Starting /dee2/code/volunteer_pipeline.sh SRR7172659 current disk space = 3058221289472 free memory = 1010073324 SRR7172659 SRAfilesize a2f16184bf0ee8a1d837c19cb38ac82c SRR7172659.sra SRR7172659.sra file validated SRR7172659 is paired end SRR7172659 is conventional basespace SRR7172659 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172659_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.67925 32.0 18.0 33.0 18.0 33.0 2 27.41925 30.0 25.0 33.0 18.0 33.0 3 28.748 31.0 27.0 33.0 18.0 33.0 4 30.91475 32.0 32.0 33.0 27.0 33.0 5 32.62675 33.0 33.0 33.0 32.0 33.0 6 36.33925 38.0 36.0 38.0 34.0 38.0 7 37.40325 38.0 38.0 38.0 36.0 38.0 8 37.6455 38.0 38.0 38.0 38.0 38.0 9 37.65725 38.0 38.0 38.0 38.0 38.0 10-14 37.67275000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.66305 38.0 38.0 38.0 38.0 38.0 20-24 37.705799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.6835 38.0 38.0 38.0 38.0 38.0 30-34 37.65245 38.0 38.0 38.0 38.0 38.0 35-39 37.62845 38.0 38.0 38.0 38.0 38.0 40-44 37.57935 38.0 38.0 38.0 38.0 38.0 45-49 37.5901 38.0 38.0 38.0 38.0 38.0 50-54 37.544399999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.513149999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.4871 38.0 38.0 38.0 37.4 38.0 65-69 37.42755 38.0 38.0 38.0 37.0 38.0 70-74 37.42075 38.0 38.0 38.0 37.0 38.0 75-79 37.393699999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.3322 38.0 38.0 38.0 37.0 38.0 85-89 37.26090000000001 38.0 38.0 38.0 37.0 38.0 90-94 37.24155 38.0 38.0 38.0 36.4 38.0 95-99 37.076049999999995 38.0 38.0 38.0 36.0 38.0 100-104 37.013799999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.915499999999994 38.0 38.0 38.0 36.0 38.0 110-114 36.824200000000005 38.0 38.0 38.0 35.2 38.0 115-119 36.7663 38.0 38.0 38.0 35.0 38.0 120-124 36.6568 38.0 38.0 38.0 34.8 38.0 125-129 36.523649999999996 38.0 38.0 38.0 34.2 38.0 130-134 36.2471 38.0 38.0 38.0 33.6 38.0 135-139 36.10835 38.0 37.6 38.0 33.4 38.0 140-144 35.7587 38.0 36.6 38.0 32.2 38.0 145-149 35.26120000000001 38.0 36.0 38.0 31.4 38.0 150-151 32.1855 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 0.0 19 1.0 20 3.0 21 0.0 22 3.0 23 1.0 24 8.0 25 3.0 26 6.0 27 8.0 28 15.0 29 21.0 30 18.0 31 38.0 32 43.0 33 48.0 34 92.0 35 191.0 36 605.0 37 2887.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.77742279020234 14.110756123535676 12.699680511182109 42.412140575079874 2 18.625 17.05 39.0 25.324999999999996 3 19.45 22.825 25.424999999999997 32.300000000000004 4 22.0 30.675 21.725 25.6 5 21.0 33.625 25.474999999999998 19.900000000000002 6 18.725 34.300000000000004 26.400000000000002 20.575 7 13.700000000000001 24.125 43.6 18.575 8 18.175 22.875 31.775 27.175 9 16.950000000000003 22.375 34.025 26.650000000000002 10-14 19.425 30.15 26.83 23.595 15-19 19.564999999999998 28.299999999999997 27.98 24.154999999999998 20-24 19.375 28.88 27.405 24.34 25-29 19.655 29.044999999999998 27.389999999999997 23.91 30-34 19.915 28.32 27.82 23.945 35-39 19.830000000000002 28.355000000000004 27.884999999999998 23.93 40-44 19.615 29.07 27.355 23.96 45-49 19.825 28.555000000000003 27.589999999999996 24.03 50-54 19.99 27.644999999999996 27.875 24.490000000000002 55-59 19.785 28.52 27.715 23.98 60-64 19.470000000000002 28.15 28.110000000000003 24.27 65-69 19.759999999999998 28.035 28.055000000000003 24.15 70-74 20.0 28.360000000000003 27.445000000000004 24.195 75-79 19.68 28.04 27.944999999999997 24.335 80-84 20.18 28.225 27.49 24.104999999999997 85-89 20.035 27.66 28.405 23.9 90-94 20.44 27.76 27.455000000000002 24.345 95-99 20.244999999999997 27.68 28.144999999999996 23.93 100-104 20.06 28.189999999999998 27.605 24.145 105-109 20.235 28.405 27.389999999999997 23.97 110-114 20.715 27.839999999999996 27.474999999999998 23.97 115-119 20.665 28.405 27.08 23.849999999999998 120-124 20.49 27.700000000000003 27.589999999999996 24.22 125-129 20.380000000000003 27.79 27.785 24.044999999999998 130-134 20.68 28.335 26.97 24.015 135-139 20.365 27.750000000000004 27.93 23.955000000000002 140-144 21.26 27.375 27.55 23.815 145-149 21.525 27.965 26.85 23.66 150-151 21.462500000000002 27.737499999999997 27.0 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 3.0 25 5.0 26 7.0 27 7.5 28 11.5 29 16.5 30 21.5 31 24.0 32 36.0 33 51.5 34 53.0 35 67.0 36 85.0 37 99.5 38 120.0 39 148.5 40 199.5 41 228.5 42 232.5 43 252.0 44 266.5 45 253.5 46 249.5 47 256.0 48 246.5 49 215.0 50 171.5 51 147.0 52 125.0 53 90.5 54 75.0 55 65.0 56 43.5 57 30.5 58 23.5 59 18.0 60 13.0 61 10.5 62 6.5 63 4.0 64 2.0 65 4.0 66 4.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0125 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.0625 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.1125 0.0 0.0 0.025 0.0 90-91 0.1375 0.0 0.0 0.025 0.0 92-93 0.16249999999999998 0.0 0.0 0.025 0.0 94-95 0.25 0.0 0.0 0.025 0.0 96-97 0.3 0.0 0.0 0.025 0.0 98-99 0.3375 0.0 0.0 0.025 0.0 100-101 0.425 0.0 0.0 0.025 0.0 102-103 0.5 0.0 0.0 0.025 0.0 104-105 0.6625000000000001 0.0 0.0 0.025 0.0 106-107 0.7375 0.0 0.0 0.025 0.0 108-109 0.825 0.0 0.0 0.025 0.0 110-111 1.0125 0.0 0.0 0.025 0.0 112-113 1.2375 0.0 0.0 0.025 0.0 114-115 1.4875 0.0 0.0 0.025 0.0 116-117 1.625 0.0 0.0 0.025 0.0 118-119 1.8125 0.0 0.0 0.025 0.0 120-121 2.05 0.0 0.0 0.025 0.0 122-123 2.425 0.0 0.0 0.025 0.0 124-125 2.8 0.0 0.0 0.025 0.0 126-127 3.1500000000000004 0.0 0.0 0.025 0.0 128-129 3.4125 0.0 0.0 0.025 0.0 130-131 3.7375 0.0 0.0 0.025 0.0 132-133 4.325 0.0 0.0 0.025 0.0 134-135 4.775 0.0 0.0 0.025 0.0 136-137 5.175 0.0 0.0 0.025 0.0 138-139 5.65 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATC 10 0.0068378756 144.95 2 CAGATCC 10 0.0068378756 144.95 3 >>END_MODULE SRR7172659 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172659_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09975 33.0 33.0 34.0 33.0 34.0 2 33.17425 34.0 33.0 34.0 33.0 34.0 3 33.2415 34.0 33.0 34.0 33.0 34.0 4 33.201 34.0 33.0 34.0 33.0 34.0 5 33.20175 34.0 33.0 34.0 33.0 34.0 6 37.39275 38.0 38.0 38.0 38.0 38.0 7 37.36725 38.0 38.0 38.0 38.0 38.0 8 37.426 38.0 38.0 38.0 38.0 38.0 9 37.35325 38.0 38.0 38.0 38.0 38.0 10-14 37.3764 38.0 38.0 38.0 37.8 38.0 15-19 37.39015 38.0 38.0 38.0 38.0 38.0 20-24 37.35885 38.0 38.0 38.0 37.8 38.0 25-29 37.3557 38.0 38.0 38.0 37.4 38.0 30-34 37.35045 38.0 38.0 38.0 37.0 38.0 35-39 37.33165 38.0 38.0 38.0 37.0 38.0 40-44 37.27815 38.0 38.0 38.0 37.0 38.0 45-49 37.24385 38.0 38.0 38.0 37.0 38.0 50-54 37.2067 38.0 38.0 38.0 37.0 38.0 55-59 37.163850000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.1226 38.0 38.0 38.0 36.8 38.0 65-69 37.062599999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.0178 38.0 38.0 38.0 36.0 38.0 75-79 37.025999999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.98655 38.0 38.0 38.0 36.0 38.0 85-89 36.88895 38.0 38.0 38.0 36.0 38.0 90-94 36.727999999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.62435000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.5709 38.0 38.0 38.0 34.6 38.0 105-109 36.4567 38.0 38.0 38.0 34.2 38.0 110-114 36.28565 38.0 38.0 38.0 34.0 38.0 115-119 36.05355 38.0 37.8 38.0 33.4 38.0 120-124 35.964099999999995 38.0 37.6 38.0 33.2 38.0 125-129 35.6682 38.0 37.0 38.0 31.4 38.0 130-134 35.4439 38.0 36.4 38.0 30.6 38.0 135-139 34.9132 38.0 35.8 38.0 28.4 38.0 140-144 34.5395 38.0 35.4 38.0 26.6 38.0 145-149 33.8976 38.0 35.0 38.0 23.4 38.0 150-151 30.238875 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 4.0 17 3.0 18 3.0 19 4.0 20 4.0 21 6.0 22 8.0 23 8.0 24 17.0 25 14.0 26 15.0 27 16.0 28 23.0 29 34.0 30 30.0 31 39.0 32 57.0 33 73.0 34 124.0 35 204.0 36 553.0 37 2747.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.95 14.399999999999999 19.7 31.95 2 23.425 22.675 35.85 18.05 3 21.375 26.950000000000003 30.175 21.5 4 24.375 33.7 21.975 19.950000000000003 5 25.0 34.300000000000004 24.425 16.275000000000002 6 19.85 35.25 24.575 20.325 7 19.5 16.575 42.6 21.325 8 20.95 23.875 28.475 26.700000000000003 9 23.125 24.0 28.349999999999998 24.525 10-14 24.145 28.884999999999998 25.740000000000002 21.23 15-19 23.135 28.265 27.315 21.285 20-24 23.615 28.13 27.235 21.02 25-29 23.555 28.485 26.945000000000004 21.015 30-34 23.345 28.34 27.195000000000004 21.12 35-39 24.285 28.34 27.01 20.365 40-44 24.135 28.075 27.029999999999998 20.76 45-49 23.785 28.345 26.82 21.05 50-54 23.955000000000002 27.72 27.485 20.84 55-59 23.845 27.975 27.54 20.64 60-64 24.2 27.875 27.37 20.555 65-69 24.4 27.415 27.400000000000002 20.785 70-74 24.37 27.700000000000003 27.439999999999998 20.49 75-79 24.265 28.29 26.834999999999997 20.61 80-84 23.96 28.485 26.700000000000003 20.855 85-89 23.66 28.21 27.625 20.505000000000003 90-94 24.2 28.12 26.979999999999997 20.7 95-99 24.825 27.96 27.224999999999998 19.99 100-104 24.82 28.044999999999998 26.529999999999998 20.605 105-109 24.465 28.599999999999998 26.700000000000003 20.235 110-114 24.27 28.265 26.650000000000002 20.815 115-119 24.555 27.85 27.18 20.415 120-124 24.325 28.03 27.05 20.595 125-129 25.11 27.950000000000003 27.284999999999997 19.655 130-134 24.555 28.444999999999997 27.235 19.765 135-139 25.145 28.09 27.395000000000003 19.37 140-144 25.124999999999996 27.97 26.93 19.975 145-149 25.61 27.834999999999997 27.215 19.34 150-151 25.674999999999997 28.712500000000002 26.3 19.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 2.5 27 3.5 28 4.5 29 6.5 30 8.5 31 10.0 32 17.5 33 29.0 34 29.5 35 31.5 36 58.0 37 89.5 38 110.5 39 151.0 40 188.5 41 213.5 42 263.0 43 291.0 44 290.0 45 282.0 46 270.5 47 263.0 48 246.5 49 228.5 50 210.0 51 169.5 52 122.0 53 89.0 54 72.5 55 63.5 56 50.0 57 42.0 58 29.5 59 15.5 60 11.5 61 8.5 62 7.5 63 5.5 64 4.5 65 3.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.525 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721470 spots for SRR7172659.sra Written 721470 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra Read 721469 spots for SRR7172659.sra Written 721469 spots for SRR7172659.sra SRR ids: ['SRR7172659.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zswa2qu6 SRR7172659.sra spots: 14429381 blocks: [[1, 721469], [721470, 1442938], [1442939, 2164407], [2164408, 2885876], [2885877, 3607345], [3607346, 4328814], [4328815, 5050283], [5050284, 5771752], [5771753, 6493221], [6493222, 7214690], [7214691, 7936159], [7936160, 8657628], [8657629, 9379097], [9379098, 10100566], [10100567, 10822035], [10822036, 11543504], [11543505, 12264973], [12264974, 12986442], [12986443, 13707911], [13707912, 14429381]] SRR7172659 file size 4867943 SRR7172659 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172659 SRR7172659_1.fastq SRR7172659_2.fastq Input file: SRR7172659_1.fastq Paired file: SRR7172659_2.fastq trimmed: SRR7172659-trimmed-pair1.fastq, SRR7172659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:01:55 2025 >> started Mon Feb 10 17:02:11 2025 >> done (15.800s) 14429381 read pairs processed; of these: 10482 ( 0.07%) short read pairs filtered out after trimming by size control 8080 ( 0.06%) empty read pairs filtered out after trimming by size control 14410819 (99.87%) read pairs available; of these: 6209534 (43.09%) trimmed read pairs available after processing 8201285 (56.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 3 0.00% 38 5 0.00% 39 5 0.00% 40 3 0.00% 41 6 0.00% 42 2 0.00% 43 5 0.00% 44 2 0.00% 45 5 0.00% 46 9 0.00% 47 4 0.00% 48 16 0.00% 49 16 0.00% 50 19 0.00% 51 17 0.00% 52 21 0.00% 53 14 0.00% 54 11 0.00% 55 27 0.00% 56 26 0.00% 57 33 0.00% 58 45 0.00% 59 38 0.00% 60 58 0.00% 61 47 0.00% 62 63 0.00% 63 74 0.00% 64 101 0.00% 65 101 0.00% 66 133 0.00% 67 121 0.00% 68 159 0.00% 69 163 0.00% 70 186 0.00% 71 216 0.00% 72 257 0.00% 73 324 0.00% 74 368 0.00% 75 406 0.00% 76 621 0.00% 77 621 0.00% 78 668 0.00% 79 708 0.00% 80 802 0.01% 81 940 0.01% 82 1050 0.01% 83 1233 0.01% 84 1782 0.01% 85 2283 0.02% 86 2469 0.02% 87 2842 0.02% 88 3185 0.02% 89 3379 0.02% 90 3552 0.02% 91 3899 0.03% 92 4156 0.03% 93 4564 0.03% 94 4908 0.03% 95 5274 0.04% 96 5656 0.04% 97 6173 0.04% 98 6747 0.05% 99 7243 0.05% 100 7591 0.05% 101 8194 0.06% 102 9088 0.06% 103 9705 0.07% 104 10482 0.07% 105 11321 0.08% 106 11967 0.08% 107 12789 0.09% 108 13679 0.09% 109 14396 0.10% 110 15354 0.11% 111 16128 0.11% 112 17068 0.12% 113 17885 0.12% 114 19473 0.14% 115 20845 0.14% 116 21427 0.15% 117 22246 0.15% 118 23530 0.16% 119 24461 0.17% 120 25608 0.18% 121 26980 0.19% 122 28101 0.19% 123 29364 0.20% 124 31131 0.22% 125 32411 0.22% 126 33666 0.23% 127 35197 0.24% 128 36791 0.26% 129 38162 0.26% 130 40243 0.28% 131 41733 0.29% 132 44207 0.31% 133 45827 0.32% 134 48332 0.34% 135 50737 0.35% 136 53269 0.37% 137 56507 0.39% 138 59675 0.41% 139 63586 0.44% 140 67289 0.47% 141 72370 0.50% 142 77899 0.54% 143 85192 0.59% 144 96570 0.67% 145 111978 0.78% 146 137058 0.95% 147 182165 1.26% 148 281254 1.95% 149 579037 4.02% 150 3311647 22.98% 151 8201285 56.91% 14410819 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=29 prefix-density=0.50 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=422.54 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=60.12 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.7 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7172659 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:02:57 Started mapping on | Feb 10 17:02:57 Finished on | Feb 10 17:04:47 Mapping speed, Million of reads per hour | 471.63 Number of input reads | 14410819 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13591111 Uniquely mapped reads % | 94.31% Average mapped length | 295.41 Number of splices: Total | 13873776 Number of splices: Annotated (sjdb) | 13632095 Number of splices: GT/AG | 13662379 Number of splices: GC/AG | 167119 Number of splices: AT/AC | 10822 Number of splices: Non-canonical | 33456 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316023 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 38637 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513094 513094 513094 N_multimapping 316023 316023 316023 N_noFeature 323062 13474647 360879 N_ambiguous 144141 668 65151 UnstrandedReadsAssigned:13123908 PositiveStrandReadsAssigned:115796 NegativeStrandReadsAssigned:13165081 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172659 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172659-trimmed-pair1.fastq SRR7172659-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,410,819 reads, 13,083,376 reads pseudoaligned [quant] estimated average fragment length: 229.601 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7172659.ke.tsv 34699 SRR7172659.se.tsv 87100 total ==> SRR7172659.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.4 1271 45.5073 Potri.005G024800.1.v4.1 1035 806.399 559 44.4125 Potri.004G059700.1.v4.1 961 732.409 15 1.31214 Potri.007G009000.2.v4.1 1416 1187.4 0 0 Potri.003G141000.2.v4.1 2943 2714.4 693 16.357 Potri.016G087400.1.v4.1 270 79.4955 1490 1200.84 Potri.015G069301.1.v4.1 564 337.686 0 0 Potri.010G195200.1.v4.1 1773 1544.4 309 12.8186 Potri.012G127500.1.v4.1 977 748.404 2827 242.01 ==> SRR7172659.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 393 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 60 SRR7172659 completed mapping pipeline successfully