38.0 38.0 38.0 35.0 38.0 90-94 36.5083 38.0 38.0 38.0 34.6 38.0 95-99 36.45425000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.338750000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.28635 38.0 38.0 38.0 34.0 38.0 110-114 35.93320000000001 38.0 37.4 38.0 32.8 38.0 115-119 35.623799999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.388000000000005 38.0 36.2 38.0 29.6 38.0 125-129 35.26625 38.0 36.0 38.0 30.0 38.0 130-134 34.87165 38.0 36.0 38.0 27.8 38.0 135-139 34.262950000000004 38.0 34.2 38.0 25.4 38.0 140-144 33.666450000000005 38.0 33.0 38.0 22.0 38.0 145-149 32.376149999999996 38.0 32.6 38.0 12.2 38.0 150-151 27.0445 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 4.0 5 1.0 6 2.0 7 2.0 8 1.0 9 2.0 10 2.0 11 3.0 12 1.0 13 1.0 14 3.0 15 2.0 16 1.0 17 1.0 18 0.0 19 7.0 20 4.0 21 4.0 22 4.0 23 14.0 24 5.0 25 12.0 26 20.0 27 25.0 28 45.0 29 32.0 30 53.0 31 51.0 32 70.0 33 120.0 34 167.0 35 293.0 36 653.0 37 2388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.35 15.55 17.474999999999998 32.625 2 25.2 22.875 34.2 17.724999999999998 3 20.724999999999998 28.050000000000004 30.525000000000002 20.7 4 23.625 35.099999999999994 22.825 18.45 5 23.724999999999998 36.825 21.65 17.8 6 17.95 38.525 24.2 19.325 7 17.875 16.8 44.025 21.3 8 20.275000000000002 23.175 27.875 28.675 9 22.925 25.525 27.425 24.125 10-14 22.805 28.915000000000003 26.8 21.48 15-19 22.715 28.225 28.485 20.575 20-24 22.915 28.485 27.965 20.635 25-29 22.779146347594388 28.485244582977227 27.97244985169172 20.763159217736664 30-34 22.63408149700905 28.488164016565264 28.11493430134465 20.762820185081036 35-39 22.56956719357608 28.594515428513713 27.927882430180297 20.908034947729913 40-44 23.09 27.83 27.944999999999997 21.135 45-49 23.23 28.335 27.800000000000004 20.635 50-54 23.535 28.54 27.815 20.11 55-59 23.225 28.465 27.575 20.735 60-64 22.895 27.735 28.560000000000002 20.810000000000002 65-69 23.35 28.465 27.405 20.78 70-74 23.32 28.205000000000002 27.6 20.875 75-79 23.78 28.09 27.725 20.405 80-84 23.02 28.525 27.625 20.830000000000002 85-89 23.599999999999998 28.475 27.185 20.74 90-94 22.84 28.42 27.925 20.815 95-99 23.165 27.98 28.155 20.7 100-104 23.385 28.53 27.860000000000003 20.225 105-109 23.655 28.465 27.855 20.025000000000002 110-114 23.735 28.084999999999997 27.839999999999996 20.34 115-119 24.169999999999998 27.73 27.245 20.855 120-124 23.46 27.694999999999997 28.415000000000003 20.43 125-129 23.94 28.749999999999996 27.485 19.825 130-134 24.05 28.139999999999997 27.455000000000002 20.355 135-139 23.830000000000002 28.235 27.505000000000003 20.43 140-144 24.279999999999998 27.805000000000003 27.79 20.125 145-149 24.145 28.54 27.16 20.155 150-151 24.625 27.750000000000004 28.050000000000004 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 2.5 26 3.0 27 1.5 28 4.5 29 6.5 30 11.5 31 16.0 32 19.5 33 35.0 34 55.0 35 72.0 36 79.0 37 100.5 38 143.0 39 188.5 40 227.0 41 248.5 42 276.5 43 300.5 44 305.5 45 302.5 46 273.0 47 238.0 48 207.0 49 177.0 50 147.5 51 120.5 52 110.5 53 86.5 54 57.5 55 42.5 56 34.0 57 26.0 58 18.5 59 15.0 60 11.0 61 7.0 62 7.0 63 4.0 64 1.5 65 3.0 66 3.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.545 30-34 2.205 35-39 0.9950000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779988 spots for SRR7172658.sra Written 779988 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra Read 779973 spots for SRR7172658.sra Written 779973 spots for SRR7172658.sra SRR ids: ['SRR7172658.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_od4awed5 SRR7172658.sra spots: 15599475 blocks: [[1, 779973], [779974, 1559946], [1559947, 2339919], [2339920, 3119892], [3119893, 3899865], [3899866, 4679838], [4679839, 5459811], [5459812, 6239784], [6239785, 7019757], [7019758, 7799730], [7799731, 8579703], [8579704, 9359676], [9359677, 10139649], [10139650, 10919622], [10919623, 11699595], [11699596, 12479568], [12479569, 13259541], [13259542, 14039514], [14039515, 14819487], [14819488, 15599475]] SRR7172658 file size 5264449 SRR7172658 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172658 SRR7172658_1.fastq SRR7172658_2.fastq Input file: SRR7172658_1.fastq Paired file: SRR7172658_2.fastq trimmed: SRR7172658-trimmed-pair1.fastq, SRR7172658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:45:51 2025 >> started Mon Feb 10 16:46:08 2025 >> done (16.786s) 15599475 read pairs processed; of these: 11749 ( 0.08%) short read pairs filtered out after trimming by size control 9536 ( 0.06%) empty read pairs filtered out after trimming by size control 15578190 (99.86%) read pairs available; of these: 6815326 (43.75%) trimmed read pairs available after processing 8762864 (56.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 6 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 4 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 1 0.00% 37 5 0.00% 38 1 0.00% 39 2 0.00% 40 1 0.00% 41 11 0.00% 42 5 0.00% 43 5 0.00% 44 5 0.00% 45 4 0.00% 46 8 0.00% 47 6 0.00% 48 11 0.00% 49 5 0.00% 50 9 0.00% 51 17 0.00% 52 16 0.00% 53 18 0.00% 54 11 0.00% 55 24 0.00% 56 32 0.00% 57 31 0.00% 58 28 0.00% 59 42 0.00% 60 23 0.00% 61 32 0.00% 62 51 0.00% 63 43 0.00% 64 67 0.00% 65 80 0.00% 66 71 0.00% 67 89 0.00% 68 110 0.00% 69 129 0.00% 70 138 0.00% 71 163 0.00% 72 188 0.00% 73 216 0.00% 74 241 0.00% 75 301 0.00% 76 382 0.00% 77 376 0.00% 78 432 0.00% 79 485 0.00% 80 510 0.00% 81 696 0.00% 82 766 0.00% 83 877 0.01% 84 1648 0.01% 85 2172 0.01% 86 2302 0.01% 87 2615 0.02% 88 2691 0.02% 89 2812 0.02% 90 2892 0.02% 91 3115 0.02% 92 3284 0.02% 93 3534 0.02% 94 3593 0.02% 95 3894 0.02% 96 4325 0.03% 97 4554 0.03% 98 5012 0.03% 99 5339 0.03% 100 5629 0.04% 101 6086 0.04% 102 6724 0.04% 103 7287 0.05% 104 7712 0.05% 105 8298 0.05% 106 9235 0.06% 107 9773 0.06% 108 10248 0.07% 109 10829 0.07% 110 11508 0.07% 111 12432 0.08% 112 13328 0.09% 113 14064 0.09% 114 14943 0.10% 115 15652 0.10% 116 16720 0.11% 117 17642 0.11% 118 18684 0.12% 119 19491 0.13% 120 20032 0.13% 121 21206 0.14% 122 22653 0.15% 123 23993 0.15% 124 25122 0.16% 125 26425 0.17% 126 28025 0.18% 127 29270 0.19% 128 31149 0.20% 129 32818 0.21% 130 34567 0.22% 131 36231 0.23% 132 38350 0.25% 133 40720 0.26% 134 43841 0.28% 135 46495 0.30% 136 49697 0.32% 137 53222 0.34% 138 57662 0.37% 139 62392 0.40% 140 67616 0.43% 141 74735 0.48% 142 84267 0.54% 143 94942 0.61% 144 110777 0.71% 145 132844 0.85% 146 164341 1.05% 147 223445 1.43% 148 339084 2.18% 149 678889 4.36% 150 3823654 24.54% 151 8762864 56.25% 15578190 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=102.33 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=11.6 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=34.03 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.5 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172658 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:46:55 Started mapping on | Feb 10 16:46:55 Finished on | Feb 10 16:49:07 Mapping speed, Million of reads per hour | 424.86 Number of input reads | 15578190 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14617722 Uniquely mapped reads % | 93.83% Average mapped length | 296.49 Number of splices: Total | 15075951 Number of splices: Annotated (sjdb) | 14808023 Number of splices: GT/AG | 14836665 Number of splices: GC/AG | 194089 Number of splices: AT/AC | 10975 Number of splices: Non-canonical | 34222 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363506 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 37356 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 608861 608861 608861 N_multimapping 363506 363506 363506 N_noFeature 341596 14493597 388960 N_ambiguous 146922 871 69608 UnstrandedReadsAssigned:14129204 PositiveStrandReadsAssigned:123254 NegativeStrandReadsAssigned:14159154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172658 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172658-trimmed-pair1.fastq SRR7172658-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,578,190 reads, 14,066,782 reads pseudoaligned [quant] estimated average fragment length: 245.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7172658.ke.tsv 34699 SRR7172658.se.tsv 87100 total ==> SRR7172658.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.79 1201 47.8335 Potri.005G024800.1.v4.1 1035 790.792 297 26.533 Potri.004G059700.1.v4.1 961 716.802 60 5.91349 Potri.007G009000.2.v4.1 1416 1171.79 0 0 Potri.003G141000.2.v4.1 2943 2698.79 638.415 16.7119 Potri.016G087400.1.v4.1 270 73.2832 1202 1158.76 Potri.015G069301.1.v4.1 564 323.079 0 0 Potri.010G195200.1.v4.1 1773 1528.79 431 19.9168 Potri.012G127500.1.v4.1 977 732.792 4118 397.006 ==> SRR7172658.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 431 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 116 SRR7172658 completed mapping pipeline successfully